ID: 1103969924

View in Genome Browser
Species Human (GRCh38)
Location 12:124664076-124664098
Sequence ACCCCAGCCCAATCCTCGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103969924_1103969933 20 Left 1103969924 12:124664076-124664098 CCAGGCGAGGATTGGGCTGGGGT No data
Right 1103969933 12:124664119-124664141 GACAGGAGCCCTTTGAAGGCAGG No data
1103969924_1103969927 -7 Left 1103969924 12:124664076-124664098 CCAGGCGAGGATTGGGCTGGGGT No data
Right 1103969927 12:124664092-124664114 CTGGGGTTTGCCCGGGAGCCTGG No data
1103969924_1103969932 16 Left 1103969924 12:124664076-124664098 CCAGGCGAGGATTGGGCTGGGGT No data
Right 1103969932 12:124664115-124664137 TTCAGACAGGAGCCCTTTGAAGG No data
1103969924_1103969929 3 Left 1103969924 12:124664076-124664098 CCAGGCGAGGATTGGGCTGGGGT No data
Right 1103969929 12:124664102-124664124 CCCGGGAGCCTGGTTCAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103969924 Original CRISPR ACCCCAGCCCAATCCTCGCC TGG (reversed) Intergenic
No off target data available for this crispr