ID: 1103969929

View in Genome Browser
Species Human (GRCh38)
Location 12:124664102-124664124
Sequence CCCGGGAGCCTGGTTCAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103969924_1103969929 3 Left 1103969924 12:124664076-124664098 CCAGGCGAGGATTGGGCTGGGGT No data
Right 1103969929 12:124664102-124664124 CCCGGGAGCCTGGTTCAGACAGG No data
1103969917_1103969929 17 Left 1103969917 12:124664062-124664084 CCGAGTGTGTTTTTCCAGGCGAG No data
Right 1103969929 12:124664102-124664124 CCCGGGAGCCTGGTTCAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103969929 Original CRISPR CCCGGGAGCCTGGTTCAGAC AGG Intergenic
No off target data available for this crispr