ID: 1103970031

View in Genome Browser
Species Human (GRCh38)
Location 12:124664757-124664779
Sequence AACTGGCTTGATATAGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103970031_1103970038 27 Left 1103970031 12:124664757-124664779 CCTGTCTCTATATCAAGCCAGTT No data
Right 1103970038 12:124664807-124664829 TTATCTCACTGTTGCAATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103970031 Original CRISPR AACTGGCTTGATATAGAGAC AGG (reversed) Intergenic