ID: 1103974227

View in Genome Browser
Species Human (GRCh38)
Location 12:124691728-124691750
Sequence CTTTAAAAGGTGAAAGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103974227_1103974238 25 Left 1103974227 12:124691728-124691750 CCACCCACTTTCACCTTTTAAAG No data
Right 1103974238 12:124691776-124691798 GACATCCACTTACATCTTATTGG No data
1103974227_1103974232 3 Left 1103974227 12:124691728-124691750 CCACCCACTTTCACCTTTTAAAG No data
Right 1103974232 12:124691754-124691776 TTTTATGGAAGCCCCACCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103974227 Original CRISPR CTTTAAAAGGTGAAAGTGGG TGG (reversed) Intergenic
No off target data available for this crispr