ID: 1103975652

View in Genome Browser
Species Human (GRCh38)
Location 12:124701031-124701053
Sequence CCTTCGGATGTGCAGATGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103975652_1103975659 7 Left 1103975652 12:124701031-124701053 CCGGCCATCTGCACATCCGAAGG No data
Right 1103975659 12:124701061-124701083 GCGTGTCCCTTGGCAACACAAGG No data
1103975652_1103975657 -3 Left 1103975652 12:124701031-124701053 CCGGCCATCTGCACATCCGAAGG No data
Right 1103975657 12:124701051-124701073 AGGGCATCCAGCGTGTCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103975652 Original CRISPR CCTTCGGATGTGCAGATGGC CGG (reversed) Intergenic
No off target data available for this crispr