ID: 1103976095

View in Genome Browser
Species Human (GRCh38)
Location 12:124703714-124703736
Sequence GATGATTAAGATGGAAAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103976089_1103976095 22 Left 1103976089 12:124703669-124703691 CCCTATAAAAGGGAGACAGTTCA No data
Right 1103976095 12:124703714-124703736 GATGATTAAGATGGAAAAAGGGG No data
1103976090_1103976095 21 Left 1103976090 12:124703670-124703692 CCTATAAAAGGGAGACAGTTCAG No data
Right 1103976095 12:124703714-124703736 GATGATTAAGATGGAAAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103976095 Original CRISPR GATGATTAAGATGGAAAAAG GGG Intergenic
No off target data available for this crispr