ID: 1103980749

View in Genome Browser
Species Human (GRCh38)
Location 12:124735526-124735548
Sequence CTTTGGAAGGCCAAGGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 274879
Summary {0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103980743_1103980749 -8 Left 1103980743 12:124735511-124735533 CCTGTAATCCCAGCACTTTGGAA 0: 9594
1: 299194
2: 262940
3: 149017
4: 131705
Right 1103980749 12:124735526-124735548 CTTTGGAAGGCCAAGGTGGACGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
1103980741_1103980749 11 Left 1103980741 12:124735492-124735514 CCAGGAGCAGTGGCTTACGCCTG 0: 26
1: 1319
2: 22438
3: 88934
4: 130258
Right 1103980749 12:124735526-124735548 CTTTGGAAGGCCAAGGTGGACGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103980749 Original CRISPR CTTTGGAAGGCCAAGGTGGA CGG Intergenic
Too many off-targets to display for this crispr