ID: 1103981186

View in Genome Browser
Species Human (GRCh38)
Location 12:124738032-124738054
Sequence TTGTACAGATGGGGAAACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 25885
Summary {0: 16, 1: 350, 2: 2422, 3: 7760, 4: 15337}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103981186_1103981195 20 Left 1103981186 12:124738032-124738054 CCTCAGTTTCCCCATCTGTACAA 0: 16
1: 350
2: 2422
3: 7760
4: 15337
Right 1103981195 12:124738075-124738097 AGATCATGGTGAAGGCTAAATGG No data
1103981186_1103981192 6 Left 1103981186 12:124738032-124738054 CCTCAGTTTCCCCATCTGTACAA 0: 16
1: 350
2: 2422
3: 7760
4: 15337
Right 1103981192 12:124738061-124738083 CAGTAACACCTCAAAGATCATGG No data
1103981186_1103981196 23 Left 1103981186 12:124738032-124738054 CCTCAGTTTCCCCATCTGTACAA 0: 16
1: 350
2: 2422
3: 7760
4: 15337
Right 1103981196 12:124738078-124738100 TCATGGTGAAGGCTAAATGGAGG No data
1103981186_1103981193 12 Left 1103981186 12:124738032-124738054 CCTCAGTTTCCCCATCTGTACAA 0: 16
1: 350
2: 2422
3: 7760
4: 15337
Right 1103981193 12:124738067-124738089 CACCTCAAAGATCATGGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103981186 Original CRISPR TTGTACAGATGGGGAAACTG AGG (reversed) Intergenic
Too many off-targets to display for this crispr