ID: 1103981190

View in Genome Browser
Species Human (GRCh38)
Location 12:124738042-124738064
Sequence ACTGTTCCCATTGTACAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103981190_1103981193 2 Left 1103981190 12:124738042-124738064 CCCATCTGTACAATGGGAACAGT No data
Right 1103981193 12:124738067-124738089 CACCTCAAAGATCATGGTGAAGG No data
1103981190_1103981198 23 Left 1103981190 12:124738042-124738064 CCCATCTGTACAATGGGAACAGT No data
Right 1103981198 12:124738088-124738110 GGCTAAATGGAGGCAATGAAGGG No data
1103981190_1103981196 13 Left 1103981190 12:124738042-124738064 CCCATCTGTACAATGGGAACAGT No data
Right 1103981196 12:124738078-124738100 TCATGGTGAAGGCTAAATGGAGG No data
1103981190_1103981192 -4 Left 1103981190 12:124738042-124738064 CCCATCTGTACAATGGGAACAGT No data
Right 1103981192 12:124738061-124738083 CAGTAACACCTCAAAGATCATGG No data
1103981190_1103981195 10 Left 1103981190 12:124738042-124738064 CCCATCTGTACAATGGGAACAGT No data
Right 1103981195 12:124738075-124738097 AGATCATGGTGAAGGCTAAATGG No data
1103981190_1103981197 22 Left 1103981190 12:124738042-124738064 CCCATCTGTACAATGGGAACAGT No data
Right 1103981197 12:124738087-124738109 AGGCTAAATGGAGGCAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103981190 Original CRISPR ACTGTTCCCATTGTACAGAT GGG (reversed) Intergenic
No off target data available for this crispr