ID: 1103981191

View in Genome Browser
Species Human (GRCh38)
Location 12:124738043-124738065
Sequence TACTGTTCCCATTGTACAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103981191_1103981193 1 Left 1103981191 12:124738043-124738065 CCATCTGTACAATGGGAACAGTA No data
Right 1103981193 12:124738067-124738089 CACCTCAAAGATCATGGTGAAGG No data
1103981191_1103981195 9 Left 1103981191 12:124738043-124738065 CCATCTGTACAATGGGAACAGTA No data
Right 1103981195 12:124738075-124738097 AGATCATGGTGAAGGCTAAATGG No data
1103981191_1103981197 21 Left 1103981191 12:124738043-124738065 CCATCTGTACAATGGGAACAGTA No data
Right 1103981197 12:124738087-124738109 AGGCTAAATGGAGGCAATGAAGG No data
1103981191_1103981192 -5 Left 1103981191 12:124738043-124738065 CCATCTGTACAATGGGAACAGTA No data
Right 1103981192 12:124738061-124738083 CAGTAACACCTCAAAGATCATGG No data
1103981191_1103981196 12 Left 1103981191 12:124738043-124738065 CCATCTGTACAATGGGAACAGTA No data
Right 1103981196 12:124738078-124738100 TCATGGTGAAGGCTAAATGGAGG No data
1103981191_1103981198 22 Left 1103981191 12:124738043-124738065 CCATCTGTACAATGGGAACAGTA No data
Right 1103981198 12:124738088-124738110 GGCTAAATGGAGGCAATGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103981191 Original CRISPR TACTGTTCCCATTGTACAGA TGG (reversed) Intergenic
No off target data available for this crispr