ID: 1103981192

View in Genome Browser
Species Human (GRCh38)
Location 12:124738061-124738083
Sequence CAGTAACACCTCAAAGATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103981190_1103981192 -4 Left 1103981190 12:124738042-124738064 CCCATCTGTACAATGGGAACAGT No data
Right 1103981192 12:124738061-124738083 CAGTAACACCTCAAAGATCATGG No data
1103981189_1103981192 -3 Left 1103981189 12:124738041-124738063 CCCCATCTGTACAATGGGAACAG No data
Right 1103981192 12:124738061-124738083 CAGTAACACCTCAAAGATCATGG No data
1103981191_1103981192 -5 Left 1103981191 12:124738043-124738065 CCATCTGTACAATGGGAACAGTA No data
Right 1103981192 12:124738061-124738083 CAGTAACACCTCAAAGATCATGG No data
1103981186_1103981192 6 Left 1103981186 12:124738032-124738054 CCTCAGTTTCCCCATCTGTACAA 0: 16
1: 350
2: 2422
3: 7760
4: 15337
Right 1103981192 12:124738061-124738083 CAGTAACACCTCAAAGATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103981192 Original CRISPR CAGTAACACCTCAAAGATCA TGG Intergenic
No off target data available for this crispr