ID: 1103984637

View in Genome Browser
Species Human (GRCh38)
Location 12:124759178-124759200
Sequence GGGAAGGGCACCCTGGAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103984637_1103984642 -4 Left 1103984637 12:124759178-124759200 CCAGTCTCCAGGGTGCCCTTCCC No data
Right 1103984642 12:124759197-124759219 TCCCCATCCCCCAAATCAGAGGG No data
1103984637_1103984641 -5 Left 1103984637 12:124759178-124759200 CCAGTCTCCAGGGTGCCCTTCCC No data
Right 1103984641 12:124759196-124759218 TTCCCCATCCCCCAAATCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103984637 Original CRISPR GGGAAGGGCACCCTGGAGAC TGG (reversed) Intergenic
No off target data available for this crispr