ID: 1103984862

View in Genome Browser
Species Human (GRCh38)
Location 12:124760475-124760497
Sequence GTGAACGACCTGACTTCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103984857_1103984862 4 Left 1103984857 12:124760448-124760470 CCTGGGCTCACAGGCTGGTCACC No data
Right 1103984862 12:124760475-124760497 GTGAACGACCTGACTTCTCTGGG No data
1103984852_1103984862 23 Left 1103984852 12:124760429-124760451 CCTTGGAGTCAGACGGCAGCCTG No data
Right 1103984862 12:124760475-124760497 GTGAACGACCTGACTTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103984862 Original CRISPR GTGAACGACCTGACTTCTCT GGG Intergenic
No off target data available for this crispr