ID: 1103987408

View in Genome Browser
Species Human (GRCh38)
Location 12:124777267-124777289
Sequence GACATGCCCCGTGTTGTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 67}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103987408_1103987414 24 Left 1103987408 12:124777267-124777289 CCTAGAACAACACGGGGCATGTC 0: 1
1: 0
2: 0
3: 5
4: 67
Right 1103987414 12:124777314-124777336 AAATGCACAGAAACACATCCAGG 0: 1
1: 0
2: 3
3: 52
4: 338
1103987408_1103987411 -9 Left 1103987408 12:124777267-124777289 CCTAGAACAACACGGGGCATGTC 0: 1
1: 0
2: 0
3: 5
4: 67
Right 1103987411 12:124777281-124777303 GGGCATGTCCTATGGGCACCAGG 0: 1
1: 0
2: 1
3: 15
4: 134
1103987408_1103987416 26 Left 1103987408 12:124777267-124777289 CCTAGAACAACACGGGGCATGTC 0: 1
1: 0
2: 0
3: 5
4: 67
Right 1103987416 12:124777316-124777338 ATGCACAGAAACACATCCAGGGG 0: 1
1: 1
2: 1
3: 32
4: 296
1103987408_1103987417 27 Left 1103987408 12:124777267-124777289 CCTAGAACAACACGGGGCATGTC 0: 1
1: 0
2: 0
3: 5
4: 67
Right 1103987417 12:124777317-124777339 TGCACAGAAACACATCCAGGGGG 0: 1
1: 0
2: 2
3: 29
4: 267
1103987408_1103987415 25 Left 1103987408 12:124777267-124777289 CCTAGAACAACACGGGGCATGTC 0: 1
1: 0
2: 0
3: 5
4: 67
Right 1103987415 12:124777315-124777337 AATGCACAGAAACACATCCAGGG 0: 1
1: 0
2: 3
3: 40
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103987408 Original CRISPR GACATGCCCCGTGTTGTTCT AGG (reversed) Intronic
906840991 1:49139088-49139110 GATTTGCCCCTTGCTGTTCTTGG - Intronic
906929796 1:50158152-50158174 TATATGCCAGGTGTTGTTCTGGG - Intronic
907829491 1:58050942-58050964 TACATGCTACATGTTGTTCTAGG + Intronic
908502779 1:64760766-64760788 GACATCCCAAATGTTGTTCTTGG + Intronic
908689762 1:66765516-66765538 GACATGCCTTGTGTTTATCTAGG + Intronic
912952344 1:114128532-114128554 GACACGGGCCGTGTTATTCTGGG - Intronic
918186291 1:182130387-182130409 CACTTGCCCTGGGTTGTTCTGGG - Intergenic
1074087209 10:110217419-110217441 GACATGCCCAGGGCTGCTCTGGG + Intronic
1075448926 10:122533929-122533951 GCCAGGCCCAATGTTGTTCTTGG + Intergenic
1084062606 11:66685995-66686017 GTCATGCCCCGGGTGGTGCTGGG + Exonic
1085711135 11:78830187-78830209 GAAATGCCCCGGGGGGTTCTAGG - Intronic
1100244459 12:92743254-92743276 GACATGCCATGTGTTGTTTCGGG - Intronic
1103987408 12:124777267-124777289 GACATGCCCCGTGTTGTTCTAGG - Intronic
1105474691 13:20719981-20720003 GATATATCCCGTGTTGTTCCAGG - Intronic
1113431752 13:110256495-110256517 GACATCCTCCCTGTGGTTCTGGG - Intronic
1116509853 14:45731360-45731382 TACATGCCCGGTGTTGCGCTGGG + Intergenic
1119133603 14:72196497-72196519 GACATGCCCCCTGTTCCTCCTGG + Intronic
1121812530 14:96903963-96903985 GTGATGCCCTGTGTGGTTCTGGG + Intronic
1133851220 16:9505664-9505686 GACATCCCCCTTGCTGTTCTTGG - Intergenic
1137715434 16:50595514-50595536 GACATGCCCCTGGGTGTTCCTGG - Intronic
1141400726 16:83744760-83744782 GACAGTCCCAGTGGTGTTCTGGG - Intronic
1145042030 17:19584048-19584070 GACATGGAGCGTGGTGTTCTGGG + Intergenic
1146374848 17:32287170-32287192 CACATGCCCAGTGCTGTGCTGGG - Intronic
1152485282 17:80587079-80587101 GACAAGCCCCGTGTTGTTTCTGG - Intronic
1157478007 18:48035722-48035744 CACATGCTCCCTGTTCTTCTAGG + Intronic
1162326049 19:10000299-10000321 GACATGCTCCATTTTGGTCTTGG - Intronic
926203314 2:10816876-10816898 CACATGCCCAGTGTGGGTCTTGG - Intronic
927693914 2:25227404-25227426 CAAATGCCCCGATTTGTTCTGGG + Intergenic
936016480 2:108962909-108962931 GACAATCCCAGTGTTGTTCTAGG + Intronic
936019540 2:108984334-108984356 CTCACGCCCTGTGTTGTTCTGGG - Intronic
936047149 2:109196738-109196760 CACATGCCCCGTGGCCTTCTGGG + Intronic
938165972 2:129027284-129027306 GCCATGCCCCGCCTTGTGCTGGG + Intergenic
942748470 2:179263666-179263688 GACAGCCCCCGTGGTTTTCTTGG - Intronic
945132271 2:206585668-206585690 CACATGCCTGGTGTTGTTGTAGG + Intronic
948057383 2:235018748-235018770 GTCATACCTGGTGTTGTTCTGGG + Intronic
1170612450 20:17925764-17925786 GATAAACCCCGTGTTGTTTTAGG - Intergenic
1172744078 20:37193247-37193269 CACATGCCAGGTGCTGTTCTAGG - Intronic
1182555882 22:31128077-31128099 GACATGCTCTGTGTGCTTCTGGG - Intronic
1184245093 22:43231720-43231742 GCCATGCCCCGGGTGGCTCTCGG - Intronic
1185086651 22:48744469-48744491 GCCATGACCCGTGTGGTTCGTGG + Intronic
950154475 3:10711247-10711269 GCCATTCCCAGTTTTGTTCTCGG - Intergenic
953914458 3:46909504-46909526 GACACGGCCCCTGCTGTTCTGGG + Intergenic
956887001 3:73570180-73570202 TACATGCCCATTGTTGTCCTTGG - Intronic
962109604 3:132430423-132430445 GTCATGCCCCGTGTTTTTTATGG + Intronic
963246022 3:143063670-143063692 GACATGCTACGTATTTTTCTGGG - Intergenic
964709052 3:159652457-159652479 GACCTGCCCTGTGTTTTCCTTGG + Intronic
965958977 3:174406234-174406256 TAAATGCCCCTTTTTGTTCTGGG + Intergenic
969321897 4:6417529-6417551 AACATGCCCCGTGATGTCTTTGG - Intronic
969509284 4:7608469-7608491 TACATGCCAGGTGTTGTCCTGGG - Intronic
969869894 4:10098086-10098108 GGCTTGCCCCATCTTGTTCTTGG - Intronic
970344560 4:15141007-15141029 GACATGAGCCGTGTGGCTCTGGG - Intergenic
985723854 5:1505504-1505526 TTCATGCCCCGTGTTGTTTGGGG - Intronic
996658270 5:125967502-125967524 GAAATGCCAGGGGTTGTTCTAGG + Intergenic
999830062 5:155310201-155310223 GACTTGCTCTGTGTAGTTCTAGG + Intergenic
1002952937 6:1833291-1833313 GATGTGTCCAGTGTTGTTCTGGG - Intronic
1003853426 6:10248151-10248173 AACAACCCCCGTGTTGTTCAAGG - Intergenic
1004947274 6:20629773-20629795 GAGATGCCCCATGTTCTTCTTGG + Intronic
1013370945 6:109470519-109470541 GTCATGCCCCATGTTATTCTGGG - Intronic
1015076027 6:129158691-129158713 CACATGCCCCCTGTTGTCATAGG - Intronic
1016873636 6:148842888-148842910 GACATACTCTGTGTGGTTCTGGG + Intronic
1017904914 6:158751341-158751363 GACATGTCCTGTCCTGTTCTAGG - Intronic
1020117490 7:5484059-5484081 CACATGACCCGTGGTGTTCACGG - Intronic
1030268236 7:107642883-107642905 GACAAGGCCTGTGTTGTCCTTGG - Intergenic
1034162588 7:149004151-149004173 GACGGGTCCCTTGTTGTTCTTGG + Exonic
1046357718 8:113109908-113109930 GACATAGCCCATGTCGTTCTAGG + Intronic
1046529110 8:115420908-115420930 GACTTGCCCAGTGTTGTACCTGG - Intronic
1047018252 8:120746481-120746503 CCCAAGCCCCGTGTTGTTCAAGG + Intronic
1047277603 8:123417351-123417373 TATATGCCACGCGTTGTTCTGGG + Intronic
1049750101 8:144279061-144279083 GTCATGGCCCGTGGTGGTCTTGG - Intronic
1056430891 9:86526791-86526813 CACATGCCCAGTGTTCTTCAAGG - Intergenic
1194120115 X:89951483-89951505 AACATGCCACTTGTTGTTCAGGG + Intergenic
1200472977 Y:3609004-3609026 AACATGCCACTTGTTGTTCAGGG + Intergenic
1200921955 Y:8621057-8621079 GCCAGGCTCCGTGTTTTTCTGGG + Intergenic