ID: 1103987411

View in Genome Browser
Species Human (GRCh38)
Location 12:124777281-124777303
Sequence GGGCATGTCCTATGGGCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 134}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103987403_1103987411 20 Left 1103987403 12:124777238-124777260 CCATTTATGTAACGAGCAGAAAG 0: 1
1: 0
2: 1
3: 11
4: 119
Right 1103987411 12:124777281-124777303 GGGCATGTCCTATGGGCACCAGG 0: 1
1: 0
2: 1
3: 15
4: 134
1103987408_1103987411 -9 Left 1103987408 12:124777267-124777289 CCTAGAACAACACGGGGCATGTC 0: 1
1: 0
2: 0
3: 5
4: 67
Right 1103987411 12:124777281-124777303 GGGCATGTCCTATGGGCACCAGG 0: 1
1: 0
2: 1
3: 15
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103987411 Original CRISPR GGGCATGTCCTATGGGCACC AGG Intronic
900459653 1:2796714-2796736 GTGCCTGTGCTCTGGGCACCCGG + Intronic
900697095 1:4019256-4019278 GGGCATGGGCGATGGGCAGCGGG - Intergenic
901638283 1:10680352-10680374 GGGCCTGTCTTCTGGACACCAGG + Intronic
904212801 1:28897077-28897099 GGGCAAGGCCTGTGGCCACCAGG + Intronic
905855932 1:41313886-41313908 GGGCTTGTCCTCTTGGGACCTGG - Intergenic
906205672 1:43985181-43985203 GGGAATGTCCAATGGGGTCCAGG - Intronic
909293730 1:73916857-73916879 GTGCATGTCCTATGGCTACACGG + Intergenic
919659821 1:200233625-200233647 TGGCATGTCCCTTGGGCTCCAGG - Intergenic
922802372 1:228370291-228370313 GGGCAGGGCCTCTGGGCAACAGG + Intronic
1064389116 10:14926135-14926157 GGGCATGTCCTTAGAGCAGCAGG + Intronic
1067061598 10:43080649-43080671 TGGGATGTCCTGAGGGCACCTGG - Intronic
1067739275 10:48882174-48882196 GGGCATGCCCTGGGGGAACCTGG + Intronic
1070681584 10:78452823-78452845 AGGCATGTCCTTCAGGCACCTGG + Intergenic
1070794633 10:79209570-79209592 GGGCATGGCCCACGGGCACCAGG + Intronic
1072693134 10:97584517-97584539 GGGCAAGGCCTATAGGCCCCAGG - Exonic
1073039299 10:100590139-100590161 GCATATGTCCTATGGGCACTTGG - Intergenic
1076740107 10:132478658-132478680 GGTCACGTCCTCTGGGCCCCAGG - Intergenic
1077155933 11:1090773-1090795 GGGCCTGTCCTTGGGGCACCGGG - Intergenic
1079389177 11:20006286-20006308 TGGCATGACCTGTGGGAACCTGG - Intronic
1081692852 11:45089753-45089775 GGTCATGTGCTCTGAGCACCTGG - Intergenic
1081772981 11:45661215-45661237 GGGCAGGTCCCAAGGGCCCCGGG + Intronic
1084453262 11:69252366-69252388 GGGCACCTCCTGTGGGAACCGGG + Intergenic
1084735015 11:71099208-71099230 GGGAATGTCATGTGGGAACCCGG + Intronic
1084793895 11:71491564-71491586 GGGCCAGTCCACTGGGCACCGGG - Intronic
1084858926 11:72005688-72005710 GCTCTTGTCCTTTGGGCACCAGG - Intronic
1085470492 11:76754280-76754302 TGGCCTGTCCCAAGGGCACCAGG - Intergenic
1085569779 11:77549415-77549437 GGGCCTGTTCAATGGTCACCAGG - Intronic
1085784492 11:79438566-79438588 GGGCATCTCCAAGGGGGACCAGG + Intronic
1093625557 12:21343007-21343029 GGGTATGTCCTGTGGGCAGTAGG + Intronic
1095961711 12:47838968-47838990 GGACATGTCCTATGGGCCACAGG + Intergenic
1099087616 12:78264691-78264713 GGGCATGTTCTCTGGGGCCCAGG - Intergenic
1100398259 12:94203759-94203781 GTGCCTGGCCTATGGGCACTAGG + Intronic
1101412688 12:104482369-104482391 GGCCATGTCAAATGGGCAGCTGG + Intronic
1101656995 12:106731124-106731146 GGAGATGTCCTATTGGGACCTGG + Intronic
1103146480 12:118599495-118599517 GGGCTTGTCCTAAGGGCAATAGG - Intergenic
1103623349 12:122201665-122201687 GGGCTTGTCCTGTGGGGAGCTGG + Intronic
1103987411 12:124777281-124777303 GGGCATGTCCTATGGGCACCAGG + Intronic
1104812894 12:131629032-131629054 GGGCACGGCCAAAGGGCACCCGG - Intergenic
1112109201 13:96275992-96276014 GGGCAAGTCCTAATGGAACCAGG - Intronic
1113565155 13:111315492-111315514 GGGCATGTCCCAGCAGCACCTGG + Intergenic
1113588775 13:111483560-111483582 GAGCAAGTCCTATGCACACCTGG - Intergenic
1114657171 14:24323116-24323138 GGGCATGTCCCATAGGCAGAGGG + Intronic
1116509188 14:45722544-45722566 GGTCATGTCCAATTGGCAACTGG + Intergenic
1117016538 14:51524199-51524221 AGGCATGTCCTTTGGGCAAGTGG + Intronic
1122122965 14:99564365-99564387 GGGCATGTCCTGGGGTCAGCTGG - Intronic
1122660802 14:103293686-103293708 GGGACTGTCCTATGGCCAGCAGG - Intergenic
1122714443 14:103686077-103686099 GGGCATATCCTAGGGAGACCCGG - Intergenic
1122974849 14:105166892-105166914 GGGAAGGACCTCTGGGCACCAGG + Intronic
1125501014 15:40240359-40240381 GGGCATGCCCTGTGGGGACCAGG - Intronic
1128739908 15:70076560-70076582 GCTCATGTCCTATTGGCACTGGG - Intronic
1129269331 15:74411188-74411210 GGCCTTGTCCTGTGGGCCCCAGG - Intronic
1130329561 15:82910762-82910784 GGGCCTGTTCAATGGTCACCAGG + Intronic
1130865665 15:87931269-87931291 GGGCATGCCCTTTGGGCCCCAGG + Intronic
1130959259 15:88648943-88648965 GGGCAGGTCCTGTGGCCAGCAGG + Intronic
1132458596 16:38157-38179 GGGACTGTCCTGTGGGTACCTGG - Intergenic
1135666901 16:24343503-24343525 TGGCATGTCCCAGGGGCACCTGG - Intronic
1136074223 16:27805910-27805932 GGGCTTGTCTTAGGGGCATCTGG - Intronic
1137551485 16:49440536-49440558 GGGCCTGTCCTCTGGGCTACAGG + Intergenic
1141423122 16:83930150-83930172 GGGCCAGGCCTGTGGGCACCTGG - Intronic
1142380436 16:89729005-89729027 AGCCATGTGCTCTGGGCACCAGG - Intronic
1142497359 17:313421-313443 GGGCATGTTCAAGGGGCACATGG - Intronic
1142639986 17:1280190-1280212 GGCCATCTCCGAGGGGCACCTGG + Exonic
1149784569 17:59424197-59424219 GGGCATGTGCCAGGGGCACAAGG - Intergenic
1150287627 17:63962858-63962880 TGGCAGGGCATATGGGCACCTGG + Intronic
1150716016 17:67573189-67573211 GGGGATGGCCAGTGGGCACCTGG + Intronic
1152904044 17:82960845-82960867 GGGCATTTCCCAAGGGCGCCAGG - Intronic
1152962538 18:88407-88429 GGGACTGTCCTATGGGTACCTGG - Intergenic
1160128744 18:76205082-76205104 GGGACTGTCCTATGGACAACTGG + Intergenic
1160422254 18:78755174-78755196 GGTAATGACCTCTGGGCACCAGG - Intergenic
1161112345 19:2477358-2477380 TGGCATGTCCCGTGGGCAGCCGG + Intronic
1163369427 19:16893693-16893715 GGGCTGGTCCTCTGGGCACGAGG + Intronic
1163746530 19:19052107-19052129 GGGCATGGCCAAAGGGCACACGG - Exonic
926492624 2:13543624-13543646 GGGAGTGTGCTATTGGCACCTGG + Intergenic
932237699 2:70134289-70134311 GTGCAGGGCCTATGGGCACTGGG - Intergenic
938693783 2:133816207-133816229 GGGCCTGTCCTCAGGGCCCCTGG - Intergenic
941986682 2:171517617-171517639 GGACATGTCCTACGAGCAGCTGG - Intergenic
944301319 2:198128178-198128200 GGACCTGTCCTATGGGGACAAGG + Intronic
947573474 2:231253605-231253627 AGGCATGTCCGCTGGGGACCTGG + Intronic
947577461 2:231287183-231287205 GGGCCTGTGCTGTGGGCCCCAGG - Intronic
948458156 2:238116838-238116860 GGGCCAGTCCCATGGGCACCTGG + Intronic
948889417 2:240899762-240899784 GGGCATGTGCTCTGGGCGTCAGG - Intergenic
1168768361 20:397413-397435 GGGTCTGTCCTGTGGCCACCTGG + Exonic
1170411474 20:16096660-16096682 AGGCATTGCCTATGGGCCCCAGG + Intergenic
1172991325 20:39039052-39039074 GGGCATGTCTGATGGGCACAGGG + Exonic
1173513395 20:43648059-43648081 GGTTGTGTCCTATGGGCAACTGG - Intergenic
1174583893 20:51592727-51592749 GGGCATGTCGGAGGGGCACAGGG - Intergenic
1174946099 20:54987468-54987490 AGGCATGAGCTATGGGCACCTGG - Intergenic
1175447304 20:59032146-59032168 CTGCATGACCTCTGGGCACCGGG + Intronic
1175870248 20:62205936-62205958 GGGCTGGTGCTGTGGGCACCAGG - Intergenic
1175989936 20:62783595-62783617 GGGCATGGCCTACGAGCTCCTGG - Intergenic
1181470442 22:23135922-23135944 GGGCACTTCCTGTGGGCACTTGG - Intronic
1184356911 22:43987502-43987524 CTGCATGTGGTATGGGCACCAGG + Intronic
1184363529 22:44033441-44033463 GGGCAACTCACATGGGCACCAGG + Intronic
1184639092 22:45859550-45859572 GGCCATGTCCTGAGGGCAGCGGG - Intergenic
1185050219 22:48550499-48550521 CGGCATTTCCCAGGGGCACCTGG - Intronic
1185284981 22:49996085-49996107 GGGCATGTCCTGTGGGCAGCAGG + Exonic
1185337724 22:50278263-50278285 GGGCATGGCCTGTGGGGAGCGGG + Exonic
954301411 3:49702619-49702641 GGGCATGTTCTGTGGACACCAGG - Exonic
956017158 3:64895652-64895674 GGGCATGTCCTAGGGACCCGAGG + Intergenic
959608884 3:108271756-108271778 GGGCATGTAGTATGTGCATCTGG + Intergenic
964188459 3:153975464-153975486 GAGCATGGCCTTTGGGCAGCTGG - Intergenic
965142111 3:164851319-164851341 GAGCATTTCCTTTGGGCAGCTGG - Intergenic
968920685 4:3520961-3520983 GGACTTGTCCTGTTGGCACCAGG - Intronic
968979459 4:3838902-3838924 AGGCATGTCCTGGGTGCACCTGG + Intergenic
971500272 4:27311493-27311515 GGCAATGGCCTATGGGAACCAGG - Intergenic
978333875 4:107645020-107645042 GGGCATGTCCATTGTGCACTGGG + Exonic
980128789 4:128799200-128799222 GGGCCTGTTCAATGGCCACCAGG + Intergenic
981212867 4:142129575-142129597 GGACATATCCTAGGGGCACAGGG + Intronic
989189434 5:38655663-38655685 GGGAAGGTCATATGGGCACATGG - Intergenic
1001938607 5:175725273-175725295 GGGCCTGTTCGATGGTCACCAGG + Intergenic
1004509561 6:16274308-16274330 GTGCATGTCCTAAAGCCACCAGG - Intronic
1005972837 6:30774906-30774928 TGGCGTGTCCTCTGGGCAGCTGG - Intergenic
1012594424 6:101023481-101023503 GAGCATGCCATATGGGCACCTGG + Intergenic
1014696287 6:124625368-124625390 CGGCATCTCCTCTGGGTACCTGG - Intronic
1016290912 6:142527265-142527287 GCACATCTCCTTTGGGCACCAGG + Intergenic
1017831615 6:158135656-158135678 GGGAATGTCCTTGGGGCATCAGG + Intronic
1019207934 6:170378347-170378369 GGGCTTGACCTGTGGACACCTGG + Intronic
1019224782 6:170500868-170500890 AGGCATGTCCCATGGCCATCAGG + Intergenic
1019224860 6:170501263-170501285 GGGCATGTCCCACGGCCATCAGG + Intergenic
1019225080 6:170502337-170502359 GGGCATGTCCTACAGCCATCTGG + Intergenic
1020002870 7:4765584-4765606 GGGCCTGTTCTCTGGTCACCAGG + Exonic
1020058620 7:5135837-5135859 GGGCTTGTCCTCTGAGCACCAGG + Intergenic
1020084213 7:5301888-5301910 TGGGATGTCCCATGGGCACCTGG - Intronic
1023864208 7:44231205-44231227 GGGCATGTCCCCTGAGCCCCTGG - Intronic
1034470005 7:151249894-151249916 GGGCGTGGCCTTTGGGGACCTGG - Intronic
1039740772 8:40380637-40380659 AGGCATGTCCTATGAGCAGAAGG - Intergenic
1040040801 8:42915170-42915192 GGGACTGTCCGATGGTCACCAGG + Intronic
1040594613 8:48825320-48825342 GGAAATGACCTGTGGGCACCCGG - Intergenic
1040892378 8:52330683-52330705 GGGCATGCCCTGTGCTCACCTGG + Intronic
1044245816 8:89944165-89944187 GGGCCTGTTCCATGGTCACCAGG - Intronic
1045710589 8:104978818-104978840 TGGCTTTTCCTATGGGTACCCGG + Intronic
1045825748 8:106395930-106395952 GGGCATGTCACAGGGGCACAGGG + Intronic
1049017783 8:139933146-139933168 GGGCATGTCCTCAAGGCAGCTGG - Exonic
1050990522 9:12145700-12145722 GGGCCTGTTCAATGGTCACCAGG - Intergenic
1052038229 9:23707469-23707491 AGCCATGTCCCATGGGCTCCAGG + Intronic
1053154638 9:35768434-35768456 GGGCATTCCCTATGTGCAACAGG + Intergenic
1054463469 9:65479199-65479221 GGGCACCCCCTCTGGGCACCAGG + Intergenic
1055812297 9:80163086-80163108 AGGCTTGTCCTATGGGTAACAGG - Intergenic
1057730237 9:97602177-97602199 GGGCATATGCTGTGGCCACCAGG + Exonic
1058908289 9:109498444-109498466 ACGCATCTCCTAGGGGCACCGGG + Intergenic
1060943273 9:127555637-127555659 GGGCAAGTCCTGTGCCCACCTGG - Intronic
1061290559 9:129648565-129648587 GGGCAAGTCCCCAGGGCACCGGG + Intergenic
1061818493 9:133209608-133209630 GGGCAAGTCCTCTGGGGAACTGG + Intergenic
1062241958 9:135545754-135545776 GGGCAAGTCCTCTGGGGAACTGG - Intergenic
1062735602 9:138135710-138135732 GGGACTGTCCTATGGGTACCTGG + Intergenic
1186373187 X:8967721-8967743 GGGCCTGTTCAATGGTCACCAGG + Intergenic
1187190769 X:17032718-17032740 GGGCATGTCCTCTGGGTCCTGGG + Intronic
1191134013 X:57044295-57044317 GAGCATGTCCTGAGGGCACAAGG - Intergenic
1192175461 X:68882307-68882329 GGGCATGGACTCTGGGGACCTGG - Intergenic
1192208712 X:69113014-69113036 GGGCATGGACCCTGGGCACCTGG + Intergenic
1199760174 X:150898863-150898885 GGGCGTGGCCTGCGGGCACCCGG + Intergenic