ID: 1103987414

View in Genome Browser
Species Human (GRCh38)
Location 12:124777314-124777336
Sequence AAATGCACAGAAACACATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 394
Summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 338}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103987413_1103987414 -8 Left 1103987413 12:124777299-124777321 CCAGGATTTGTAGATAAATGCAC 0: 1
1: 0
2: 1
3: 11
4: 130
Right 1103987414 12:124777314-124777336 AAATGCACAGAAACACATCCAGG 0: 1
1: 0
2: 3
3: 52
4: 338
1103987408_1103987414 24 Left 1103987408 12:124777267-124777289 CCTAGAACAACACGGGGCATGTC 0: 1
1: 0
2: 0
3: 5
4: 67
Right 1103987414 12:124777314-124777336 AAATGCACAGAAACACATCCAGG 0: 1
1: 0
2: 3
3: 52
4: 338
1103987412_1103987414 2 Left 1103987412 12:124777289-124777311 CCTATGGGCACCAGGATTTGTAG 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1103987414 12:124777314-124777336 AAATGCACAGAAACACATCCAGG 0: 1
1: 0
2: 3
3: 52
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103987414 Original CRISPR AAATGCACAGAAACACATCC AGG Intronic
901427980 1:9195408-9195430 AAAAGTACAGAAACATAGCCTGG + Intergenic
902105737 1:14034614-14034636 AAATGCACTGAAGCCCATCAAGG - Intergenic
902339340 1:15772514-15772536 AAATGCACAGGAGCACAGCCAGG + Intronic
902610610 1:17595116-17595138 AGCTGGACAGAAACACATCATGG - Intronic
902689816 1:18103650-18103672 ATATACACAGACACACATCTTGG - Intergenic
903188755 1:21644525-21644547 AAGTGCTCTGAAACACAGCCTGG + Intronic
904833198 1:33318772-33318794 AAAGGGACAGAGGCACATCCTGG - Intronic
904845548 1:33411414-33411436 AAATGCACAGAGAAACATACTGG + Intronic
905656810 1:39690982-39691004 AGATGCACACACACACATCTGGG - Intronic
906024947 1:42665486-42665508 GAATGCCCAGACACAAATCCTGG - Intronic
906261268 1:44393006-44393028 AAAGGAATAGAAACACATCATGG - Intergenic
908163754 1:61437256-61437278 ATATGCACAGACACACTGCCAGG - Intronic
908374555 1:63522304-63522326 AAATGCAAAGTAACACAGCTGGG - Intronic
909421477 1:75471153-75471175 AACTCCAAAGAAACACAGCCAGG - Intronic
909680553 1:78286924-78286946 CAATGCACATCAACACATCTGGG + Intergenic
909868832 1:80712201-80712223 AAATGCAGACAAACACATATTGG + Intergenic
912183380 1:107245720-107245742 AGAGTCACAGAAACACATCAAGG + Intronic
912990845 1:114484889-114484911 AAATGCACAAAAAAATAGCCAGG + Intronic
913296663 1:117328334-117328356 AAATGCATAGAAAAAAATTCTGG + Intergenic
913427769 1:118753396-118753418 AATTAGACAGAAAGACATCCTGG - Intergenic
916544994 1:165795777-165795799 AAAGTCACAGAAACAAAACCTGG - Intronic
916662519 1:166935571-166935593 ACATGCACATACACACATCCAGG - Intronic
916788812 1:168106427-168106449 AAATACACAGAAAATTATCCGGG + Intronic
917465119 1:175269373-175269395 AAGGGAACAGAAACAGATCCAGG + Intergenic
919081807 1:192876141-192876163 GAATCTACTGAAACACATCCAGG - Intergenic
919534161 1:198766027-198766049 AAATGCACAGGAACAAATTCAGG - Intergenic
919795157 1:201317187-201317209 AAATGCATACAAACTTATCCGGG - Intronic
921355919 1:214284206-214284228 AAATGCACACATACACATTTTGG + Intronic
922035925 1:221847894-221847916 AAAGTCACAGAAACACAAGCAGG + Intergenic
922405496 1:225308665-225308687 CAATGAACAGAAACTCATGCAGG + Intronic
922852113 1:228741602-228741624 ATAAACACAGAAACACAGCCAGG - Intronic
923685431 1:236150312-236150334 ACATGCACAGACACACACACAGG - Intronic
924528056 1:244869398-244869420 AAATGGACTAAAACACCTCCAGG + Intergenic
924566463 1:245202778-245202800 AAATACACACAAAAACAGCCGGG + Intronic
924647412 1:245891503-245891525 CACTGCACAGAGTCACATCCAGG - Intronic
924669779 1:246111905-246111927 AACTGCACAGAAATTCATTCTGG + Intronic
1063234954 10:4104382-4104404 AAATGCACAGAAAAAAATCTAGG - Intergenic
1064679163 10:17792030-17792052 AAAGGCACCTAAAAACATCCAGG - Intronic
1066238429 10:33509578-33509600 AAATACAGAGAAACAAATCAAGG - Intergenic
1066703517 10:38154489-38154511 ACATGCACAGACACACATATAGG - Intergenic
1067272950 10:44808253-44808275 AAATCCATAGAAACACATCTGGG + Intergenic
1068277946 10:54827000-54827022 AAAAACACACAAAAACATCCTGG + Intronic
1069694329 10:70375735-70375757 ACATGCACACAAACACACTCGGG + Intronic
1070330625 10:75414447-75414469 AATGGCACAGAAACATCTCCAGG + Intergenic
1070722853 10:78768569-78768591 AAATACACAGACACACTGCCAGG - Intergenic
1072910330 10:99495293-99495315 GAATGCAAAGGAACACATCCAGG + Intergenic
1074259359 10:111836222-111836244 ATATGCATACATACACATCCTGG + Intergenic
1074333668 10:112545904-112545926 ACATGCACACACACACACCCTGG - Intronic
1075589125 10:123678699-123678721 AAATTCACAGAAGCCCATCAGGG - Intronic
1076262551 10:129079227-129079249 AAATCCACAGAAAAACAAACAGG + Intergenic
1079339308 11:19598881-19598903 AAATGCACACACACACACACAGG - Intronic
1079364004 11:19793269-19793291 ACATGCACTGAGACAAATCCAGG - Intronic
1080961198 11:37162313-37162335 AGATGCTCAGAGACATATCCTGG - Intergenic
1081129555 11:39361754-39361776 AAATGGACAGCACCACATGCTGG - Intergenic
1086596923 11:88583618-88583640 AAAGCCACAGAAACACTTACAGG - Intronic
1088092175 11:106055341-106055363 CACTGCTCAGAAAGACATCCTGG - Intronic
1089976687 11:122738389-122738411 AAATGCAAAGAAGCAGTTCCAGG + Intronic
1090515626 11:127423605-127423627 ATATGCAGAGAAACCTATCCTGG + Intergenic
1091025712 11:132139156-132139178 AAAAGGAAAGAAAAACATCCAGG + Intronic
1091068794 11:132543350-132543372 AAATGCACACACACACAGCCAGG + Intronic
1091107815 11:132939217-132939239 CAAAGTACAGAAACACACCCAGG + Intronic
1091205335 11:133817159-133817181 AAAAGCAGAGAAACCCTTCCCGG + Intergenic
1091271222 11:134313134-134313156 AAAGGCACAGAAACCCAACCAGG - Intronic
1091286345 11:134410767-134410789 ATTTCCACACAAACACATCCAGG + Intronic
1091676646 12:2495775-2495797 AAATGCACACACACACAACATGG - Intronic
1095362081 12:41354495-41354517 AAAAGGACAGAAACAAATACTGG + Intronic
1096915002 12:55021826-55021848 ACATACACATAAACACATTCTGG - Intronic
1097190853 12:57218848-57218870 AAGTGCACAGAAGCACACACAGG - Intronic
1097686966 12:62700149-62700171 AAATGCTGAGAATGACATCCTGG - Intronic
1097921982 12:65085782-65085804 AAGTTCAAATAAACACATCCAGG + Intronic
1098007231 12:66010483-66010505 AAATGAACAGAAAAACCTTCTGG + Intergenic
1098457516 12:70691703-70691725 AAATGCACAGAAACTCTACACGG - Intronic
1099840615 12:87960676-87960698 AAAAGAACATAAACATATCCTGG + Intergenic
1100117879 12:91330557-91330579 AAAAGCCCAGAAACAAGTCCAGG + Intergenic
1101087843 12:101254485-101254507 AAACTCACAGAACCACATCAAGG - Intergenic
1101755066 12:107614946-107614968 AGATGGACAAAAAGACATCCTGG - Intronic
1102249645 12:111377728-111377750 AAATGAACAGAAACTCTGCCAGG + Intergenic
1103321656 12:120095865-120095887 AAATCTAAGGAAACACATCCTGG + Exonic
1103344012 12:120237460-120237482 AAATGCACTGGAACACATGCGGG - Intronic
1103987414 12:124777314-124777336 AAATGCACAGAAACACATCCAGG + Intronic
1104480366 12:129102433-129102455 ATATGCACATACACACATGCAGG + Intronic
1105536240 13:21266832-21266854 AAAGGCTCAGAAACAGATTCAGG + Intergenic
1106422949 13:29598672-29598694 AAGTGCACAGAATCAAAGCCAGG + Intergenic
1108943461 13:55988665-55988687 AGATGCAGAAAAACACATACTGG + Intergenic
1109095591 13:58111062-58111084 ACATGCACACAAAGACATGCTGG - Intergenic
1109267536 13:60218266-60218288 ACACACACAGAAAAACATCCAGG - Intergenic
1110067424 13:71126343-71126365 AAATGCAGAGATCCACAGCCAGG + Intergenic
1110144541 13:72174132-72174154 AAATGAACATAAACACACCATGG - Intergenic
1111164162 13:84435954-84435976 AAATACACATATATACATCCTGG - Intergenic
1112492133 13:99876660-99876682 TAATGCACAGAAACCCAGCAAGG + Intronic
1112606006 13:100907116-100907138 AAATGCAAATCAAAACATCCAGG + Intergenic
1114321550 14:21550863-21550885 AAACACACACACACACATCCTGG - Intergenic
1114352337 14:21866743-21866765 AAATTCTCAGAAATACATCCAGG - Intergenic
1114388604 14:22281719-22281741 ATAAGCACAGAAATACATCGCGG - Intergenic
1116430234 14:44837666-44837688 AGATGCAAAGACACACAACCAGG - Intergenic
1117261923 14:54044105-54044127 ACATGCACATACACACACCCAGG + Intergenic
1118119573 14:62824040-62824062 AAACATACAGAAAAACATCCAGG + Intronic
1118424572 14:65646096-65646118 AATTTTACAAAAACACATCCAGG + Intronic
1118709403 14:68507353-68507375 AAAAGCTCATAAACACTTCCTGG - Intronic
1119043637 14:71297819-71297841 AAGTACACAGAGACAAATCCAGG + Intergenic
1119148903 14:72340417-72340439 AAATGCGTAGAATCACAGCCAGG + Intronic
1119627960 14:76198200-76198222 TAGTGCACAGAACCACACCCTGG + Intronic
1119650533 14:76379874-76379896 AAAAGCACAGAGAAACAACCTGG + Intronic
1120435880 14:84481572-84481594 ATATGCACAGAAATTCATCCTGG + Intergenic
1121309620 14:92928791-92928813 GGATGGACAGAAATACATCCAGG - Intronic
1121593565 14:95139360-95139382 CACTGTACAGAACCACATCCAGG + Intronic
1123917408 15:25046672-25046694 ACCTTCACAGAGACACATCCAGG - Intergenic
1124114462 15:26828328-26828350 AACTGTACAGAAGCACATGCTGG + Intronic
1125816492 15:42589365-42589387 TAATGTACAGTAACACATTCAGG + Intronic
1126188687 15:45856109-45856131 ATATGCACAGACTCACATACAGG - Intergenic
1127149847 15:56062200-56062222 AAAATCAAAGAAACAAATCCTGG + Intergenic
1128502706 15:68238920-68238942 AAAAGGACAGAAACAAATACTGG + Intronic
1128531814 15:68457535-68457557 ATATGCACAAAGACAAATCCAGG + Intergenic
1129420928 15:75425934-75425956 AAATCCACAGAAACAAAACAAGG + Intronic
1131153267 15:90059972-90059994 AAAGGCCCAGAGCCACATCCTGG + Intronic
1131512880 15:93059134-93059156 AAAAGCATAGAAACAGCTCCAGG - Intronic
1132706383 16:1245198-1245220 AAAGACACAGAAATACTTCCAGG - Intergenic
1133968800 16:10551963-10551985 TGATGCACAGAATCACAGCCAGG - Intronic
1135403822 16:22184160-22184182 AACTGCAAAGAAACACGACCTGG - Exonic
1135484086 16:22848633-22848655 GAATGCAGAGAAACAGAGCCAGG - Intronic
1137645673 16:50071145-50071167 AAATGGCTAGAAACACAACCTGG + Intronic
1137890294 16:52154158-52154180 AAATACACAGAAACTCATCCAGG - Intergenic
1141147146 16:81539227-81539249 AATTGCACAGAAAAACATTTTGG + Intronic
1141265507 16:82493553-82493575 GAAAGCACTGAAATACATCCAGG + Intergenic
1141322273 16:83022609-83022631 ATATGCACAGATCCACCTCCAGG - Intronic
1142019043 16:87768802-87768824 AATTTCACAGAAACCCAGCCTGG + Intergenic
1142219497 16:88846835-88846857 AAAAGAACAGAAACACGGCCGGG - Intronic
1143878064 17:10007917-10007939 AAATCCACAGAAAACCACCCTGG - Intronic
1144092488 17:11870538-11870560 AACTGCACAGACACACATTTGGG - Intronic
1144504294 17:15817196-15817218 AAAGCCAAAGAAAAACATCCCGG + Intergenic
1144634046 17:16892864-16892886 AAAGCCAAAGAAAAACATCCCGG + Intergenic
1145089321 17:19973551-19973573 AAATGCACAGAAACAGACCCAGG - Intronic
1145168150 17:20632705-20632727 AAAGCCAAAGAAAAACATCCCGG + Intergenic
1145208959 17:20999237-20999259 AAATGCACATAACCACAGCCCGG + Intergenic
1146164235 17:30575673-30575695 AAAGCCAAAGAAAAACATCCCGG + Intergenic
1147473624 17:40688009-40688031 GAATCCTCAGAAACACATGCTGG + Intergenic
1147589196 17:41670465-41670487 AAACACACAGAAACATCTCCGGG - Intergenic
1148024546 17:44577347-44577369 AAACACACACACACACATCCGGG + Intergenic
1149025754 17:52025894-52025916 AAAAGCATAGAAATACATCCTGG - Intronic
1149283559 17:55134869-55134891 AAATGCCCAGAAACAACTGCTGG + Intronic
1152450018 17:80372856-80372878 GCATTCACAGAAACACATCCAGG - Intronic
1153002820 18:471953-471975 AAAGGCACTGAAACAAAGCCTGG + Intronic
1153332376 18:3887016-3887038 AAATGCAGAGGTGCACATCCAGG - Intronic
1153392663 18:4579866-4579888 AAATGCACAGATACACTACTCGG + Intergenic
1153950831 18:10056451-10056473 AAATGCTCAGAAAAGCATCTGGG + Intergenic
1155511073 18:26577859-26577881 AAATGCTCAGCCACACATGCTGG - Intronic
1155845091 18:30695628-30695650 CACTGCAAAGAAGCACATCCAGG + Intergenic
1157183563 18:45519248-45519270 AAATGAACAGAAACCCATGAAGG + Intronic
1158135782 18:54206581-54206603 AAATACACAGCAATACACCCCGG + Intronic
1158260755 18:55603542-55603564 GTATGCACAGAAATACATTCTGG - Intronic
1158280917 18:55825188-55825210 GAATGCTCAGAAACAAATACTGG - Intergenic
1159068251 18:63593251-63593273 AAATGCACGGAAACGCTTGCTGG + Intronic
1160043504 18:75366756-75366778 AAATGCTCTGGAACACAGCCTGG + Intergenic
1161464357 19:4420037-4420059 AAAGCCACAGAGACACAGCCTGG - Intronic
1162851968 19:13437903-13437925 ACATGCACAGACACGCAACCTGG - Intronic
1163555334 19:17988966-17988988 TAATGCACAGAGAGACATCGTGG + Intronic
1164410355 19:27998810-27998832 AAATTCAAATAAACACAACCAGG - Intergenic
1164445355 19:28312878-28312900 TAATGCAGATAAACACACCCAGG - Intergenic
1164505357 19:28856160-28856182 AAATGCAGAGATTCACAACCTGG - Intergenic
1164534796 19:29077080-29077102 ACATGCACAGAGACACACACAGG + Intergenic
1166210316 19:41302696-41302718 CAATGAACAGAACCTCATCCAGG - Exonic
1167900179 19:52615650-52615672 AAATGCATAAAAACACTTCCTGG - Intronic
1168701758 19:58444133-58444155 AAAGGCACAGCTATACATCCTGG - Intergenic
925725841 2:6870399-6870421 AAATACACAGACACACAAACAGG + Intronic
925801515 2:7606792-7606814 AAGTGCCCAGAAACAAAGCCTGG + Intergenic
927573439 2:24180306-24180328 AAGTGCACAGAACCACACCTGGG - Intronic
927656852 2:24955597-24955619 AAATGAAGAGAATCACATCTTGG + Intronic
928061417 2:28117071-28117093 AACAGCACAGTAACACATCCTGG - Intronic
930782417 2:55235855-55235877 AAATGGACAGAAACACAAACTGG - Intergenic
931407332 2:61992139-61992161 GAATGCACAGCAACAAATGCAGG + Intronic
933098888 2:78225066-78225088 AAATGTACAGAAACTAATCATGG + Intergenic
933306826 2:80610928-80610950 GCATACACAGAAACACATCCTGG - Intronic
934155765 2:89198728-89198750 AAATGTGATGAAACACATCCAGG - Intergenic
934211557 2:89984032-89984054 AAATGTGATGAAACACATCCAGG + Intergenic
935212379 2:100949615-100949637 ATGAGCACAAAAACACATCCTGG - Intronic
935836216 2:107057206-107057228 AAATGAAAAGAAACACTTTCTGG + Intergenic
936238079 2:110762797-110762819 ACATGCACACAACCACATCCAGG + Intronic
936495253 2:113014894-113014916 AAATGCAGAGGAATACATCCAGG - Intergenic
936933193 2:117811453-117811475 AAATACACAGAACCAGATGCTGG + Intergenic
939426698 2:142047735-142047757 AAAGGCCCTTAAACACATCCTGG + Intronic
940523809 2:154785757-154785779 GAATGCACAGAGACACATCAGGG - Intronic
940845757 2:158640395-158640417 AGATGCACAGAAAGAGATTCAGG - Intronic
943882324 2:193161908-193161930 AAATACACACATACACACCCTGG - Intergenic
943907734 2:193521319-193521341 AAAAGGCCAGACACACATCCTGG + Intergenic
944470918 2:200053387-200053409 AATTGCCCAGAAATACATTCTGG - Intergenic
945126572 2:206517728-206517750 AAATGAACTGATTCACATCCAGG - Intronic
945334188 2:208572082-208572104 AATTGCAGAGACACATATCCAGG + Intronic
945509984 2:210689049-210689071 AAATATATAAAAACACATCCAGG + Intergenic
946104704 2:217358887-217358909 AACTGCACAGGGACACAACCGGG + Intronic
947288594 2:228546143-228546165 AAATGTACAGTAGCACATACAGG - Intergenic
1169597365 20:7215571-7215593 AAAAGCAAAGAGACATATCCAGG - Intergenic
1170038294 20:12013174-12013196 GAATCCAGAGAAACACATACCGG - Intergenic
1170299647 20:14868877-14868899 ATATGCAAAGAAAGATATCCAGG - Intronic
1170964511 20:21054092-21054114 GAATGCTCAGAAAAATATCCAGG + Intergenic
1172120487 20:32595839-32595861 AAAGGGACAGAGACTCATCCAGG + Intronic
1173094070 20:40007397-40007419 AAATTCACTGTTACACATCCAGG + Intergenic
1174009830 20:47440731-47440753 AAATGTAAAAAAACCCATCCAGG + Intergenic
1174105744 20:48161131-48161153 AAAGGCACAGGAGCACAGCCAGG - Intergenic
1174448217 20:50604492-50604514 AAGTGCACAGGAAAACACCCAGG + Intronic
1174543099 20:51304970-51304992 AAAGGCACAGAAAGACAAGCTGG - Intergenic
1175001997 20:55639424-55639446 GGATGGACAAAAACACATCCTGG - Intergenic
1175055755 20:56196435-56196457 AAAGGCACAGAAAGAGAACCAGG - Intergenic
1175335301 20:58192255-58192277 ACATGCCCAGAAGCACATCCCGG + Intergenic
1177176081 21:17702102-17702124 AAATGCATAGAAAAACGTGCGGG + Intergenic
1177971058 21:27790124-27790146 ACATCCTCAGAGACACATCCAGG + Intergenic
1178676310 21:34634488-34634510 AAGTGAACAGAAACTCATCCAGG - Intergenic
1179941554 21:44641970-44641992 AAATCCACAGACACCCATCAAGG + Intronic
1180926181 22:19556472-19556494 GAAGGCACAGAGACACATCACGG + Intergenic
1181339890 22:22170005-22170027 AAATGCACTGAAAAACAGACAGG + Intergenic
1182243321 22:28934911-28934933 AAATGCACAGAAAAAAAAACTGG - Intronic
1182874739 22:33681801-33681823 AAATGTACAGAGGCACATTCAGG + Intronic
1182888489 22:33796693-33796715 AAATGCAAAGAAACAGAGCCAGG + Intronic
1183123903 22:35756183-35756205 AAAAGAACAGAAACACATTCCGG + Intronic
1183353422 22:37345958-37345980 AAGTGCTCAGAACCACATCTGGG - Intergenic
1184868914 22:47220602-47220624 GCATGCACACATACACATCCAGG + Intergenic
1184868920 22:47220663-47220685 GCATGCACACATACACATCCAGG + Intergenic
949426963 3:3928184-3928206 AAAAGCACAGAGACACAGCCTGG + Intronic
950273372 3:11638207-11638229 ATCTTCACAGCAACACATCCAGG + Intronic
950450964 3:13065289-13065311 AAATGCACAGAAATTCACCAAGG + Intronic
951084004 3:18489377-18489399 AAATGCACAGAAACAAATAGGGG + Intergenic
951108529 3:18773421-18773443 AAATGCACAGAAACGCATGAAGG + Intergenic
951770581 3:26251978-26252000 AATTGCAGAGAAACAGATTCAGG - Intergenic
951863113 3:27276112-27276134 AAATGAACAAAAACACATCCAGG - Intronic
954915425 3:54145353-54145375 AATTCCACACACACACATCCAGG - Intronic
955341961 3:58131790-58131812 ACATGCACACAAACACATGCAGG - Intronic
955882425 3:63561790-63561812 AAATGCATAGGAACAAATCCTGG - Intronic
956070418 3:65443982-65444004 ACATGCACACAAACACATACAGG + Intronic
957706826 3:83798953-83798975 AAAAGTACAGAAACATTTCCAGG + Intergenic
958144755 3:89609784-89609806 AAATACACAGAAACACAAAATGG - Intergenic
958727001 3:97918059-97918081 AATTACACAGAAACATTTCCTGG - Intronic
959380282 3:105633128-105633150 AAATACAAAGAAATCCATCCTGG + Intergenic
959647490 3:108720234-108720256 AAATGCATAGAAAAACATGACGG - Intergenic
959709533 3:109371308-109371330 AAATTAACAGAAACACTTTCTGG - Intergenic
959782439 3:110251603-110251625 AAATGCTCAGAAATAAATCCAGG - Intergenic
959878906 3:111419868-111419890 AAATGGACAAACACACATCTTGG - Intronic
960350305 3:116585108-116585130 AAATCCCCAGAAACACTTCCAGG + Intronic
961180702 3:124874680-124874702 AAGTGCCCAGAAATAAATCCAGG + Intronic
961601646 3:128066883-128066905 TGCTGCACAGAAACACAGCCCGG - Intronic
961985268 3:131125188-131125210 AAATGGGCAGAAACTCAACCGGG - Intronic
962097802 3:132310038-132310060 AAATCCACAGGCAGACATCCCGG + Intergenic
962543949 3:136412734-136412756 AAAGGCTCAGAAACAATTCCAGG + Intronic
962911873 3:139859669-139859691 AAATAGACAGAAACACACCAAGG + Intergenic
963786049 3:149535436-149535458 AAATGCACTGTCACACTTCCCGG + Intronic
965349217 3:167593592-167593614 TAAGGCACAATAACACATCCTGG - Intronic
965882188 3:173398740-173398762 AAATGCAGAGTAACAGATACTGG - Intronic
966178081 3:177161090-177161112 AAATGTACACAAACACACCTAGG + Intronic
966681907 3:182650752-182650774 CACTGCACAGAGACTCATCCAGG + Intergenic
967205470 3:187116440-187116462 TAATGCATAGAAACAAATACTGG + Intergenic
967845589 3:194040189-194040211 AAATACACAGAAACAGGCCCAGG - Intergenic
968291511 3:197543064-197543086 AAAGGCACAGACACACAGACTGG - Intronic
968487323 4:869049-869071 AAATGCACACACACAGATGCAGG + Intronic
969056456 4:4405745-4405767 AAGGGCAAAGAAATACATCCAGG - Intronic
969335970 4:6510489-6510511 AAATGAACAGAAACAATTTCGGG - Intronic
969684427 4:8662819-8662841 AAATGCACAGAAAGATGTTCAGG + Intergenic
970994940 4:22255791-22255813 AAACACACAAAAACACATACTGG - Intergenic
971213992 4:24646877-24646899 AGAAGCATAGAAACACATTCAGG - Intergenic
973147684 4:46847972-46847994 AAAAGAACAGAAACACTTTCTGG - Intronic
974382231 4:61155612-61155634 AAATGCACAAAAATATATCTGGG - Intergenic
974668492 4:64996754-64996776 AAATTCACAGACACACATCAAGG - Intergenic
975178674 4:71317287-71317309 AAATGCATATAAACACACGCAGG - Intronic
975612645 4:76216958-76216980 AACTGAACAGAAAGACAGCCAGG - Intronic
975822367 4:78285068-78285090 AAATGCACATAAACCCATTCTGG - Intronic
976486166 4:85607561-85607583 AAATGCACAGAGAAATATCTGGG - Intronic
977128664 4:93204309-93204331 AAATGCACATTAAGACATACAGG + Intronic
977509196 4:97939752-97939774 AAAGGCACAGAAAGACAAGCTGG - Intronic
978357299 4:107890756-107890778 AAACGTACAGACACACATCTTGG + Intronic
978925963 4:114244799-114244821 AAATGGACAGAAACACAAAATGG - Intergenic
979085368 4:116403169-116403191 AAACACACAGACACACTTCCGGG - Intergenic
979193303 4:117890111-117890133 AAATGCTAAGAAACACAGCAAGG + Intergenic
979351809 4:119652224-119652246 AAATGCACAGTAACAAATAGGGG + Intergenic
980782266 4:137506244-137506266 AATTGCACTGAAATACATTCTGG + Intergenic
982196976 4:152926307-152926329 CAATACACACAAACACATCTTGG + Intergenic
983703748 4:170631740-170631762 AAATGCTCACACACACACCCTGG - Intergenic
984010331 4:174363521-174363543 AAAGGTACAGAAACAATTCCAGG + Intergenic
984122967 4:175769358-175769380 AAATGCCCAGAAACAATTCTAGG + Intronic
984481299 4:180306408-180306430 ACATGCAGAGACACACATACAGG - Intergenic
984870915 4:184324216-184324238 AGAATCACAGAAACACATTCTGG + Intergenic
987137451 5:14913106-14913128 AAATGCACAGAAACATTGGCTGG - Intergenic
987221456 5:15794209-15794231 AAATGTACAGAAAGGCATTCTGG - Intronic
987827775 5:23055729-23055751 AAATGTACAGACACAGATGCAGG + Intergenic
988242349 5:28630302-28630324 AAACAAACAGAAACAAATCCTGG - Intergenic
988266356 5:28955756-28955778 AAATCCACACACACACATGCTGG - Intergenic
990735043 5:58851134-58851156 AAACACACAGAAACACATCTTGG - Intronic
991642118 5:68765484-68765506 AATTGCACAGAAACCCAGCCAGG + Intergenic
992027930 5:72689695-72689717 AAATTCAAAGAAACTCCTCCAGG + Intergenic
995056373 5:107763775-107763797 AAATAAACAGAAGTACATCCTGG - Intergenic
996746609 5:126851643-126851665 AAATGCAGAGAGACCCAACCAGG - Intergenic
997139913 5:131367869-131367891 AAATCCACAGAATCAACTCCAGG - Intronic
997945591 5:138197815-138197837 ATTTGCACAGAAAAATATCCTGG + Intronic
998636488 5:143960555-143960577 AAATGAACAGAAAAACAACATGG + Intergenic
998730794 5:145074524-145074546 AAAAACACAGAAACACTTGCAGG - Intergenic
999030844 5:148289320-148289342 AAATGCAAACAAACACTTCAAGG + Intergenic
999241334 5:150129589-150129611 ACATGCATAGGAACACATTCTGG - Intronic
999689624 5:154135392-154135414 AAATCCACACAAACAAATTCTGG - Intronic
999822001 5:155237676-155237698 TAATGCTCAGAAACACCTGCTGG - Intergenic
1000504169 5:162093277-162093299 AAATACACATAAACACACCCTGG + Intronic
1001317617 5:170655554-170655576 AAATGCCTAGCAACACATCTAGG - Intronic
1001488292 5:172136209-172136231 AAATTCCTAGAAACACAACCTGG + Intronic
1001867517 5:175118072-175118094 AAAGGTACAGAAAGCCATCCTGG - Intergenic
1003755647 6:9116549-9116571 AAGAGCACAGAAATACATCAGGG + Intergenic
1004266881 6:14156349-14156371 AAATAAACTGAAACACATCTGGG - Intergenic
1004979396 6:21006364-21006386 TAGTGAACAGAAACACATCTGGG - Intronic
1005389657 6:25320504-25320526 AAAGGCTCAGAAACAGTTCCTGG - Intronic
1006015422 6:31077064-31077086 AAATGAAAAGAAAGACTTCCTGG + Intergenic
1008593168 6:53013889-53013911 AAAACCACAGAAAGGCATCCTGG - Exonic
1008793931 6:55276741-55276763 AAATGCACACAAACCCATTGAGG - Intronic
1009670267 6:66740119-66740141 AAATGCACAGAAAAATATGTGGG - Intergenic
1011465941 6:87657059-87657081 AAATGAAAACAAAAACATCCAGG - Intronic
1012200678 6:96402609-96402631 AAATGCAAATGAACACATCAGGG + Intergenic
1012531749 6:100245877-100245899 AAATGCAAAGAATCACCTCGAGG + Intergenic
1012655521 6:101814358-101814380 AAATGCAAAGAAACAAATAATGG + Intronic
1013542669 6:111126333-111126355 AAATACCAAGAAACACCTCCTGG - Intronic
1014561329 6:122894341-122894363 AAATGCACTGATACACAAGCAGG + Intergenic
1015751005 6:136559048-136559070 AAATACAAAGAAATGCATCCAGG + Intronic
1016863047 6:148740884-148740906 AAATGCACTGAAAACCATCTGGG - Intergenic
1018223451 6:161605298-161605320 ATATGCACATATACACATACGGG - Intronic
1021261986 7:18469887-18469909 AAATGCAAGAAAACACATCTGGG - Intronic
1022512107 7:30944054-30944076 AAATCTACAGAAAAACATCCTGG - Intronic
1023279396 7:38554118-38554140 AGATGCACAGAGCCACATTCTGG + Intronic
1024248209 7:47486399-47486421 AAACACACAGAGACACATACAGG - Intronic
1024798871 7:53052478-53052500 ATGTGCCCTGAAACACATCCGGG + Intergenic
1024833699 7:53491528-53491550 AAAAGCACAGACACACACACAGG - Intergenic
1024925182 7:54605087-54605109 ACTTGCACAGAAACAGATCTGGG - Intergenic
1026063570 7:67048390-67048412 AAATTCACAATAACTCATCCAGG - Intronic
1026408950 7:70099022-70099044 AAATAAACAGAAACACTTCTGGG - Intronic
1026714780 7:72779084-72779106 AAATTCACAATAACTCATCCAGG + Intronic
1027424326 7:78047335-78047357 AAATGAACAGAATCATCTCCTGG + Intronic
1028204517 7:88001114-88001136 AAAGGTATAGAAACACATGCAGG + Intronic
1029602327 7:101574935-101574957 AAATCCACAGGAAGACAGCCTGG - Intergenic
1030447265 7:109662528-109662550 AAAAGGACAGCAATACATCCTGG - Intergenic
1031155394 7:118104421-118104443 AAATGCACAGACACACACCATGG + Intergenic
1032677519 7:134145051-134145073 AAATGAACAAAAACAGATCATGG + Intronic
1032853269 7:135813253-135813275 AAAAGAAAAGAAACACCTCCTGG - Intergenic
1034496603 7:151427122-151427144 AACTGCACAGACAGACATGCGGG - Intergenic
1035735776 8:1886701-1886723 AAATGCAGTGAAACACACCAGGG - Intronic
1037143903 8:15550190-15550212 AAATCCACAGACAGACAGCCCGG - Intronic
1037171506 8:15898436-15898458 AAAAGCAGAGAAACAAATCCAGG - Intergenic
1037456860 8:19072380-19072402 AAATGTTCAGAAAACCATCCGGG - Intronic
1037457481 8:19078500-19078522 CAATGCCCAGAAACACTTGCAGG - Intronic
1037680164 8:21090462-21090484 AAAGCCACAGAAACAAATCCAGG + Intergenic
1038002211 8:23402108-23402130 AAATACACATATACACATACAGG + Intronic
1039130138 8:34254541-34254563 AAATGGACAAAAACAATTCCAGG + Intergenic
1039685221 8:39794520-39794542 AAATCCACAGGAAGACAGCCTGG + Intronic
1040535106 8:48302377-48302399 ACAGGCACAGAGACAGATCCAGG - Intergenic
1041011614 8:53549420-53549442 AAATGCAAAGAAACCAATCCAGG + Intergenic
1041829479 8:62137733-62137755 ACAGGCACACACACACATCCTGG + Intergenic
1042361740 8:67891601-67891623 GTATGCACAGAAACACATATAGG + Intergenic
1042693210 8:71526908-71526930 AAATCACCACAAACACATCCTGG + Intronic
1042845664 8:73167535-73167557 AGGTGAACAGAAACACATCCAGG - Intergenic
1043825185 8:84919506-84919528 TCATGCACATAAACACAACCTGG + Intronic
1044418034 8:91958232-91958254 TAAAGCACACAACCACATCCTGG + Intronic
1045248189 8:100461310-100461332 AAATGCACAGAGAGACATCAGGG + Intergenic
1046225062 8:111267609-111267631 AAAAGAAGAGAAAGACATCCTGG - Intergenic
1047344785 8:124016556-124016578 AAATGCACAGAAAAAAGTCCAGG - Intronic
1047720787 8:127637298-127637320 AGATGCACATAAACACCTACAGG + Intergenic
1047782509 8:128121708-128121730 ACATGCACAAACACACATGCAGG + Intergenic
1048171961 8:132115813-132115835 AAATAAACAAAAACCCATCCTGG - Intergenic
1050474403 9:6024808-6024830 CAATGCACTGAAATTCATCCAGG + Intergenic
1050574636 9:6980909-6980931 AAGTGCACTGAAACACAACCGGG - Exonic
1051481307 9:17564391-17564413 ATGTGCACAGAAACACAAACTGG + Intergenic
1054297599 9:63344597-63344619 AAAAACACAGCAACACAGCCAGG - Intergenic
1056328893 9:85505435-85505457 AAAAGCACAGAAGCGCATGCTGG - Intergenic
1056705401 9:88948248-88948270 GCATGCACACACACACATCCAGG - Intergenic
1056938349 9:90935261-90935283 AAAACCACAGAAAGACATCGTGG + Intergenic
1057886124 9:98831026-98831048 AAATGCAAAGAAACACGGCCTGG + Intronic
1058537390 9:105976304-105976326 AAAGACACAGGCACACATCCTGG - Intergenic
1058738201 9:107916010-107916032 ACATACACACATACACATCCTGG - Intergenic
1059553761 9:115257240-115257262 ACATGCACAGACACACACACAGG + Intronic
1059828046 9:118055582-118055604 AAATTCACAGAAGCGCATTCTGG - Intergenic
1059945839 9:119407350-119407372 AACTGCCCAGACACAAATCCAGG + Intergenic
1059951177 9:119463875-119463897 ACATGCACACAAACAAATACAGG - Intergenic
1060542681 9:124441263-124441285 AAGCGCAGAGAAAAACATCCAGG - Intergenic
1186480344 X:9891773-9891795 AGATGCACAGGCACACATACAGG - Intronic
1188541885 X:31260016-31260038 AAATACATAAAAACACAGCCTGG + Intronic
1188929411 X:36088020-36088042 GAATACACAGAAAGACATCAGGG - Intronic
1189235936 X:39487391-39487413 AGATGCACAAAAACACACACAGG - Intergenic
1190060989 X:47211611-47211633 AGATGCACAGAGAAACATGCAGG - Intronic
1190238838 X:48640632-48640654 CAATGAACAGAAAGACATCCTGG + Intergenic
1190577038 X:51850391-51850413 AAATGCTCAGAACCAAATCCTGG - Intronic
1191164906 X:57378694-57378716 CAGTGCACAGAAACAACTCCTGG - Exonic
1191837918 X:65484999-65485021 AAAAGCAGAGAAACATATGCAGG - Intronic
1193129533 X:77905061-77905083 AAATACACAGAAACTCACCTGGG - Intronic
1193249151 X:79267401-79267423 AAATCCAGAAAAACACAACCTGG - Intergenic
1196468950 X:116003500-116003522 CAATGCACAGACACAGTTCCAGG + Intergenic
1197272467 X:124440133-124440155 AAATGCAGAAAAACACCTTCTGG - Intronic
1197805215 X:130392373-130392395 AAAGGCACAGAGACACAAACTGG - Intergenic
1198551605 X:137751139-137751161 ATATGCACACAAACACAGCGTGG - Intergenic
1199180797 X:144851571-144851593 AAATGTACAGAAAATTATCCAGG - Intergenic
1199187930 X:144938928-144938950 AAAAGAACAGTAACACAACCAGG - Intergenic
1199509786 X:148609111-148609133 AAATCCAGAGATACAAATCCAGG + Intronic
1199979473 X:152913102-152913124 ACCTCCACAGAAACACATCCAGG + Intergenic
1201458469 Y:14197016-14197038 AAATTCACAGAAATACACACAGG + Intergenic
1202179225 Y:22125376-22125398 ACTTCCACAGAAACACAGCCTGG + Intergenic
1202212136 Y:22461018-22461040 ACTTCCACAGAAACACAGCCTGG - Intergenic