ID: 1103987415

View in Genome Browser
Species Human (GRCh38)
Location 12:124777315-124777337
Sequence AATGCACAGAAACACATCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 311}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103987408_1103987415 25 Left 1103987408 12:124777267-124777289 CCTAGAACAACACGGGGCATGTC 0: 1
1: 0
2: 0
3: 5
4: 67
Right 1103987415 12:124777315-124777337 AATGCACAGAAACACATCCAGGG 0: 1
1: 0
2: 3
3: 40
4: 311
1103987412_1103987415 3 Left 1103987412 12:124777289-124777311 CCTATGGGCACCAGGATTTGTAG 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1103987415 12:124777315-124777337 AATGCACAGAAACACATCCAGGG 0: 1
1: 0
2: 3
3: 40
4: 311
1103987413_1103987415 -7 Left 1103987413 12:124777299-124777321 CCAGGATTTGTAGATAAATGCAC 0: 1
1: 0
2: 1
3: 11
4: 130
Right 1103987415 12:124777315-124777337 AATGCACAGAAACACATCCAGGG 0: 1
1: 0
2: 3
3: 40
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103987415 Original CRISPR AATGCACAGAAACACATCCA GGG Intronic
901120541 1:6888842-6888864 AAAGAACAGAAACAAAACCAAGG + Intronic
901177194 1:7312810-7312832 AAGGCACAAAATCACATCAAAGG - Intronic
901942152 1:12670968-12670990 TATGCAAAAAAACACATACAAGG - Intergenic
904270720 1:29348256-29348278 AAAGAAAAGAAACAAATCCATGG - Intergenic
906291383 1:44621742-44621764 AACACACAGACACACATCCAAGG - Intronic
907817517 1:57934795-57934817 AATGCAGAGAGAAAGATCCATGG - Intronic
908114417 1:60926912-60926934 AAAGCACATCAACACATCAAAGG + Intronic
908163753 1:61437255-61437277 TATGCACAGACACACTGCCAGGG - Intronic
908187284 1:61664412-61664434 AATGATCAGAAACACTGCCATGG - Intergenic
908203244 1:61819301-61819323 AATATAAGGAAACACATCCAAGG - Intronic
909164389 1:72199880-72199902 ACTTCTCAGAAACACATACATGG + Intronic
909321149 1:74286797-74286819 AATGCACAGATACCAATACAAGG + Intronic
910164923 1:84316533-84316555 AGAGCCCAGAAATACATCCATGG - Intronic
914323063 1:146584133-146584155 AAAGCAAAGAAACATATCCGAGG + Intergenic
918147527 1:181770753-181770775 AATGGATAGAAACATATCTAAGG + Intronic
920773269 1:208910303-208910325 AAGACACAGAAACAAATTCAAGG + Intergenic
921315829 1:213889263-213889285 CATGCACACAAACACACACATGG + Intergenic
921578653 1:216868831-216868853 AATGCATATAAACACATGAAAGG - Intronic
921899029 1:220430962-220430984 AATCCACAGAAATACTTCCTTGG - Intergenic
923406830 1:233669514-233669536 AATGCTCACAAAAATATCCATGG - Intronic
924820944 1:247490166-247490188 AGGGCACAGAAACACATTGAAGG - Intergenic
1063355648 10:5395953-5395975 AGAGCACAGACACACATACAGGG - Intronic
1063952084 10:11232959-11232981 AATGCCTATGAACACATCCAAGG - Intronic
1064432113 10:15280126-15280148 AATGCAGACAAACACAGACAGGG + Intronic
1064730280 10:18324151-18324173 CATGAACAGAAACACATAGATGG - Intronic
1064937523 10:20694826-20694848 AGTGCAGAGAAACAAATCAAAGG + Intergenic
1064976990 10:21127056-21127078 AATACACTCAAACGCATCCATGG + Intronic
1065052621 10:21811193-21811215 AATGTTCAGAAATACAACCAAGG - Intronic
1066310896 10:34195518-34195540 AATCAAAAGAAACACATCAAAGG + Intronic
1069116457 10:64512829-64512851 AATACACTGAAAAATATCCAGGG + Intergenic
1069665404 10:70152536-70152558 ACTGCACATGAACACTTCCATGG + Exonic
1070330626 10:75414448-75414470 ATGGCACAGAAACATCTCCAGGG + Intergenic
1072062890 10:91834003-91834025 AATGTACAGCAACTCCTCCAAGG + Exonic
1072625723 10:97110145-97110167 AAGGAACAGAAACAATTCCACGG + Intronic
1073903988 10:108255516-108255538 AAAACACAAAAACACAGCCAGGG - Intergenic
1074705429 10:116125563-116125585 AATGCAGAGAAAGACAGGCATGG + Intronic
1076045388 10:127290112-127290134 ACTCAACAGAAACACATCCACGG - Intronic
1076126322 10:127976960-127976982 AATGGACAGAACCGCAGCCACGG - Intronic
1077741675 11:4853228-4853250 CATGCACACACACACATACAAGG + Intronic
1079364003 11:19793268-19793290 CATGCACTGAGACAAATCCAGGG - Intronic
1080735416 11:35009175-35009197 AATCCAGAAAAACTCATCCAAGG - Intronic
1080889628 11:36398233-36398255 GAAGCAAAGAAACACATCCAAGG - Intronic
1081679417 11:44991196-44991218 AATGCACACACACACACACATGG + Intergenic
1084235414 11:67785107-67785129 AATGCACAGAGAGACATCCTAGG - Intergenic
1084337488 11:68468541-68468563 AAAGTACAGAAACACCTCCAAGG + Intronic
1085166630 11:74406946-74406968 CATGCACACAAACAAAACCAAGG - Intergenic
1087514179 11:99136311-99136333 AATCGACAGAAACATAGCCAGGG + Intronic
1087522367 11:99256811-99256833 AAACCACAGAAACACATAGAAGG - Intronic
1088034976 11:105300355-105300377 AAGGCACTGCATCACATCCAAGG + Intergenic
1088724559 11:112622670-112622692 CATGCAAAGACAGACATCCACGG + Intergenic
1089976688 11:122738390-122738412 AATGCAAAGAAGCAGTTCCAGGG + Intronic
1091271221 11:134313133-134313155 AAGGCACAGAAACCCAACCAGGG - Intronic
1093045438 12:14438651-14438673 AATTTACAGACACACATACAAGG - Intronic
1095535497 12:43241189-43241211 CATACACACATACACATCCAAGG - Intergenic
1096878936 12:54651669-54651691 AATGCCCAGAAAATCTTCCAGGG - Intergenic
1097204551 12:57308995-57309017 AATGGAAAGAAAAACAGCCAGGG + Intronic
1097483442 12:60162454-60162476 AATGAACAAAAACTCATTCACGG + Intergenic
1098223246 12:68292651-68292673 AATGCACCAAAACACATACATGG - Intronic
1098651835 12:72980379-72980401 AATGTTTAGAAACATATCCACGG + Intergenic
1099533142 12:83812081-83812103 AATGAACAAACACACATACATGG - Intergenic
1099941775 12:89197644-89197666 TATGCAAAGAAAAAGATCCACGG + Intergenic
1101330028 12:103750232-103750254 ACTGTACAGAAACAAATGCATGG + Intronic
1101434630 12:104654404-104654426 GATCCACAGAAAGACACCCATGG + Intronic
1102063198 12:109950856-109950878 AATGGGAAGAATCACATCCATGG + Intronic
1102704904 12:114872564-114872586 AAGGCACATCAACACATCAAGGG + Intergenic
1103151392 12:118642116-118642138 AATGCACATAAACATATTAAAGG - Intergenic
1103477566 12:121229841-121229863 AAGACACAGAGACACATACAAGG - Intronic
1103987415 12:124777315-124777337 AATGCACAGAAACACATCCAGGG + Intronic
1107312296 13:39092499-39092521 AATGCATAGAAACATGTCCAAGG + Intergenic
1108642862 13:52398639-52398661 AAGGAACAGAACCACTTCCATGG - Intronic
1108891590 13:55267308-55267330 AATGCATATAAACAAATCCTAGG + Intergenic
1108984638 13:56570097-56570119 CATGAGCAGAAACAAATCCAAGG - Intergenic
1110394426 13:75012802-75012824 AATGTACAGAAGCACATGCAAGG - Intergenic
1111305208 13:86402712-86402734 TATGAACAGAATCACACCCAAGG - Intergenic
1112392467 13:98998015-98998037 AAACCACAGAAACATCTCCAGGG + Intronic
1113976796 13:114233728-114233750 AAAGCACAAAAAGATATCCAAGG + Intergenic
1114352336 14:21866742-21866764 AATTCTCAGAAATACATCCAGGG - Intergenic
1114763356 14:25343306-25343328 AATGCACAGACACTGATGCATGG - Intergenic
1115709706 14:36038151-36038173 AATGCACAGACACCAATGCAAGG - Intergenic
1115863021 14:37710959-37710981 AGTGCACAGAATCACCTTCAGGG + Intronic
1116430233 14:44837665-44837687 GATGCAAAGACACACAACCAGGG - Intergenic
1116776469 14:49187857-49187879 AATGCACAGACACCAATGCAAGG - Intergenic
1120237170 14:81905090-81905112 AGTGCACAGAAATGCATGCACGG - Intergenic
1124810564 15:32933577-32933599 AATACACAGCAACACAGCAATGG - Intronic
1127381817 15:58437230-58437252 AATGCACACACACACAGCCTTGG - Intronic
1128283633 15:66417888-66417910 AGTGCCCAGAAGCACACCCAAGG - Intronic
1132349283 15:101128768-101128790 AATAATAAGAAACACATCCAAGG + Intergenic
1132927631 16:2439521-2439543 TGTGGACAGAAACGCATCCAAGG - Intronic
1133346979 16:5077741-5077763 AATGCACAGAGAGACGTCCTAGG - Intronic
1134434294 16:14241368-14241390 AATTCACAGCAAGACATCAATGG + Intronic
1135484085 16:22848632-22848654 AATGCAGAGAAACAGAGCCAGGG - Intronic
1137424313 16:48364825-48364847 AAACCAAAGAATCACATCCAAGG + Intronic
1138170843 16:54848372-54848394 AGTGAACAGGAACACATTCATGG + Intergenic
1139368475 16:66448841-66448863 AAAGAAAAGAAACACATCCTTGG + Intronic
1139425607 16:66878127-66878149 AATGCACATAAAATCCTCCAGGG + Intergenic
1140382597 16:74503876-74503898 AATGCTTAGAAATATATCCAAGG + Intronic
1140821874 16:78670272-78670294 GATGCACAGAAAAACATCCAAGG - Intronic
1141113693 16:81290624-81290646 CATCCAAAGAAACATATCCATGG - Exonic
1141264610 16:82485303-82485325 AATCCACAGATTCAAATCCATGG + Intergenic
1141265508 16:82493554-82493576 AAAGCACTGAAATACATCCAGGG + Intergenic
1143052697 17:4139602-4139624 AAAGCACAGAATCAAATGCATGG + Intronic
1145208960 17:20999238-20999260 AATGCACATAACCACAGCCCGGG + Intergenic
1145963918 17:28903412-28903434 AATGCACACAAACACCTACAAGG - Intergenic
1145977595 17:28993249-28993271 GATGGACAGAAACGCCTCCAGGG - Intronic
1148442383 17:47718085-47718107 AGTGCACACTAACACATGCATGG + Intergenic
1149383011 17:56112587-56112609 AATGAACAGGAACACACACATGG + Intronic
1151078853 17:71305007-71305029 ACTGAACAGAAACACAACCAAGG + Intergenic
1152450017 17:80372855-80372877 CATTCACAGAAACACATCCAGGG - Intronic
1153332375 18:3887015-3887037 AATGCAGAGGTGCACATCCAGGG - Intronic
1157981789 18:52390208-52390230 AAAGAACAGAAATACATTCATGG - Intronic
1158260754 18:55603541-55603563 TATGCACAGAAATACATTCTGGG - Intronic
1161117816 19:2508759-2508781 AATGCACAGAAAAAAAGACATGG - Intergenic
1161832514 19:6617509-6617531 AATGCACAGACACTAATGCAAGG + Intergenic
1162457945 19:10797122-10797144 ATTGCACAGACAGACAGCCAAGG - Intronic
1163174786 19:15556646-15556668 AATGCACCCAAACACATACGCGG - Intergenic
1163640882 19:18461370-18461392 CATGCCCAGAAACGCATCCATGG + Intronic
1164445354 19:28312877-28312899 AATGCAGATAAACACACCCAGGG - Intergenic
1167900178 19:52615649-52615671 AATGCATAAAAACACTTCCTGGG - Intronic
927589881 2:24345694-24345716 AATGCATAGAAAAAGATCCGTGG - Intronic
927591867 2:24363552-24363574 AATGTATAGACACACTTCCAAGG - Intergenic
928061416 2:28117070-28117092 ACAGCACAGTAACACATCCTGGG - Intronic
931232138 2:60383843-60383865 AATGAACAGAAACCTAACCAAGG + Intergenic
931495605 2:62803586-62803608 AATTCACAGAAAAACATGCATGG - Intronic
931988019 2:67759641-67759663 CATCCACAGAACCATATCCAAGG - Intergenic
932272885 2:70426071-70426093 AAGGCACAGGAACACACCCTCGG - Intergenic
933850821 2:86365196-86365218 GACACACAGAGACACATCCAAGG + Intergenic
933940034 2:87237526-87237548 ATTGCACAGATAGATATCCATGG - Intergenic
934155764 2:89198727-89198749 AATGTGATGAAACACATCCAGGG - Intergenic
934211558 2:89984033-89984055 AATGTGATGAAACACATCCAGGG + Intergenic
936353105 2:111728252-111728274 ATTGCACAGATAGATATCCATGG + Intergenic
939353762 2:141074174-141074196 AAGGAACAGAAAGACAGCCAAGG - Intronic
939501333 2:142988699-142988721 AATAAACAGAAAAACAACCAAGG - Intronic
940845756 2:158640394-158640416 GATGCACAGAAAGAGATTCAGGG - Intronic
940939205 2:159538377-159538399 AATGCAGAGTACCACATGCAAGG - Intronic
941497687 2:166227173-166227195 ATTTCACATAAACTCATCCAAGG + Intronic
942745179 2:179223928-179223950 AACACACATAAAGACATCCAAGG + Intronic
943316510 2:186395716-186395738 AATCCACAGAAGCATATTCATGG - Intergenic
943455420 2:188101750-188101772 AATGCACAGAAACATGTCTATGG + Intergenic
945025213 2:205614281-205614303 AAGGCACACAGAAACATCCAGGG - Intronic
946683872 2:222246647-222246669 AATGCGAAGAAACACAGCAAAGG - Intronic
947256143 2:228165831-228165853 AATGGACAGAGAGACATTCAAGG - Intronic
947288593 2:228546142-228546164 AATGTACAGTAGCACATACAGGG - Intergenic
947467744 2:230369036-230369058 AATGCACAGATATAAATGCAAGG - Intronic
947765927 2:232637308-232637330 AAGACACAGAAACACACACAGGG - Intronic
947951236 2:234149214-234149236 ATTGCACAGAAACAGATTTATGG + Intergenic
948003693 2:234590113-234590135 CAGGCACAAAAACACCTCCATGG - Intergenic
1169597364 20:7215570-7215592 AAAGCAAAGAGACATATCCAGGG - Intergenic
1170241705 20:14174054-14174076 ACTTCACAAAAACACAACCAAGG - Intronic
1171277655 20:23871890-23871912 TATACACAGAAACACATCTGAGG - Intergenic
1171492730 20:25532573-25532595 AATGCTCAGTAACTCAGCCATGG - Intronic
1171749173 20:29031154-29031176 AATGCACAGAGACACATGCTTGG - Intergenic
1173030060 20:39348330-39348352 AATGCACAGACACCAATGCAAGG + Intergenic
1173044059 20:39492620-39492642 AATGCTCAGAAATGAATCCATGG - Intergenic
1174777638 20:53360102-53360124 ATTGCACAGAAACTCAGCAAGGG - Intronic
1175253824 20:57626392-57626414 AATGGAGGGACACACATCCAAGG + Intergenic
1175496284 20:59416695-59416717 AATCCACAGAAAGACATACACGG - Intergenic
1175547326 20:59786733-59786755 ACTGCACAGAAAGAGCTCCATGG - Intronic
1175588386 20:60166207-60166229 AATACAGAGAAACACCTCCTTGG + Intergenic
1175706327 20:61180201-61180223 CATGCACAGAGACACACACATGG + Intergenic
1176316008 21:5244534-5244556 AATGCACAGAGACACATGCTTGG + Intergenic
1176742118 21:10614472-10614494 ACTGAACAGAAACAAAGCCACGG - Intergenic
1177357332 21:20026045-20026067 CATGCACAGAAAAACAGGCATGG - Intergenic
1177892539 21:26824248-26824270 CTTGAACAAAAACACATCCATGG - Intergenic
1179230081 21:39494523-39494545 AAGGGAAAAAAACACATCCAAGG - Intronic
1179230892 21:39502880-39502902 CATACACAGAAACAGAGCCAGGG - Intronic
1179724163 21:43332666-43332688 CATGCACACAAACACACACAAGG - Intergenic
1180393810 22:12310475-12310497 AATGCACAGAGACACATGCTTGG + Intergenic
1180405937 22:12554273-12554295 AATGCACAGAGACACATGCTTGG - Intergenic
1180638706 22:17281044-17281066 GATGCACAGAAACACAGGCAAGG - Intergenic
1180926182 22:19556473-19556495 AAGGCACAGAGACACATCACGGG + Intergenic
1181516856 22:23419251-23419273 AATGAACAGTACCACCTCCAAGG - Intergenic
1182807677 22:33088989-33089011 AATTCCCAGAAGCTCATCCATGG - Intergenic
1182874740 22:33681802-33681824 AATGTACAGAGGCACATTCAGGG + Intronic
950199917 3:11035553-11035575 AGTGGACAGCAACTCATCCAGGG - Intronic
950229285 3:11261878-11261900 TGTGCACAGATACACATACACGG + Exonic
950563181 3:13747747-13747769 CACACACAGAGACACATCCATGG + Intergenic
950634735 3:14306865-14306887 AAAGGACAAAAACACCTCCATGG - Intergenic
950788165 3:15452705-15452727 ACTGCACACAGACACATACATGG + Intronic
951790245 3:26474355-26474377 AATTCACAGAAACGAATTCATGG - Intergenic
952714865 3:36470495-36470517 AATAAACAGAAACATAACCAAGG - Intronic
953097917 3:39796920-39796942 AATGCCCAGAAATTCAACCAGGG - Intergenic
953718068 3:45332957-45332979 AATTCACAGAAAGACCTCCAAGG + Intergenic
954585281 3:51729958-51729980 GATGCACAGAAACCAATGCAAGG - Intergenic
954626025 3:52022311-52022333 GAGGCTCAGAAACTCATCCAGGG - Intergenic
954915424 3:54145352-54145374 ATTCCACACACACACATCCAGGG - Intronic
955013031 3:55038214-55038236 AATGAAAATAAACACATGCATGG - Intronic
955074412 3:55600252-55600274 AATGCAATGAAACACATATATGG + Intronic
955751808 3:62191082-62191104 GATGCACACACACACATGCACGG - Intronic
956159602 3:66335331-66335353 TATGCACAGATACACATCCCAGG - Intronic
956246750 3:67192064-67192086 AAAGTACAGATATACATCCAAGG - Intergenic
956714517 3:72066882-72066904 GACACACAGAAAGACATCCAGGG - Intergenic
957051383 3:75414911-75414933 AATGCACAGAGAGACATCCTAGG - Intergenic
957905480 3:86548224-86548246 CATGCACACACACACATACACGG + Intergenic
959838028 3:110943524-110943546 AATGCACAGAAACCAACACAAGG + Intergenic
960008925 3:112812042-112812064 AATGGACATAAACACTTCCGCGG - Intronic
960761279 3:121076102-121076124 AATGCACAGAATGAAGTCCAAGG - Intronic
963815578 3:149827104-149827126 AATCCACAGATACAGAGCCATGG - Intronic
964866398 3:161266641-161266663 TAGGCACACAAACACATACATGG + Intergenic
966681908 3:182650753-182650775 ACTGCACAGAGACTCATCCAGGG + Intergenic
966937657 3:184723610-184723632 AAAGCACAGAAACAGACCCAAGG - Intergenic
967250641 3:187534506-187534528 AATTCACAGAAGGACATCTAAGG + Intergenic
968487324 4:869050-869072 AATGCACACACACAGATGCAGGG + Intronic
968918425 4:3508981-3509003 AGTCCACAGAAACACCGCCATGG + Exonic
969056455 4:4405744-4405766 AGGGCAAAGAAATACATCCAGGG - Intronic
969279283 4:6158755-6158777 AAAGCCCAAAAACAGATCCAAGG + Intronic
970243054 4:14029512-14029534 CACGCACAGAAACACAGGCAAGG - Intergenic
970540110 4:17069422-17069444 AATGAACAGTAACAAATGCATGG + Intergenic
971536607 4:27759785-27759807 ACTGCACAGAAACACATAGCAGG - Intergenic
972724178 4:41731811-41731833 AATTCACAGAAGCACTTCTAAGG - Intergenic
972830902 4:42812482-42812504 ACTGTATAGAAACACTTCCATGG - Intergenic
972972958 4:44599965-44599987 AATTCACACAAACACAAGCATGG + Intergenic
974350658 4:60741248-60741270 CATGCACAGAAACACACACACGG + Intergenic
975216102 4:71756810-71756832 AGTGCACACAAAAACGTCCATGG + Exonic
976427640 4:84924294-84924316 AATGAATAGAAATACATACACGG + Intronic
976683151 4:87779962-87779984 CATGGACACAAACAGATCCACGG + Intergenic
978265681 4:106821591-106821613 TATTTACAGAAAAACATCCAGGG - Intergenic
978625009 4:110675430-110675452 TATACACACAAACACATGCATGG - Intergenic
978954056 4:114594344-114594366 AATGCACAGAATGAAGTCCAAGG - Intergenic
979193304 4:117890112-117890134 AATGCTAAGAAACACAGCAAGGG + Intergenic
979527065 4:121728463-121728485 AATTCCCAGAAATGCATCCAGGG - Intergenic
979774037 4:124565146-124565168 AATACACAAACACACATACATGG - Intergenic
980762876 4:137259838-137259860 AATGCACAGAAAAAGATCACTGG - Intergenic
981062448 4:140439585-140439607 GATGCACACAAACACATGTATGG - Intergenic
981236852 4:142427115-142427137 AATGGACAGTAAAACATCCACGG + Intronic
982791532 4:159597752-159597774 AGTGTACTGAAACACCTCCAGGG - Intergenic
982893559 4:160887214-160887236 ACTGCACACAAACACACCCACGG - Intergenic
983542373 4:168926095-168926117 AAGGCACCTGAACACATCCATGG - Intronic
984010332 4:174363522-174363544 AAGGTACAGAAACAATTCCAGGG + Intergenic
984190563 4:176600928-176600950 ACTGAACAAAAACACAGCCAAGG - Intergenic
984377951 4:178955904-178955926 AATGCAGAGAAAAAAATGCAGGG - Intergenic
984486021 4:180371202-180371224 TATGTATAGACACACATCCATGG + Intergenic
985108265 4:186520531-186520553 ACTCAACAGAAACACAACCAAGG - Intronic
985661796 5:1161037-1161059 AAAGAAAAGAAACACATCCCAGG + Intergenic
985868825 5:2537932-2537954 AAAGCACAGAAAAACAAACATGG - Intergenic
986093986 5:4537833-4537855 AATAAACAGAGCCACATCCAAGG + Intergenic
986546339 5:8902007-8902029 AATTTACAGAAAGGCATCCAGGG - Intergenic
986680948 5:10232477-10232499 AATGCACAATAACCCATCTAAGG + Intronic
988524735 5:31977172-31977194 ATTGCACACATAGACATCCATGG + Intronic
988996273 5:36717710-36717732 AAAACACAGAAACACATTGAAGG + Intergenic
989743105 5:44794911-44794933 AATCCACAAAAACCCATCTATGG + Intergenic
989971230 5:50527034-50527056 AATGCACAGAAGCATAAACATGG + Intergenic
992778642 5:80109096-80109118 AATGCTTAGAAACACATCCCAGG - Intergenic
993437610 5:87916635-87916657 AATGCACAGACACAAATGTAAGG + Intergenic
993731590 5:91429208-91429230 AAAGCACAGAAACATACGCAGGG - Intergenic
994105175 5:95939698-95939720 AATGTACTGAAACACATCTGTGG + Intronic
994119140 5:96094125-96094147 AATACACAGAAAAAGATCCCTGG + Intergenic
995178073 5:109201571-109201593 CATACACACAAACACATCAATGG + Intergenic
995911051 5:117187108-117187130 AATGGAGAGAACCACATCGAAGG + Intergenic
997616735 5:135251715-135251737 AGTGAACAGAAAAACAGCCATGG + Intronic
998150183 5:139752667-139752689 CAGGCACAGAAACACACACAAGG + Intergenic
998423398 5:142007419-142007441 AAAGCACAGACACAGATCCTAGG + Intronic
999822000 5:155237675-155237697 AATGCTCAGAAACACCTGCTGGG - Intergenic
999846420 5:155485899-155485921 CATGCACAGAAAGAAATCCTAGG - Intergenic
1000504170 5:162093278-162093300 AATACACATAAACACACCCTGGG + Intronic
1000664984 5:163983860-163983882 AATGCACAGTATCAAATCCCAGG + Intergenic
1001938482 5:175724238-175724260 AATCCCCAGAAAGACCTCCACGG - Intergenic
1002857808 6:1053561-1053583 CATGAACATAAACACAACCACGG + Intergenic
1003016549 6:2472643-2472665 CATGCACAGACACACAGCCATGG - Intergenic
1003780527 6:9419971-9419993 AATGCACATTAACATATCAAAGG + Intergenic
1004034301 6:11907668-11907690 AAACCTCAGAGACACATCCATGG + Intergenic
1005291191 6:24380575-24380597 GATACACTGAAACACATCAAAGG - Intergenic
1005692065 6:28316271-28316293 AATACACACACACACATACAAGG + Intergenic
1007162667 6:39804694-39804716 AATGCTCAGAAGCTCATCTATGG - Intronic
1008009458 6:46449649-46449671 AAAGCCCAGAAATAAATCCATGG + Intronic
1009494132 6:64328030-64328052 AATGCACAGAATGAAGTCCAAGG + Intronic
1010597911 6:77787613-77787635 AATGCACAGACAACCATGCAAGG + Intronic
1010985157 6:82414954-82414976 AATCCACAGAAGCACTTCTAGGG - Intergenic
1012208463 6:96490519-96490541 ATTGCACAGAGATACAGCCAAGG + Intergenic
1012401650 6:98846526-98846548 CTTGAACAGAAACTCATCCATGG + Intergenic
1012492103 6:99793390-99793412 AAAGCACACAAAGAAATCCATGG + Intergenic
1012509788 6:99990383-99990405 AATACACACACACACATACAGGG - Intronic
1012509790 6:99990412-99990434 AATACACACACACACATACAGGG - Intronic
1012666201 6:101973865-101973887 AATGCACAATAACATATCTAAGG + Intronic
1014291926 6:119568646-119568668 AATGCACAGGATGGCATCCAGGG + Intergenic
1014855711 6:126398034-126398056 AATGCACAGACACACACACAAGG - Intergenic
1015811365 6:137164787-137164809 AATGCACAGAATGAAGTCCAAGG + Intronic
1015900708 6:138062817-138062839 AAAGCACAGAGACACATCAGAGG - Intergenic
1016010183 6:139131434-139131456 AAAGCACAGCAACAAATCAAGGG - Intergenic
1016474847 6:144416033-144416055 CATACACACACACACATCCACGG - Intronic
1018755333 6:166843478-166843500 ACTGAACAAAAACACAACCAAGG + Intronic
1024430694 7:49285067-49285089 AATGCGGAGAACCACAGCCAAGG + Intergenic
1024994581 7:55262028-55262050 AATGCACAGACACCAATGCAAGG + Intergenic
1026117364 7:67507228-67507250 AATGCACACAAACAATTCAATGG + Intergenic
1026354176 7:69542899-69542921 TATGCACGGAAGCACATTCATGG - Intergenic
1027218551 7:76199849-76199871 GATGCACAGACACAGACCCACGG + Intergenic
1028068810 7:86423448-86423470 AATGTACTGAAACACACCTAGGG - Intergenic
1028177333 7:87673867-87673889 AAAGCAAAAAAACCCATCCAAGG - Intronic
1028501889 7:91527954-91527976 ACTAAACAGAAACACAACCAAGG + Intergenic
1031155395 7:118104422-118104444 AATGCACAGACACACACCATGGG + Intergenic
1031783185 7:125996791-125996813 AATGCACAGATAGTTATCCAAGG - Intergenic
1035926980 8:3738684-3738706 AATGCACACAGACACATGGAAGG + Intronic
1036121585 8:6023530-6023552 AATACACAGGAAGACATCCCAGG + Intergenic
1037368187 8:18145239-18145261 TATCCACAGAAACAGACCCAAGG + Intergenic
1037457480 8:19078499-19078521 AATGCCCAGAAACACTTGCAGGG - Intronic
1038030208 8:23631891-23631913 AAGACACAGAGACACATACAGGG + Intergenic
1039130139 8:34254542-34254564 AATGGACAAAAACAATTCCAGGG + Intergenic
1039928846 8:41964055-41964077 AATGAACAGGAAGACATCTAGGG - Intronic
1040663999 8:49609210-49609232 AATGAGGAGGAACACATCCAAGG + Intergenic
1041011615 8:53549421-53549443 AATGCAAAGAAACCAATCCAGGG + Intergenic
1041605525 8:59778632-59778654 ATTCCACAGATAGACATCCAGGG - Intergenic
1041832095 8:62165252-62165274 AATAAACAAAAACACAACCAAGG + Intergenic
1042845663 8:73167534-73167556 GGTGAACAGAAACACATCCAGGG - Intergenic
1044418035 8:91958233-91958255 AAAGCACACAACCACATCCTGGG + Intronic
1044482013 8:92701964-92701986 AATGCACACACACACATAAATGG + Intergenic
1047476851 8:125240678-125240700 AAGACACAGACACACATGCAGGG - Intronic
1047590274 8:126319669-126319691 CATGCACATATACACATACATGG - Intergenic
1048450406 8:134528513-134528535 AATACACAAATATACATCCAAGG + Intronic
1048582237 8:135739190-135739212 CAGACACAGACACACATCCAGGG + Intergenic
1048863398 8:138740661-138740683 AATGCAAAGAAACACATCTATGG + Intronic
1052949567 9:34197876-34197898 AATGCACAGAAACCAACACAAGG - Intronic
1053590980 9:39514377-39514399 AATGAAAAGAAACACATATATGG - Intergenic
1053848828 9:42269749-42269771 AATGAAAAGAAACACATATATGG - Intergenic
1054575326 9:66850913-66850935 AATGAAAAGAAACACATATATGG + Intergenic
1055847794 9:80588233-80588255 CTGGCATAGAAACACATCCAAGG - Intergenic
1056703373 9:88930894-88930916 AATGAACAGAAACATATAAAAGG - Intergenic
1056930918 9:90876346-90876368 CATGCACAAAAACAAATCGAAGG - Intronic
1057605815 9:96497038-96497060 AACACAGAGAAACACACCCAGGG + Intronic
1058698357 9:107579216-107579238 TAAGCCCAGAAACAGATCCATGG - Intergenic
1059623223 9:116032291-116032313 ATTTCACAGAAAAACATCTATGG - Intergenic
1060128860 9:121075655-121075677 AAGGCTCAGACACATATCCAGGG - Intronic
1062479136 9:136743394-136743416 CATGCACACACACACATTCATGG - Intergenic
1203454870 Un_GL000219v1:156875-156897 AATGTACAGAGACACATGCTTGG + Intergenic
1185615150 X:1417421-1417443 CATGCACAGACACACACACAAGG + Intronic
1186036864 X:5432473-5432495 AACACACAAAAACACTTCCAAGG - Intergenic
1186417736 X:9398330-9398352 AATGGGCAGAAACATATCGAGGG + Intergenic
1186471683 X:9826962-9826984 AATACACAGTAACATTTCCAAGG - Intronic
1186504665 X:10081662-10081684 AATGCACACAAACACATAGCTGG - Intronic
1186737745 X:12483609-12483631 AATGCACACAAAAAGAACCATGG - Intronic
1187641205 X:21292296-21292318 AAAGCAAAAAATCACATCCAAGG - Intergenic
1188036318 X:25321447-25321469 AATGCAAAGAAAAAAATCCTTGG - Intergenic
1189689506 X:43601091-43601113 AATCCACAGAAACAACCCCAGGG - Intergenic
1189872228 X:45396461-45396483 AATGCACAGACACAAATGCAAGG - Intergenic
1190238839 X:48640633-48640655 AATGAACAGAAAGACATCCTGGG + Intergenic
1191164905 X:57378693-57378715 AGTGCACAGAAACAACTCCTGGG - Exonic
1192938347 X:75885059-75885081 ACTGCACACAAACACTTCTATGG - Intergenic
1192982017 X:76354135-76354157 ACTAAACAGAAACACAACCAAGG + Intergenic
1193817493 X:86121863-86121885 ACTGAACAAAAACACAACCAAGG - Intergenic
1194096972 X:89653020-89653042 CATGCACATACACACATACAAGG - Intergenic
1194701819 X:97122909-97122931 AATGCAAAGGAACATATTCATGG + Intronic
1195324273 X:103745423-103745445 TTTGCACAGAAACAGTTCCATGG - Intergenic
1195583419 X:106533455-106533477 AATGCACAGACACAAATGTAAGG + Intergenic
1197226924 X:123962887-123962909 AATCCACAGAGACAAATACAGGG - Intronic
1198209054 X:134499030-134499052 CATGTTCATAAACACATCCATGG - Intronic
1198493792 X:137170010-137170032 AAGGCACAGAAGCAAATACAAGG + Intergenic
1198924905 X:141778773-141778795 AATGTACAGATACACATCTGAGG - Intergenic
1199187929 X:144938927-144938949 AAAGAACAGTAACACAACCAGGG - Intergenic
1199355194 X:146854390-146854412 AAAGGGCAGAAACACATTCATGG - Intergenic
1199509787 X:148609112-148609134 AATCCAGAGATACAAATCCAGGG + Intronic
1199642399 X:149875528-149875550 AAAGAACAGATACACATCAATGG + Intergenic
1199802227 X:151262946-151262968 AAAGCAAAGAAACACTTCTATGG + Intergenic
1201458470 Y:14197017-14197039 AATTCACAGAAATACACACAGGG + Intergenic
1202163673 Y:21963509-21963531 AATGTACAGATACACATCTGAGG + Intergenic
1202227683 Y:22622856-22622878 AATGTACAGATACACATCTGAGG - Intergenic
1202315474 Y:23573322-23573344 AATGTACAGATACACATCTGAGG + Intergenic
1202555327 Y:26097275-26097297 AATGTACAGATACACATCTGAGG - Intergenic