ID: 1103987500

View in Genome Browser
Species Human (GRCh38)
Location 12:124777778-124777800
Sequence CCTGGGCACCTATAATCTGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 104}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103987496_1103987500 -9 Left 1103987496 12:124777764-124777786 CCTCTTCACCTCAGCCTGGGCAC 0: 1
1: 5
2: 175
3: 6288
4: 88842
Right 1103987500 12:124777778-124777800 CCTGGGCACCTATAATCTGAGGG 0: 1
1: 0
2: 0
3: 7
4: 104
1103987482_1103987500 29 Left 1103987482 12:124777726-124777748 CCAGGGTCCAGGAGCGCCCGGAA 0: 1
1: 0
2: 0
3: 7
4: 141
Right 1103987500 12:124777778-124777800 CCTGGGCACCTATAATCTGAGGG 0: 1
1: 0
2: 0
3: 7
4: 104
1103987490_1103987500 -1 Left 1103987490 12:124777756-124777778 CCCCCAGGCCTCTTCACCTCAGC 0: 1
1: 1
2: 1
3: 28
4: 402
Right 1103987500 12:124777778-124777800 CCTGGGCACCTATAATCTGAGGG 0: 1
1: 0
2: 0
3: 7
4: 104
1103987489_1103987500 12 Left 1103987489 12:124777743-124777765 CCGGAAGGCAGGGCCCCCAGGCC 0: 1
1: 0
2: 4
3: 52
4: 413
Right 1103987500 12:124777778-124777800 CCTGGGCACCTATAATCTGAGGG 0: 1
1: 0
2: 0
3: 7
4: 104
1103987492_1103987500 -3 Left 1103987492 12:124777758-124777780 CCCAGGCCTCTTCACCTCAGCCT 0: 1
1: 1
2: 22
3: 46
4: 401
Right 1103987500 12:124777778-124777800 CCTGGGCACCTATAATCTGAGGG 0: 1
1: 0
2: 0
3: 7
4: 104
1103987485_1103987500 22 Left 1103987485 12:124777733-124777755 CCAGGAGCGCCCGGAAGGCAGGG 0: 1
1: 0
2: 2
3: 42
4: 299
Right 1103987500 12:124777778-124777800 CCTGGGCACCTATAATCTGAGGG 0: 1
1: 0
2: 0
3: 7
4: 104
1103987488_1103987500 13 Left 1103987488 12:124777742-124777764 CCCGGAAGGCAGGGCCCCCAGGC 0: 1
1: 1
2: 7
3: 68
4: 602
Right 1103987500 12:124777778-124777800 CCTGGGCACCTATAATCTGAGGG 0: 1
1: 0
2: 0
3: 7
4: 104
1103987481_1103987500 30 Left 1103987481 12:124777725-124777747 CCCAGGGTCCAGGAGCGCCCGGA 0: 1
1: 0
2: 1
3: 4
4: 136
Right 1103987500 12:124777778-124777800 CCTGGGCACCTATAATCTGAGGG 0: 1
1: 0
2: 0
3: 7
4: 104
1103987491_1103987500 -2 Left 1103987491 12:124777757-124777779 CCCCAGGCCTCTTCACCTCAGCC 0: 1
1: 15
2: 7
3: 93
4: 497
Right 1103987500 12:124777778-124777800 CCTGGGCACCTATAATCTGAGGG 0: 1
1: 0
2: 0
3: 7
4: 104
1103987493_1103987500 -4 Left 1103987493 12:124777759-124777781 CCAGGCCTCTTCACCTCAGCCTG 0: 1
1: 0
2: 7
3: 72
4: 696
Right 1103987500 12:124777778-124777800 CCTGGGCACCTATAATCTGAGGG 0: 1
1: 0
2: 0
3: 7
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103987500 Original CRISPR CCTGGGCACCTATAATCTGA GGG Exonic
900777326 1:4594745-4594767 CCTGGGCACCCATGCCCTGATGG + Intergenic
901528339 1:9838104-9838126 CCTGGGCTCATATGATCTGCCGG - Intergenic
905390249 1:37631456-37631478 ACTGGACATCTATAATCTGTGGG - Intronic
905806098 1:40878626-40878648 CCTGGGCACCTATTAGCTTTGGG - Intergenic
905860973 1:41351166-41351188 CCTGAGCACCTATTATATGCTGG - Intergenic
906066354 1:42983660-42983682 CCTTGGCCCCTATAATAAGATGG - Intergenic
906225737 1:44119667-44119689 CCTGGGAACCTTTCACCTGACGG - Intronic
910975780 1:92903776-92903798 CCTGGGCCCACATAACCTGACGG - Intronic
911536505 1:99106404-99106426 CCTGGGGGCCTATAATCAGCAGG - Intergenic
912314071 1:108650809-108650831 ACTGGGCACCTTTTATGTGAAGG - Intronic
916128472 1:161591586-161591608 CCTGGTCACCTATCACCTGAGGG - Intronic
916138388 1:161673417-161673439 CCTGGTCACCTATCACCTGAGGG - Intronic
1063546572 10:6987475-6987497 GCTGGGCAACTAAAATCTGTAGG + Intergenic
1076062966 10:127427845-127427867 CCTGGGACCCTCTCATCTGAGGG - Intronic
1079819579 11:25108152-25108174 TCTGGGCACTTATAATGGGAGGG + Intergenic
1080046601 11:27815158-27815180 CATTGGCACCCATAGTCTGATGG - Intergenic
1083523902 11:63342836-63342858 CTTGGGCAACTATAATGTGATGG - Intronic
1087220558 11:95542301-95542323 CTTGTCCACCTATACTCTGATGG - Intergenic
1088439041 11:109847985-109848007 GCTGGGCACCTGTCATGTGATGG - Intergenic
1089154666 11:116392055-116392077 CCTGGGAACCTTTAATGTGTTGG + Intergenic
1089176971 11:116555754-116555776 CCTGGACACCTACAAGCTTAAGG - Intergenic
1090806226 11:130203991-130204013 CCTGGCCACCTATGGCCTGAAGG - Intronic
1090829981 11:130414568-130414590 CCTGGGCACCTCTGCTCAGAAGG - Exonic
1092041381 12:5388032-5388054 ACTGAGAACCTATCATCTGAAGG - Intergenic
1093684191 12:22038062-22038084 CCTGAGCACTTATAGTCTGTGGG - Intergenic
1094711996 12:32973682-32973704 CCAGGGCAGCCATCATCTGAAGG - Intergenic
1097471532 12:59999059-59999081 CCTGAGGCCCTACAATCTGAAGG - Intergenic
1099675266 12:85752979-85753001 CCTTAGCACCTATCAGCTGAGGG - Intergenic
1103987500 12:124777778-124777800 CCTGGGCACCTATAATCTGAGGG + Exonic
1106454591 13:29916108-29916130 CCTGGGGAGATATAAGCTGATGG + Intergenic
1108749458 13:53432745-53432767 TCAGGGCACCTCTATTCTGAGGG - Intergenic
1109977983 13:69866734-69866756 CCTGGGCAAATATTATTTGAAGG - Intronic
1112497616 13:99917204-99917226 CCTGGGTACCTATTGTCTCAAGG - Intergenic
1115038140 14:28886018-28886040 CCAGGGCTTCTATCATCTGAAGG - Intergenic
1117931204 14:60842322-60842344 CCAGGGCAGCTATAATTTGCAGG - Intronic
1121274570 14:92658792-92658814 CCTGGGCAGCTGTATGCTGATGG - Intronic
1126694666 15:51315731-51315753 CCTTGGCACCCAGAATCTGCAGG - Intronic
1128358304 15:66943565-66943587 CCTGGGCTCCTACATTCTGAAGG - Intergenic
1129181078 15:73875924-73875946 TCTGGGCTCCTTTAATGTGACGG - Intronic
1129698789 15:77755709-77755731 CCTGGGCACCTACTATGTGCTGG + Intronic
1130012271 15:80160979-80161001 CCTGGGCACCTGTGAGCTGAGGG + Intronic
1135573570 16:23567776-23567798 CCTGAGCAGCTGTAATGTGAGGG + Intronic
1135872112 16:26160736-26160758 CCTGGGTACCTAGAATCAGATGG + Intergenic
1141697576 16:85627427-85627449 CCTGGGCACCCTCAAACTGAGGG - Intronic
1141834866 16:86532043-86532065 CCTGGGCACCGACACCCTGAGGG - Exonic
1142868763 17:2807475-2807497 ACTGGGCACCTACACTCTGCAGG + Intronic
1143464908 17:7130237-7130259 ACTGAGCACCTACAATGTGAGGG - Intergenic
1147892123 17:43724800-43724822 CCTGGGTCCCTATAGTATGAGGG - Intergenic
1148170148 17:45512504-45512526 GCTGAGCATCTCTAATCTGAGGG + Intergenic
1148170624 17:45516497-45516519 GCTGAGCATCTCTAATCTGAGGG + Intergenic
1148279059 17:46333316-46333338 GCTGAGCATCTCTAATCTGAGGG - Intronic
1148301276 17:46551169-46551191 GCTGAGCATCTCTAATCTGAGGG - Intronic
1148365401 17:47052059-47052081 GCTGAGCATCTCTAATCTGAGGG - Intergenic
1150401233 17:64858100-64858122 GCTGAGCATCTCTAATCTGAGGG + Intronic
1156215203 18:34990962-34990984 CTTGGGGACAGATAATCTGATGG + Intronic
1158772427 18:60535710-60535732 CCTGGGCATCTACCATGTGAAGG - Intergenic
1162346657 19:10122418-10122440 GCTGGGCACCTGTAATCGGGAGG + Intergenic
1166225651 19:41393490-41393512 CCTGGGCAACTGTAATCCCAAGG + Intronic
1166789887 19:45392358-45392380 CCTGGGGACCTGTCCTCTGATGG - Intronic
932537743 2:72617642-72617664 GGTGGGCACCTGTAATCTGGAGG - Intronic
936587303 2:113769583-113769605 CCTGGGCTGCTGTCATCTGAAGG + Intergenic
936979953 2:118255166-118255188 CCTGATAAACTATAATCTGATGG + Intergenic
943363418 2:186947219-186947241 CCTGGTCTCCTCTAAGCTGAGGG - Intergenic
945489933 2:210442953-210442975 CCTGGGAGCCTAAACTCTGAGGG + Intronic
948686608 2:239674424-239674446 CCTGGGCCCCTTTCATCTTAGGG + Intergenic
1171040031 20:21754449-21754471 CCTAGGGACCTAGAAACTGAAGG - Intergenic
1173823500 20:46032923-46032945 CCTGAGCACCTATTATGTGCTGG + Intronic
1175961398 20:62638508-62638530 TCTGGGCATCTATAATCCCAGGG + Intergenic
1179080573 21:38166923-38166945 CCTGGAGAGCTGTAATCTGATGG - Intronic
950108459 3:10403423-10403445 CCTAGGCACATCTGATCTGAAGG + Intronic
950189035 3:10963762-10963784 CCAGGGCTCCCATCATCTGAAGG + Intergenic
960288099 3:115852444-115852466 CCTGGGCACCTAGCACCTGCTGG + Intronic
961115041 3:124322103-124322125 CTTGGTCACCTAGAAGCTGAAGG + Intronic
962382514 3:134909187-134909209 CCTGGCCTCTCATAATCTGAAGG + Intronic
962448681 3:135492953-135492975 TCTGAGCACCTGTAATCTGATGG - Intergenic
963448135 3:145440621-145440643 CCTGGCCCTCTATAATCGGAAGG - Intergenic
970863607 4:20733934-20733956 CCTGGGCACCTTTTGTCTGTGGG + Intronic
971639372 4:29111139-29111161 ACTGTCCAACTATAATCTGAAGG + Intergenic
975154083 4:71051801-71051823 CCTGGGCTCACATAATCTGCTGG + Intergenic
975910242 4:79258616-79258638 CCTTGGCACCTATAGCCTGGGGG + Intronic
977440124 4:97055301-97055323 CATGGACACCTATGAGCTGAAGG + Intergenic
978922348 4:114200232-114200254 CCTGGGCCTCTATAATCAGCAGG + Intergenic
979565805 4:122152741-122152763 CCCTGGCACCTATAAACCGAGGG + Intronic
981398155 4:144278937-144278959 CCAGGGCTACTATCATCTGAAGG - Intergenic
983278242 4:165644844-165644866 CCTGGAGACCAATAAACTGACGG - Intergenic
984969095 4:185170543-185170565 AGTGGGCACCTATAATCCCAGGG - Intronic
985278478 4:188262581-188262603 CCTATGCACCTATGATGTGATGG + Intergenic
990526766 5:56635950-56635972 ACTGGACACCTTTAACCTGAAGG + Intergenic
992295038 5:75319222-75319244 CCCGAGCAACTATGATCTGAGGG - Intergenic
998394775 5:141811641-141811663 ACTGGGCCCCTCTAATCAGAAGG - Intergenic
999731742 5:154480358-154480380 CCTGTGAATGTATAATCTGAGGG - Intergenic
1009844055 6:69113992-69114014 CCTGGGCACCAAAACTCTGCAGG - Intronic
1012927957 6:105286625-105286647 CATGGGCTTCTATAAACTGAAGG + Intronic
1024569397 7:50711291-50711313 CCTTTGCACCAAAAATCTGAGGG - Intronic
1034990541 7:155545227-155545249 TCTGGGCACCTAGTACCTGAGGG + Intergenic
1035270441 7:157716629-157716651 CCTGGCCACGTAGACTCTGAGGG + Intronic
1035270493 7:157716959-157716981 CCTGGCCACGTAGACTCTGAGGG + Intronic
1037835877 8:22214473-22214495 CCTGGGCAGCTAGAAGGTGAGGG - Intergenic
1042300612 8:67276502-67276524 TCTGGGCAAATATAAACTGAAGG + Intronic
1042943703 8:74133322-74133344 CCTGGTCACCCAAAATCTTATGG + Intergenic
1043065899 8:75569387-75569409 CCTGGGCACATATCATCACACGG + Intergenic
1043981020 8:86639574-86639596 CCTGGTGACCTATAAATTGAAGG - Intronic
1048186265 8:132243973-132243995 CCTGAGCACCTGGCATCTGAAGG - Intronic
1058481545 9:105400711-105400733 CCTGGGAACCTATATTCAGTGGG - Intronic
1060104566 9:120865793-120865815 CCTGGCCCTCTATAATCTGGGGG - Exonic
1188766535 X:34099751-34099773 CCTGGGCACCAGGAATCTCATGG + Intergenic
1189108164 X:38257634-38257656 CCTTAGCATCTATCATCTGATGG - Intronic
1193169138 X:78315876-78315898 CCTGGGGATCTATAATCAGCAGG - Intronic
1194209533 X:91054648-91054670 CCTTGGCCCCTCTAATCAGAGGG - Intergenic
1195868670 X:109462440-109462462 ACTGGGCACCTGCAAACTGAGGG + Intronic
1198655205 X:138906415-138906437 CCTGAGCACCTATCATGTGCTGG + Intronic
1200280744 X:154774952-154774974 CCTGGGCAGCCAAAATCTCACGG - Intronic