ID: 1103989079

View in Genome Browser
Species Human (GRCh38)
Location 12:124786270-124786292
Sequence TGGCCAGAGGGTCCGATCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 102}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103989067_1103989079 30 Left 1103989067 12:124786217-124786239 CCACTCCGGCAGAGACGCAGGAC 0: 1
1: 0
2: 0
3: 4
4: 146
Right 1103989079 12:124786270-124786292 TGGCCAGAGGGTCCGATCTGAGG 0: 1
1: 0
2: 1
3: 6
4: 102
1103989068_1103989079 25 Left 1103989068 12:124786222-124786244 CCGGCAGAGACGCAGGACTGCTG 0: 1
1: 0
2: 3
3: 12
4: 197
Right 1103989079 12:124786270-124786292 TGGCCAGAGGGTCCGATCTGAGG 0: 1
1: 0
2: 1
3: 6
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103989079 Original CRISPR TGGCCAGAGGGTCCGATCTG AGG Intronic
901325768 1:8364315-8364337 TGGGCAGAGGGGCCCTTCTGTGG + Intronic
901797078 1:11686054-11686076 TGTCCAGAGGGTTTGTTCTGGGG - Intronic
901857605 1:12054281-12054303 TGGCCAGAGTGTGAGAGCTGAGG - Intergenic
902583545 1:17424310-17424332 TGCCCACAGGGTCAGAACTGAGG + Intronic
903230636 1:21920396-21920418 TGGCCTGAGGGGCAGAGCTGGGG - Intronic
904475190 1:30760295-30760317 TGGCCAAAGGGTCTGACCTTTGG - Intergenic
905962004 1:42050797-42050819 TGGCCTGAGTGGCCGAGCTGGGG - Intergenic
916315579 1:163444524-163444546 AGTCCAGAGGGTGGGATCTGTGG - Intergenic
916507276 1:165439470-165439492 TAGCCAGCTGGTCCGAACTGGGG + Intronic
919955719 1:202413121-202413143 TGGCCAGAAGGTCAGATTGGAGG + Intronic
920570801 1:207015877-207015899 TGGCGAGAGGCTCAGATCTGGGG - Intronic
924027836 1:239855818-239855840 TGGACAGAGGGACAGATATGTGG - Intronic
924423070 1:243927231-243927253 TGGCCTGAGGTTTCGAGCTGTGG + Intergenic
1063175730 10:3549324-3549346 TGGCCAGAGGGCCAGAGGTGGGG + Intergenic
1067685323 10:48463442-48463464 TGGGCAGAGGGTCCCATGAGGGG + Intronic
1071076542 10:81760578-81760600 TTGCCAGAGGGTCAGGGCTGGGG - Intergenic
1075361025 10:121834166-121834188 TAGTCAGAGGGTCCTCTCTGAGG - Intronic
1076839610 10:133039539-133039561 TGGGCTAAGGGTCCCATCTGTGG + Intergenic
1076857782 10:133126094-133126116 TGGGCCGAGGGTCCGTGCTGCGG - Intronic
1077351931 11:2097095-2097117 TGGCCCGAGGGCCCGCTCTGAGG + Intergenic
1079013483 11:16848950-16848972 GGGCCAGAGGGTAGGCTCTGGGG - Intronic
1081262410 11:40977007-40977029 TAGCTAGATGGTCCCATCTGGGG + Intronic
1085913906 11:80862001-80862023 TGATCAGAGGGTCTGACCTGAGG - Intergenic
1096461762 12:51825566-51825588 GGGCGAGAGGGTCTGAGCTGTGG - Intergenic
1099324704 12:81199911-81199933 TGGCCAGAGAGTCCTATGAGAGG - Intronic
1102671217 12:114620690-114620712 TGGGCAGATGGTCCGAGCAGAGG + Intergenic
1103939232 12:124492918-124492940 AGGCAGGAGGGTCCGATATGGGG + Intronic
1103989079 12:124786270-124786292 TGGCCAGAGGGTCCGATCTGAGG + Intronic
1113737811 13:112690513-112690535 CGGCCACAGGGTCCGGGCTGCGG - Intronic
1118346702 14:64946310-64946332 TGGGCAGTGGCTCCAATCTGTGG - Exonic
1118460653 14:65984116-65984138 GGGCCAGAGGGCCAGATATGTGG + Intronic
1120864852 14:89286945-89286967 TGGCCACAGGGTCCAATCCAGGG + Intronic
1122106381 14:99459997-99460019 TGCCCAGAAGATCCGAGCTGTGG - Intronic
1122524496 14:102371170-102371192 TGGAAAGAGGGTCAGTTCTGTGG + Intronic
1128061795 15:64739992-64740014 TGGCCAGACGGTCACAGCTGCGG + Exonic
1128534311 15:68479213-68479235 AAGCCAGAGGGTGAGATCTGAGG + Intergenic
1129249322 15:74299970-74299992 TGGCCAGTGGGTAGGAGCTGGGG - Intronic
1129722423 15:77885168-77885190 AGGCCAGAGGGCCTGCTCTGGGG - Intergenic
1131144619 15:90002617-90002639 TGGCCCAAGGGCCGGATCTGCGG - Intronic
1132371324 15:101301369-101301391 GGGCCAGAGGTTCAGATCAGAGG - Intronic
1135947460 16:26877530-26877552 GGACCAGAGGGACCCATCTGGGG - Intergenic
1136267703 16:29130945-29130967 TGGCCAGGGGGTCTGAGTTGGGG + Intergenic
1137576843 16:49605563-49605585 GGGCCTGAGGGTCTGTTCTGGGG - Intronic
1141686051 16:85570604-85570626 TGGCCAGCGGGTCAGACCGGTGG + Intergenic
1141854668 16:86672945-86672967 TGGCAAGAGGGTCAGATTAGAGG + Intergenic
1144057991 17:11558707-11558729 GGGCCAGCGGGTCCAATCAGTGG + Exonic
1145766493 17:27461517-27461539 TGGCCAGAGGGTTACAACTGTGG - Intronic
1146375133 17:32288752-32288774 TGGGGAGAGGGTCAGAGCTGGGG - Intronic
1148737988 17:49875619-49875641 TGGCCAGAGGGACCCATGTTAGG + Intergenic
1151970897 17:77456881-77456903 TGGCCATAGGGGCCCATCTCTGG - Intronic
1152243982 17:79175779-79175801 TGGGCAGCAGGTCCGAGCTGCGG + Intronic
1152259472 17:79259347-79259369 TGGCAAGAGGGTGTGTTCTGGGG + Intronic
1160555310 18:79720832-79720854 TGGCCTGGGGGTCCGAGATGAGG - Intronic
1161051292 19:2165127-2165149 TGGCCAGAGGGTCCCAAGCGCGG - Intronic
1164607157 19:29608129-29608151 TGGCCAGAGGGTGGGATAAGAGG + Intronic
1165991747 19:39819196-39819218 TGGCCAGTGGGTCCAGTCAGAGG + Intergenic
1166944877 19:46390523-46390545 TGGCCAGAGGGTCTGCTCCCTGG + Exonic
930233193 2:48863481-48863503 TGTCCAGAGGGTCTGATTTATGG + Intergenic
940649272 2:156425456-156425478 GGGAGAGAGGGTCTGATCTGGGG - Intergenic
944091811 2:195919955-195919977 TGGCCAGAGGTACAGATATGGGG + Intronic
948953197 2:241268492-241268514 TAGCCAGAAGGTCCGTCCTGAGG + Exonic
1169350116 20:4861951-4861973 TGACCAGAGGGTTCTGTCTGAGG + Exonic
1175823886 20:61926174-61926196 TGACCAGGGGCTCCGCTCTGAGG + Intronic
1175839571 20:62018575-62018597 TGGCCTTGGGGTCCCATCTGTGG - Intronic
1175967969 20:62669097-62669119 GGGACAGAGGGTCTGCTCTGAGG + Intronic
1176625170 21:9086716-9086738 AGGCCTGAGGGTCCGCTCAGGGG - Intergenic
1179958720 21:44756210-44756232 TGTCCACAGGGTTCGATGTGGGG - Intergenic
1180840472 22:18956733-18956755 GGGCCGGAGGGTCCCATCTTTGG + Intergenic
1181808541 22:25390113-25390135 CAGCCAGTGGGTCAGATCTGCGG + Intronic
1183746656 22:39695622-39695644 TGGCCAGAGGGTGGCATCTTCGG - Intergenic
1184500612 22:44869355-44869377 TGCCCAGAGGCCCTGATCTGTGG + Intergenic
1184876909 22:47282125-47282147 TGGCCAAAGGGTTGGAGCTGAGG + Intergenic
1184892289 22:47387406-47387428 TGCCCAGAGGGCTCGAACTGGGG + Intergenic
1185338040 22:50279538-50279560 TGGCCTGTGGGTCCCATCTGTGG + Intronic
950259989 3:11536641-11536663 TGGCAAGAGGGTCCGCTCTCGGG - Intronic
952412693 3:33063908-33063930 TGGCCAGGGTGTCCGTTCTGAGG - Intronic
957503611 3:81091043-81091065 TAACCAGAAGGTCCCATCTGGGG + Intergenic
961003310 3:123388548-123388570 GGGCCAGAGGGACAGATATGGGG + Intronic
973619480 4:52712582-52712604 CGGCCCGTGGGTCCGATCAGGGG + Intergenic
975716800 4:77212992-77213014 TAGCCAGAGGCTCAGATCTCAGG - Intronic
977699828 4:100008541-100008563 TGACTAGAGGGTCCCATCTGGGG + Intergenic
989128770 5:38083319-38083341 TGGCCAGAGGGACCGATACAAGG - Intergenic
990329510 5:54712237-54712259 TGGCCACAGGGTCCAGGCTGAGG + Intergenic
996401526 5:123068501-123068523 TGGCCAGAGAGTATGATCTTGGG + Intergenic
1005987388 6:30883613-30883635 GGGCCAGAGGGTCTGATCACTGG - Intronic
1006936562 6:37722899-37722921 GGGCCAAAGGCTCTGATCTGTGG + Intergenic
1016422510 6:143900048-143900070 TGGCCTGAGGCACCCATCTGGGG + Intronic
1016814011 6:148287033-148287055 AGTCCAGAGGGTCAGATTTGAGG + Intronic
1017434954 6:154407079-154407101 TGGCCACAAGGTCCCACCTGTGG + Intronic
1019422101 7:955184-955206 TGCCCAGAGGGTCCCATCTGTGG - Intronic
1019572475 7:1719463-1719485 TGTCCAGAGGGCCCTGTCTGCGG - Intronic
1027187526 7:75981020-75981042 TGGACACAGGGGCCGCTCTGAGG - Intronic
1028604899 7:92644888-92644910 AGGCCACAGGGTCAGATATGGGG + Intronic
1029619224 7:101679450-101679472 TGGCCAGTGGTTCCGATCCTGGG - Intergenic
1031622810 7:123955583-123955605 TGGCCCAAGGGTCCTATCTCAGG + Intronic
1033670418 7:143487712-143487734 TGGCCAGAAAGTCAGATATGCGG - Intergenic
1034298208 7:149992722-149992744 TCTCCAGAGGGACAGATCTGTGG + Intergenic
1034807811 7:154104061-154104083 TCTCCAGAGGGACAGATCTGTGG - Intronic
1040961191 8:53035055-53035077 TGGACAGAGTGTCTGATCAGGGG - Intergenic
1044386665 8:91597300-91597322 TGGCCAGAAGTTCAGATGTGTGG + Intergenic
1055425623 9:76193134-76193156 TGGCCAGAGAGGCAGATTTGGGG - Intronic
1060527258 9:124327618-124327640 TGGCCAGAGGAGCCCAGCTGGGG + Intronic
1061156013 9:128862073-128862095 TGGACACAGAGTCCGATGTGGGG - Intronic
1061619390 9:131801726-131801748 TGCCCAGAGGGACCTCTCTGGGG - Intergenic
1061950892 9:133935320-133935342 TGGCCAGAGGGACCGATGCATGG + Intronic
1203748344 Un_GL000218v1:57176-57198 AGGCCTGAGGGTCCGCTCAGGGG - Intergenic
1198399435 X:136254778-136254800 TGGGCAGATGGGCCCATCTGTGG + Intronic
1200846485 Y:7836166-7836188 TTGCCAGAGTGTCCTACCTGGGG + Intergenic
1201161691 Y:11172146-11172168 AGGCCTGAGGGTCCGTTCAGGGG - Intergenic
1202578884 Y:26358062-26358084 TGGCCAGAAGGTCAGATTGGAGG - Intergenic