ID: 1103990596

View in Genome Browser
Species Human (GRCh38)
Location 12:124796790-124796812
Sequence GCTTGCCCTCGAGAGCCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 122}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103990590_1103990596 4 Left 1103990590 12:124796763-124796785 CCTCACTTACGCCCACGACTGGG 0: 1
1: 0
2: 0
3: 1
4: 43
Right 1103990596 12:124796790-124796812 GCTTGCCCTCGAGAGCCTGGTGG 0: 1
1: 0
2: 0
3: 9
4: 122
1103990593_1103990596 -7 Left 1103990593 12:124796774-124796796 CCCACGACTGGGGAGTGCTTGCC 0: 1
1: 0
2: 1
3: 2
4: 76
Right 1103990596 12:124796790-124796812 GCTTGCCCTCGAGAGCCTGGTGG 0: 1
1: 0
2: 0
3: 9
4: 122
1103990594_1103990596 -8 Left 1103990594 12:124796775-124796797 CCACGACTGGGGAGTGCTTGCCC 0: 1
1: 0
2: 0
3: 11
4: 136
Right 1103990596 12:124796790-124796812 GCTTGCCCTCGAGAGCCTGGTGG 0: 1
1: 0
2: 0
3: 9
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103990596 Original CRISPR GCTTGCCCTCGAGAGCCTGG TGG Intronic