ID: 1103991830

View in Genome Browser
Species Human (GRCh38)
Location 12:124804582-124804604
Sequence GCTTCATTCTTTGCTGGTAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 152}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103991830_1103991833 1 Left 1103991830 12:124804582-124804604 CCGATACCAGCAAAGAATGAAGC 0: 1
1: 0
2: 1
3: 9
4: 152
Right 1103991833 12:124804606-124804628 AGCAGAGGCCAATGCCCAGACGG 0: 1
1: 0
2: 1
3: 46
4: 376
1103991830_1103991841 29 Left 1103991830 12:124804582-124804604 CCGATACCAGCAAAGAATGAAGC 0: 1
1: 0
2: 1
3: 9
4: 152
Right 1103991841 12:124804634-124804656 ACAGGACCAGGAGACAGCAGCGG 0: 1
1: 0
2: 5
3: 49
4: 489
1103991830_1103991836 11 Left 1103991830 12:124804582-124804604 CCGATACCAGCAAAGAATGAAGC 0: 1
1: 0
2: 1
3: 9
4: 152
Right 1103991836 12:124804616-124804638 AATGCCCAGACGGGCCAGACAGG 0: 1
1: 0
2: 4
3: 10
4: 209
1103991830_1103991842 30 Left 1103991830 12:124804582-124804604 CCGATACCAGCAAAGAATGAAGC 0: 1
1: 0
2: 1
3: 9
4: 152
Right 1103991842 12:124804635-124804657 CAGGACCAGGAGACAGCAGCGGG 0: 1
1: 0
2: 0
3: 45
4: 452
1103991830_1103991834 2 Left 1103991830 12:124804582-124804604 CCGATACCAGCAAAGAATGAAGC 0: 1
1: 0
2: 1
3: 9
4: 152
Right 1103991834 12:124804607-124804629 GCAGAGGCCAATGCCCAGACGGG 0: 1
1: 0
2: 8
3: 107
4: 363
1103991830_1103991839 17 Left 1103991830 12:124804582-124804604 CCGATACCAGCAAAGAATGAAGC 0: 1
1: 0
2: 1
3: 9
4: 152
Right 1103991839 12:124804622-124804644 CAGACGGGCCAGACAGGACCAGG 0: 1
1: 0
2: 0
3: 14
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103991830 Original CRISPR GCTTCATTCTTTGCTGGTAT CGG (reversed) Intronic
901418632 1:9135221-9135243 GCCTCATTCTTTGGGGGAATTGG + Intergenic
903972085 1:27125576-27125598 GCTTCACTCTTGGCTGGTGTAGG - Intronic
910591320 1:88930157-88930179 GCCTCATTGTTTACTGGTAGTGG + Intergenic
912926264 1:113915810-113915832 GCATCATTCTGTTCAGGTATAGG - Intergenic
913510978 1:119561901-119561923 GCTACATACTCTGTTGGTATCGG + Intergenic
913515201 1:119599307-119599329 GCTACATACTCTGTTGGTATCGG + Intergenic
915809728 1:158894055-158894077 GTTTCAATCTTTGCTAGGATGGG - Intergenic
915863665 1:159475232-159475254 GCTTCCTTTTTTTGTGGTATGGG - Intergenic
917030206 1:170682161-170682183 CCTTCTCTCTTTACTGGTATAGG + Intronic
922201344 1:223404263-223404285 CCCTCAGTCTTTGCTGGCATGGG - Intergenic
922642108 1:227244903-227244925 GCTTCATTCTCTGCTGTGACAGG - Intronic
924038401 1:239958575-239958597 GATTCATTGTTTGTTGGTTTTGG - Intergenic
1063066041 10:2609786-2609808 GCTCCATTCTTTGATTCTATTGG + Intergenic
1065088519 10:22205057-22205079 GCTTCATTCTCTGCTTGTGCTGG - Intergenic
1065426282 10:25607481-25607503 GATTCAGTCTTTGCTGGGAATGG + Intergenic
1075253736 10:120907447-120907469 GTTTCATTCTTTTCTGGTCCTGG - Intronic
1080851111 11:36070988-36071010 GCATCGATCTTTGCTGGAATTGG - Intronic
1081724554 11:45318985-45319007 GATTCATTCTTTGCTGGGATTGG - Intergenic
1081830912 11:46112810-46112832 GCATCATTCATTGCTAGTGTGGG - Intronic
1085185297 11:74570856-74570878 GCTTCATGGTTTCCAGGTATTGG - Intronic
1087854046 11:103069421-103069443 CATTCAGTCTTTGCTGGCATTGG - Intronic
1088525687 11:110751296-110751318 GTTACATCCTTTTCTGGTATTGG + Intergenic
1089586831 11:119514983-119515005 GCTGCATCCTGGGCTGGTATTGG + Intergenic
1090692256 11:129196101-129196123 GCTTCTCTCTTTGCTGCTGTGGG - Intronic
1091959357 12:4678805-4678827 CCTTCATACATTGCTGGTAGGGG + Intronic
1092382931 12:8012584-8012606 GCTTCCTTCTTGGTTGGTACAGG + Intergenic
1092996269 12:13953776-13953798 GCTTCCTGCTTTGCTGATCTGGG + Intronic
1097665505 12:62473454-62473476 GCTTCATTATTTGTTACTATTGG + Intronic
1099177312 12:79436877-79436899 GTCTCTTTCTTTTCTGGTATTGG - Intronic
1100034993 12:90239684-90239706 GCTTCATTCTTTGTTGTGTTGGG + Intergenic
1101237129 12:102801219-102801241 GCTTCAAACTCTTCTGGTATGGG - Intergenic
1101393104 12:104321167-104321189 GCTGGATTTCTTGCTGGTATTGG + Exonic
1101403951 12:104412064-104412086 GCTTTATTCTTTACTGGAAAAGG - Intergenic
1102879811 12:116475611-116475633 GCATCAGTCTTTGGTGGTGTGGG - Intergenic
1103991830 12:124804582-124804604 GCTTCATTCTTTGCTGGTATCGG - Intronic
1104303822 12:127591190-127591212 GCTTCATTCTGTGCTGTTTGCGG - Intergenic
1107249719 13:38345200-38345222 GCTATATTCTTCACTGGTATAGG - Intergenic
1109135044 13:58637865-58637887 ACTTCATTCTTTGTTTTTATGGG - Intergenic
1109866127 13:68266643-68266665 GCTTCATGCTTTTCTCTTATAGG - Intergenic
1112131827 13:96533124-96533146 GCTTCATTCTCTGTTGTAATTGG + Intronic
1113109652 13:106808796-106808818 GTTTTATTCTTAGCTGTTATGGG - Intergenic
1114384586 14:22241979-22242001 GCTTCATTGTTTACAGGTAGTGG + Intergenic
1115166907 14:30458914-30458936 GCTTCCTGGTTTGCTGGGATGGG - Intergenic
1115683395 14:35767336-35767358 GCTTTCTTCTTTTCTGATATAGG - Intronic
1116964008 14:50995759-50995781 TTTTTTTTCTTTGCTGGTATTGG - Intronic
1118687915 14:68310225-68310247 GCTTCACTCTTGGGTGGTGTTGG + Intronic
1119707391 14:76791924-76791946 CCTTCTTTCTTTCCTGATATTGG - Intronic
1124078944 15:26473485-26473507 GCTTCATCCTTTGTTGTTATAGG - Intergenic
1124530907 15:30505383-30505405 TCTTCTTTCATTGCTGATATTGG - Intergenic
1124767750 15:32502312-32502334 TCTTCTTTCATTGCTGATATTGG + Intergenic
1125777013 15:42225242-42225264 TTTTCCTTCTTTGGTGGTATGGG + Intronic
1127303180 15:57677639-57677661 GCTTAATTCAATGCTTGTATTGG - Intronic
1127359082 15:58229312-58229334 GTTTCATTCTTTGCAGGATTTGG - Intronic
1127661872 15:61107062-61107084 GCTACATTCATTGCTGGAGTGGG + Intronic
1131602755 15:93866260-93866282 GTTCCATTCTTTGGTGGCATTGG + Intergenic
1135155612 16:20050381-20050403 GGTGCATTCTTTGCAGGGATGGG + Intronic
1137968884 16:52964063-52964085 GCTTCTTTGTTTGCTGGAATGGG + Intergenic
1140595245 16:76401336-76401358 GCTTGGTTCTTGGCTGTTATTGG + Intronic
1143168543 17:4911932-4911954 CATCCATTCTTTGCTGATATGGG - Intergenic
1148140019 17:45321664-45321686 CCTCCATTCTTTGCTGAAATTGG - Intergenic
1153226045 18:2900737-2900759 GCTTCAGTCCGTGATGGTATGGG + Intronic
1153983733 18:10334577-10334599 ACTTAATGCTTTGCTGGTTTGGG + Intergenic
1155181121 18:23347947-23347969 CCTTCATTCATTTCTGATATGGG + Intronic
1155603730 18:27579051-27579073 GCTTCTTTCTCTGCTAGTGTTGG - Intergenic
1158229139 18:55234305-55234327 GCCTCATTCCCTGCTGATATAGG + Intronic
1159858552 18:73618362-73618384 GCTTCATTCATTGCTCCTCTGGG - Intergenic
1163755434 19:19103826-19103848 GCTTCCTCCTTGGCTGGCATGGG + Intronic
1164694919 19:30236184-30236206 GCTTGCTTCTGTGCTGGTCTTGG + Intronic
1165251260 19:34537853-34537875 GCTTAATTCTTTGCTGTTGAGGG - Intergenic
1165268909 19:34687740-34687762 GCTTAATTCTTTGCTGCTGAGGG + Intergenic
1165399065 19:35586146-35586168 GCTTCAGCCTTTGATGGTTTGGG + Intergenic
1166408455 19:42540374-42540396 CCTTTATTCTTTGCTGTGATGGG + Intronic
925974658 2:9133392-9133414 GCTTTATTCTTTGGTGGGTTCGG + Intergenic
928010132 2:27599722-27599744 GCTTTATTCTTTGAGGGTAAAGG + Intronic
928108063 2:28485469-28485491 GCTGCATCCTCTGCTGGAATGGG - Intronic
928677371 2:33662734-33662756 GCCTCATTGTTTACTGGTAGTGG + Intergenic
928756994 2:34538547-34538569 GTTGCATTCTTTTCTGGTTTTGG + Intergenic
928957452 2:36884665-36884687 GTTGTATTCTTTGCTGGTATAGG - Intronic
929793483 2:45040498-45040520 GCTTCAATTGTGGCTGGTATTGG - Intergenic
930696304 2:54415481-54415503 GTTTCTTTTTTTGCTGTTATAGG - Intergenic
931086800 2:58840985-58841007 ACTATGTTCTTTGCTGGTATAGG + Intergenic
933458710 2:82550562-82550584 CCTTGAGTGTTTGCTGGTATTGG + Intergenic
937757216 2:125554780-125554802 GTTTCCTTCTTTGGTGGTCTGGG - Intergenic
937798638 2:126055452-126055474 GTTACATTCTTTCCTGGTTTTGG + Intergenic
940376840 2:152967262-152967284 GCTTCATTCTTTTCTGGAAATGG - Intergenic
941991503 2:171561696-171561718 GCCTCATTTTTTACTGGTAGTGG - Intergenic
945277277 2:208000540-208000562 TCTTGAGTCTTTGCTGGTGTTGG + Intronic
946693752 2:222331914-222331936 GCTTCACAATTTGTTGGTATTGG + Intergenic
947882656 2:233532594-233532616 GCTTCATTCTTTGCTTTGCTGGG + Intronic
948744283 2:240075040-240075062 GCTTCATTTTATGATGGGATTGG + Intergenic
1169720821 20:8674474-8674496 ACCTCATTCTTTTCTGGTCTTGG + Intronic
1169739522 20:8876980-8877002 ACTCCGTTCTTTGCTGGGATGGG + Intronic
1171136034 20:22695200-22695222 GCTTCATTTCTTGCTGCTGTGGG + Intergenic
1173974446 20:47176592-47176614 GATTGACTCTTTGCTTGTATTGG - Intronic
1174866749 20:54144145-54144167 GTTTAATTCTTTGCTGGCTTTGG + Intergenic
1175134565 20:56813311-56813333 GCATCATTCTTTGTTGTTAGGGG + Intergenic
1176136114 20:63522688-63522710 GCATCATTCTGGCCTGGTATAGG + Intergenic
1177725844 21:24966595-24966617 TGTTCATTCTTTGCTGTGATGGG - Intergenic
1178575004 21:33778927-33778949 TCTTCTTTCTTTACTGATATTGG + Intronic
1184160002 22:42692407-42692429 GCTTTGTTCTTTTCTGGTTTTGG - Exonic
955950954 3:64241587-64241609 GCTTCATACCATGGTGGTATTGG - Intronic
958164762 3:89866166-89866188 GTTTCATTCTCTCCTGGTGTTGG + Intergenic
959162383 3:102737794-102737816 GCTGCATTCATTGATGGTTTTGG + Intergenic
960445214 3:117739955-117739977 GCTTCTTCATTTGCTGGAATGGG - Intergenic
961337686 3:126192411-126192433 GCTTCTTCCTTTACTGATATAGG - Intronic
963809199 3:149758186-149758208 GCCTCATTGTTTACTGGTAGTGG - Intergenic
966197483 3:177327775-177327797 GTTTCTTTCTTTGTTGGTTTGGG - Intergenic
974270367 4:59643278-59643300 GATTCATTCTTTCTTGGTTTTGG + Intergenic
981469122 4:145109925-145109947 TTTTCTTTCTTTGCTGCTATAGG + Intronic
983144180 4:164192456-164192478 ACTTTTTACTTTGCTGGTATTGG - Intronic
984606236 4:181788919-181788941 GCTACATGCTATGCAGGTATGGG - Intergenic
984724018 4:183002663-183002685 GCCTCATTCTTTACGGGTAGTGG + Intergenic
986841236 5:11699913-11699935 GCTTCATTCTTTTGTAGTAGAGG + Intronic
992834880 5:80630271-80630293 GCTACATTCTTTTTTGGTTTTGG - Intronic
993256196 5:85592774-85592796 GTTTCATTCATTTCTAGTATTGG - Intergenic
995659919 5:114470113-114470135 GCTCCATTCTTTTCTGCTACTGG - Intronic
996520569 5:124421153-124421175 ACCTCAGTCTGTGCTGGTATTGG + Intergenic
999109045 5:149100543-149100565 CCTTCATTCTTTGCTTGTCTGGG - Intergenic
999319425 5:150604183-150604205 GCTTCATGCTGTCCTGGCATGGG + Intronic
1001030863 5:168261756-168261778 GGTTCACCCTTTGCTGGCATGGG - Intronic
1001759552 5:174195806-174195828 GCTTCCTTCCATGCTGGCATTGG + Intronic
1004565739 6:16795550-16795572 TCTTCTTTCATTCCTGGTATTGG - Intergenic
1005249836 6:23931887-23931909 GTTTCATATTTTGCTGGTAAAGG - Intergenic
1008411324 6:51183310-51183332 TCTTCATCCTTTTCTGGTAGAGG - Intergenic
1010868627 6:81010863-81010885 CTTTCAGTCTTTGCTGGAATGGG + Intergenic
1011897128 6:92242248-92242270 GATTCATTCTTTATTGGCATCGG + Intergenic
1014192933 6:118519103-118519125 GCTTTCTTTTTTTCTGGTATAGG - Intronic
1015656761 6:135527186-135527208 ACTTTATTCTTTGCTGGTAACGG + Intergenic
1015795959 6:137011446-137011468 GCTTCTTTCTTAGCAGATATGGG - Exonic
1016118711 6:140320944-140320966 CCTACATTCCTTGCTGTTATAGG - Intergenic
1016534771 6:145097803-145097825 TCTTCTTGGTTTGCTGGTATCGG + Intergenic
1017479257 6:154833258-154833280 GGATCATTCTGTACTGGTATAGG - Exonic
1018703028 6:166442239-166442261 GCCTCATTCTTTCATGGTTTGGG + Intronic
1019778237 7:2925052-2925074 GCTTCATTCTGTTCTTGAATTGG + Intronic
1027612527 7:80378938-80378960 GCTTCTTTCTTAGGTGCTATTGG + Intronic
1027965635 7:85002518-85002540 CTTTCATTCTTTGCTGAAATAGG + Intronic
1030169226 7:106584935-106584957 TCTTCATTCTTTCCTGTTTTAGG - Intergenic
1034473983 7:151272261-151272283 GCTTGCTTCTCTGCTGGCATCGG + Intronic
1035143076 7:156783800-156783822 TCTTCTTTCTTTCCTGTTATGGG - Intronic
1035538393 8:410896-410918 GCTTAATTCTTGACTGGTGTAGG - Intronic
1036588368 8:10146157-10146179 GCACCATTCTTTGCTGCTCTAGG - Intronic
1039466450 8:37788417-37788439 GCTTCTTTCTGTGATGGAATGGG - Intronic
1039595005 8:38784119-38784141 GCTTCGTTCTTACCTGGTACAGG - Intronic
1040046295 8:42967314-42967336 GCCTCTTTCTTCGCTGCTATAGG - Intronic
1041510135 8:58647248-58647270 GCTTCATTCAAGGCTGGTGTTGG - Intronic
1041724559 8:61005932-61005954 GCCTCATTCTTTGCAGATTTTGG + Intergenic
1045168152 8:99630415-99630437 GCTTCTTTCTGTCCTGGTTTAGG + Intronic
1050273442 9:3971154-3971176 GCTCCATTCTTTGATGGTGATGG - Intronic
1057724403 9:97557916-97557938 GCTTCATTCTTTGTAGATATTGG - Intronic
1062096077 9:134704383-134704405 CCTTCATCCTTTGCTGATAAAGG - Intronic
1190380678 X:49837162-49837184 GCTTCATCCTTTTCTGGGAAGGG + Intergenic
1191183309 X:57584888-57584910 GCTTTCTACTTTGATGGTATAGG + Intergenic
1192367244 X:70484194-70484216 GCTGCATTCTTTGCAGCCATAGG + Intronic
1193702606 X:84781023-84781045 GCTTCATTCTTTTCTTGTCATGG - Intergenic
1195226344 X:102798343-102798365 GCTTCAATATTTTTTGGTATTGG - Intergenic
1195919961 X:109973985-109974007 ACTTCAGTCTCTGCTGGTATAGG + Intergenic
1196527060 X:116739679-116739701 GCCTCATTCTTTACGGGTAGTGG - Intergenic
1198436916 X:136626053-136626075 GGATCATTCTTTGCTGGAAGTGG - Intergenic
1198473396 X:136971594-136971616 GCTTCACTGTTTGCTGATCTAGG + Intergenic
1198765822 X:140078305-140078327 GCCTCATTGTTTACTGGTAGTGG + Intergenic
1200095827 X:153661223-153661245 CTTTCTTTTTTTGCTGGTATAGG - Intergenic
1200106866 X:153719090-153719112 CCTTCATTCTTTTTTGGGATCGG - Intronic
1201673146 Y:16548645-16548667 ACTTCATTCTTTCCAGCTATAGG + Intergenic