ID: 1103994477

View in Genome Browser
Species Human (GRCh38)
Location 12:124820373-124820395
Sequence AGGAGTCCGGGAGGTCTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 0, 2: 6, 3: 46, 4: 375}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103994472_1103994477 -3 Left 1103994472 12:124820353-124820375 CCAATAGTTGGAGGGCACTGAGG 0: 1
1: 0
2: 3
3: 10
4: 130
Right 1103994477 12:124820373-124820395 AGGAGTCCGGGAGGTCTTCCTGG 0: 1
1: 0
2: 6
3: 46
4: 375

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103994477 Original CRISPR AGGAGTCCGGGAGGTCTTCC TGG Intronic
900436134 1:2632108-2632130 AGGAATCTGGGAGGCCTGCCTGG - Intronic
900463191 1:2811058-2811080 GGCAGTCCGGGAGGGCTGCCTGG - Intergenic
900761159 1:4471813-4471835 CTGAGTCAGGGATGTCTTCCTGG - Intergenic
900793330 1:4693355-4693377 GGGAGTCATGGAGGGCTTCCTGG + Intronic
901834062 1:11912318-11912340 GAAAGTCAGGGAGGTCTTCCTGG - Intergenic
901880199 1:12189212-12189234 GGGAGTCAGGGAGGGCTGCCTGG + Intronic
902293168 1:15448036-15448058 AGGAATCCAGGATGGCTTCCTGG + Intronic
902633296 1:17718717-17718739 GGAGGTCAGGGAGGTCTTCCTGG + Intergenic
902642536 1:17775946-17775968 AAGAGTCAGGGAGGGCTTCCTGG + Intronic
902719364 1:18293822-18293844 AGGAGTCCTAGAGGCCTTGCTGG - Intronic
903369071 1:22823300-22823322 AGGAGTCAGCGAAGGCTTCCTGG - Intronic
903981954 1:27195179-27195201 AGAAGTCAGGGAGGCTTTCCTGG - Intergenic
904092549 1:27955543-27955565 TGGAATCCGGGAGGCCTTCAGGG + Intronic
904630517 1:31838491-31838513 GGGAGTCAGGGAGGTCTCCCTGG + Intergenic
904827358 1:33282103-33282125 AGCAATCAGGGAGGGCTTCCTGG - Intronic
904860226 1:33532442-33532464 AGAAGTCAGGGAGGACTTCCTGG - Intronic
904914422 1:33959751-33959773 GGCAGTCTGGGAGGGCTTCCTGG - Intronic
906436635 1:45802361-45802383 AGGAGTCCAGGATGATTTCCAGG + Intronic
906704524 1:47885288-47885310 GGGAGTCAGCGAGGGCTTCCTGG - Intronic
906748485 1:48238178-48238200 AGGAGTCAGGTAAGACTTCCTGG + Intronic
907372401 1:54011858-54011880 GGGAGTCAGGGAAGGCTTCCTGG + Intronic
908113739 1:60921658-60921680 AGGTTTCTGGGAGGGCTTCCTGG - Intronic
908427178 1:64018443-64018465 TGGAGTCAGGGAAGTCTTCTTGG - Intronic
908845467 1:68320255-68320277 AGCAGTCCCTCAGGTCTTCCCGG + Intergenic
912965959 1:114237897-114237919 AGGAGGCAGGGAAATCTTCCTGG - Intergenic
915640147 1:157218594-157218616 AGCAGTCTGGGAGCTCCTCCAGG + Intergenic
916493400 1:165323023-165323045 GGGAGTAAGGGAGGTATTCCAGG - Intronic
917717193 1:177750150-177750172 AAGAGCCCTGGATGTCTTCCAGG + Intergenic
919933235 1:202235229-202235251 AGGAGTCCTGGAGCTCCTCAGGG - Intronic
920053930 1:203179510-203179532 AGGAGCCCTGGAAGTCATCCAGG + Exonic
920665306 1:207959147-207959169 AGGAGTCCCGGGGCTCTGCCGGG - Intergenic
921217609 1:212950867-212950889 CGGGGTCCGGGAGGGCTTCCTGG + Intronic
921381826 1:214532439-214532461 AGGAGGCCAGGTGGTCTTTCAGG - Intronic
922469133 1:225865207-225865229 AGCAGTCCGGGAAGGCTCCCAGG - Intronic
922803424 1:228374149-228374171 AGCAGTCTTGGAGGACTTCCTGG + Intronic
922920637 1:229299893-229299915 AGGTGTCAGGGAGGGCTTTCAGG + Intronic
924709949 1:246523465-246523487 AGGAGCCCTGGAGGGCTGCCTGG - Intergenic
1065075293 10:22072698-22072720 AGGAATCAGGGAAGTCTTCATGG + Intergenic
1066291996 10:34022739-34022761 AGGGGACAGAGAGGTCTTCCTGG + Intergenic
1069374907 10:67783934-67783956 AGGAATCAGAGAGGTCTTCATGG - Intergenic
1069582755 10:69576699-69576721 GGGAGTCCTGGAGGTCTTAGGGG - Intergenic
1069774765 10:70919867-70919889 AGGAGTCCTGGTGCTCCTCCAGG - Intergenic
1069786745 10:70993110-70993132 AGGATTCTGGGAAGGCTTCCTGG - Intergenic
1070238574 10:74655653-74655675 GGGAGGCCCGGGGGTCTTCCTGG - Intronic
1070694693 10:78553104-78553126 AGGATTCAGGGAGGCCTTCAGGG - Intergenic
1070778931 10:79126429-79126451 AGGGGTCAGGGAGAGCTTCCTGG + Intronic
1072146885 10:92648945-92648967 ATGATTCAGGGAGGTCTTCATGG + Intronic
1072809337 10:98446918-98446940 AGGAGCCCGGGCGCGCTTCCGGG + Exonic
1073025181 10:100482504-100482526 AGTAGTCCGGGGAGTCCTCCAGG - Exonic
1073078172 10:100837566-100837588 AGCAGTCAGGGAGGGCTTCCTGG - Intergenic
1073404638 10:103286536-103286558 TGGAGGCAGAGAGGTCTTCCTGG + Intronic
1074315861 10:112361112-112361134 AGGAGACAGGCAGGGCTTCCAGG - Intergenic
1075878498 10:125828202-125828224 AGGAGTCAAGGATGACTTCCAGG + Intronic
1075985336 10:126780149-126780171 AGGAATCTGGGAAGGCTTCCTGG - Intergenic
1076314003 10:129527999-129528021 GGGAGTCCAGGAAGGCTTCCTGG - Intronic
1076706934 10:132307461-132307483 CGGTGTCCGGGACGGCTTCCCGG - Intronic
1077369781 11:2176053-2176075 AGGAGCCCAGGAGGTGTTCTGGG + Intergenic
1077672487 11:4168455-4168477 AGCACTCAGGGAGGCCTTCCTGG - Intergenic
1078907217 11:15699005-15699027 AAGAGTCAGGGAGGACTTCCTGG - Intergenic
1079080675 11:17411644-17411666 AGTAATCAGGGAGGGCTTCCTGG - Intronic
1079106869 11:17577435-17577457 AGCATTCAGGGAGGGCTTCCTGG + Intronic
1079943053 11:26705868-26705890 AGGAGTCAGACAGGTCTTCATGG - Intronic
1080090453 11:28342131-28342153 AGGAGTTGGAGAGCTCTTCCTGG + Intergenic
1080419533 11:32097697-32097719 AGCAGTCAGGGAAGGCTTCCTGG + Intronic
1080643167 11:34169795-34169817 AGGAGTCAGGAAGGGATTCCAGG - Intronic
1081694888 11:45102828-45102850 AGCAGTCAGGGAAGGCTTCCTGG + Intronic
1082785990 11:57316981-57317003 AGGAGGCCAGGATGTCTGCCTGG - Intronic
1083271285 11:61574052-61574074 AGGAGTTGGGGAGGGCTTCATGG - Intronic
1084213686 11:67635348-67635370 GGCAGTCAGGGAGGGCTTCCTGG - Intronic
1084215808 11:67646285-67646307 AGCAGTCAGGGAAGGCTTCCTGG - Intronic
1084335832 11:68457433-68457455 TGAAGTCAGGGAGGACTTCCTGG - Intergenic
1084400189 11:68938935-68938957 AGCAGTCAGGGTGGGCTTCCTGG + Intronic
1084939246 11:72603525-72603547 AGCAGCCTGGGAGGCCTTCCTGG - Intronic
1084971755 11:72775942-72775964 AGGTGTTAGGGAAGTCTTCCTGG - Intronic
1085043482 11:73340414-73340436 AGTATTCAGGGAGGGCTTCCTGG - Intronic
1085311442 11:75519298-75519320 GGGAGTCAGGGAAGCCTTCCTGG - Intronic
1085315860 11:75544566-75544588 AGCAGTCAGGGAGGTTGTCCTGG + Intergenic
1085398024 11:76217308-76217330 AGGGGTCCTGGCTGTCTTCCTGG + Intergenic
1085516729 11:77116045-77116067 AGGAGACAGGCAGGGCTTCCTGG + Intronic
1089256061 11:117194739-117194761 AGGAGTCCAGGAAAGCTTCCTGG + Intronic
1089601575 11:119618720-119618742 GGGAGTCCAGGAAGGCTTCCTGG - Intergenic
1089639927 11:119841181-119841203 GGTAGTCAGGGAGGTCTTCAAGG - Intergenic
1089655891 11:119946698-119946720 AGGAGTCCAGGAGGACTTCCAGG + Intergenic
1089673440 11:120073081-120073103 GGGGGTCAGGGAGGTCTCCCAGG + Intergenic
1089679346 11:120110691-120110713 GAGAGTCAGGGAAGTCTTCCTGG - Intergenic
1090240933 11:125181372-125181394 AGTAGTCTGGGATGGCTTCCTGG + Intronic
1091238583 11:134037443-134037465 AGGCGGCGGGGAGCTCTTCCCGG + Intergenic
1091879786 12:3967808-3967830 AGGTATCCGGGAGGCCTGCCTGG - Intergenic
1092171711 12:6377502-6377524 GGGAGTGAGGGAGGCCTTCCCGG - Intronic
1096555743 12:52402591-52402613 GGGAGTCCAGGAAGCCTTCCTGG - Intronic
1099888993 12:88566528-88566550 AAAAGTCAGGGAGGACTTCCTGG + Intronic
1101439617 12:104693689-104693711 GGGGGTCAGGGAGGGCTTCCTGG + Intronic
1102635709 12:114321726-114321748 AGTAGTCAGGGAAGGCTTCCTGG - Intergenic
1103025079 12:117567205-117567227 GGGAGTCAGGGAAGGCTTCCCGG + Intronic
1103676051 12:122656691-122656713 AGGTGTCGAGGAAGTCTTCCGGG - Intergenic
1103942212 12:124507386-124507408 AGCAATCAGGGAGGTCTCCCTGG - Intronic
1103994477 12:124820373-124820395 AGGAGTCCGGGAGGTCTTCCTGG + Intronic
1104372099 12:128232479-128232501 AGAAATCCGAGAGGGCTTCCTGG + Intergenic
1104945758 12:132414289-132414311 GGGAGACCCTGAGGTCTTCCCGG - Intergenic
1105427153 13:20303592-20303614 TGCAGTCCGGGAGATCTTGCTGG + Intergenic
1106690285 13:32107765-32107787 AGGAGCCAGGGAGGCCTTCATGG + Intronic
1107911438 13:45108975-45108997 AGGGGTCCGGGAGGGGTCCCTGG - Intergenic
1114453972 14:22843749-22843771 AGAAGGCCGGGAGGTAGTCCTGG - Exonic
1114767450 14:25390151-25390173 AGGGGTCAGGAAAGTCTTCCTGG + Intergenic
1116957578 14:50940861-50940883 AGGTGTTCCAGAGGTCTTCCCGG - Intronic
1117255321 14:53971433-53971455 AGGAGTCAAGGAAGGCTTCCTGG + Intergenic
1118774205 14:68963190-68963212 AGGAGACAGGTAGGACTTCCTGG - Intronic
1118927632 14:70207184-70207206 AGGAGTCCGGCATGACATCCAGG - Intergenic
1119265565 14:73261690-73261712 AGGGGTCAGGGAGGTCTTTGAGG + Intronic
1119904097 14:78285924-78285946 AGGAGCCAGGGGGGTCTTCCTGG - Intronic
1121138398 14:91519384-91519406 CGGAGTCCGGGAGGCCTGCTTGG + Intergenic
1121316628 14:92964721-92964743 GGGAGTCTGGAAGCTCTTCCAGG - Intronic
1121583675 14:95048534-95048556 AGGAGTGTGGGAGAACTTCCAGG - Intergenic
1122051675 14:99065269-99065291 AGGCATCAGGGAGGTCTTCTTGG - Intergenic
1122276225 14:100592147-100592169 AGGGATCGGGGAGGGCTTCCTGG - Intergenic
1124068683 15:26370913-26370935 AGGAGTCAGGGATGACTTCAAGG - Intergenic
1124146744 15:27134701-27134723 AGAAGCCCTGGAGGGCTTCCTGG - Intronic
1124439785 15:29677656-29677678 AGCAGTCCTGGAGGGCTTCGTGG + Intergenic
1124929136 15:34101869-34101891 GGGAGACTGGGAGGGCTTCCGGG - Exonic
1126171864 15:45701852-45701874 TGGAGTCTGGGAGGACTCCCAGG + Intergenic
1126570447 15:50144856-50144878 AGTAGTCCGTGACGGCTTCCAGG - Intronic
1126773238 15:52078167-52078189 AGAGGTCAGGGAGGGCTTCCTGG - Intergenic
1126906525 15:53373905-53373927 AGGTTTCAGGGAGGTCTTACTGG - Intergenic
1127796770 15:62445096-62445118 AGGGGTCAGGGAGGCCTTACTGG + Intronic
1127846674 15:62876771-62876793 GGGAGCCCTGGAGGTCATCCAGG - Intergenic
1128314646 15:66653017-66653039 AGGAGTCTGGGGAGGCTTCCTGG + Intronic
1129154181 15:73707486-73707508 AGGAGTCAGGTAGGTCTGCAGGG - Intronic
1129177174 15:73848401-73848423 GGGAGTCAGGGAGGCCTTCCTGG - Intergenic
1129382588 15:75177511-75177533 AGCAGTCCAGGAGGGCTTCCTGG - Intergenic
1129605026 15:77020720-77020742 AGGTGTCTGGGAGGGCTTCCTGG - Intronic
1129683148 15:77669602-77669624 AGCAGTCCCAGAGGGCTTCCTGG - Intronic
1129704326 15:77785776-77785798 GGAAGTCAGGGAGGGCTTCCTGG - Intronic
1129713975 15:77836345-77836367 GGCAGTCCTGGAGGGCTTCCAGG - Intergenic
1130136979 15:81189612-81189634 GGGTGTCAGGGAAGTCTTCCTGG + Intronic
1131054059 15:89365283-89365305 AGGAGCCCGGGAAGCCATCCAGG - Intergenic
1131116693 15:89800288-89800310 AGAGGTCAGGGAGGGCTTCCCGG - Intronic
1132319909 15:100918432-100918454 CGGCGTCCGGGAGGTCCTGCAGG + Intergenic
1132851359 16:2026464-2026486 GGGGGTCCGGAAGGGCTTCCCGG + Intronic
1133164764 16:3938826-3938848 AGGAGTCCGGGCGGTTTCCAAGG + Intergenic
1134390869 16:13818910-13818932 AGTAGTCAGGGAAGACTTCCTGG + Intergenic
1135938179 16:26798542-26798564 AGGAGTCAAGGAAGGCTTCCTGG + Intergenic
1136092072 16:27927697-27927719 AGGCATCAGGGAGGACTTCCTGG - Intronic
1137393207 16:48098424-48098446 AGAACTCTGGGAGGCCTTCCAGG - Intronic
1137507716 16:49068872-49068894 AGAAGTCTGGGAAGGCTTCCTGG - Intergenic
1137724988 16:50651003-50651025 GGGGGTCAGGGAGGGCTTCCTGG - Intergenic
1138519458 16:57562841-57562863 AGCAGTCAGGGAAGGCTTCCTGG + Intronic
1139346578 16:66307647-66307669 GGGAGTCAGGGAGGACTTCCTGG + Intergenic
1139361082 16:66400684-66400706 TGCAGTCAGGGAGGGCTTCCTGG + Intronic
1139372389 16:66477191-66477213 GGAAGTCAGGGAGGGCTTCCTGG - Intronic
1140347592 16:74228919-74228941 AAGAGGCAGGGAGGTCATCCAGG + Intergenic
1140855376 16:78973272-78973294 AGAAGTCCGGGCTGTCATCCTGG + Intronic
1140888434 16:79264681-79264703 AGCATTTAGGGAGGTCTTCCTGG - Intergenic
1141648401 16:85379466-85379488 AAGATTCCAGGAGGTCTCCCTGG + Intergenic
1141656309 16:85418491-85418513 AGCAGTCAGAGAGGGCTTCCTGG - Intergenic
1141680111 16:85538836-85538858 AGGAGCCCCAGAGGTCTTCCAGG - Intergenic
1142607801 17:1091564-1091586 AGGAGTCCGAGAGGGCTGCCCGG + Intronic
1142991267 17:3732748-3732770 AGGAATTCGTAAGGTCTTCCTGG + Intronic
1143105172 17:4526172-4526194 TGGGGTCAGGGAGGGCTTCCTGG + Intronic
1143619044 17:8070737-8070759 GGGAGTCCCTGAGGTCTTCAAGG - Intergenic
1144493715 17:15734487-15734509 AGGAGCCCTGGAGGGCTGCCTGG + Intronic
1144605521 17:16662271-16662293 AGTAGTACAGGAGGACTTCCTGG - Intergenic
1144906550 17:18642192-18642214 AGGAGCCCTGGAGGGCTGCCTGG - Exonic
1148229096 17:45920093-45920115 AGGAGCCAGGGTGCTCTTCCTGG + Intronic
1148464313 17:47855868-47855890 CTGAGTCCGTGAGGTCTGCCAGG + Intronic
1148677725 17:49454927-49454949 AGAGGTCAGGGAGGACTTCCTGG - Intronic
1148678084 17:49456684-49456706 AGCAATCCTGGAGGGCTTCCAGG - Intronic
1149529784 17:57385892-57385914 AGGTGTCTGGGAGATCTTCAAGG + Intronic
1151599507 17:75097641-75097663 AGGAGTCGGGGCAGTGTTCCAGG - Intronic
1151965077 17:77426910-77426932 AGCAGTCAGGGAAGACTTCCTGG + Intronic
1152210003 17:78998075-78998097 GGCAGTCAGGGAGGGCTTCCTGG - Intronic
1152353325 17:79795174-79795196 AGGGGTCCGGGAGCTCCTTCCGG + Exonic
1152594170 17:81230213-81230235 TGCAGTCAGGGAGGGCTTCCTGG + Intronic
1153948652 18:10038649-10038671 AGGGGTCAGGGAAGGCTTCCTGG + Intergenic
1155278116 18:24209883-24209905 AGGAGTCAGGGAGAACATCCTGG + Intronic
1156490523 18:37493276-37493298 AGTAGTCAGGGAAGGCTTCCTGG - Intronic
1156778011 18:40817283-40817305 AGGAGTCCAGGAGATTTTGCGGG + Intergenic
1158875339 18:61728909-61728931 AGGACTCCAGAAAGTCTTCCTGG - Intergenic
1160741436 19:687956-687978 GGGAGTCTGGGAAGACTTCCTGG - Intronic
1160953756 19:1680024-1680046 TGGGGTCAGGGAGGGCTTCCTGG + Intergenic
1160955076 19:1687521-1687543 AGGGGTCAGAGAGGGCTTCCTGG + Intergenic
1161066863 19:2242988-2243010 GGCAGTCCGGGATGGCTTCCTGG + Intronic
1161250089 19:3275793-3275815 AGGAATCCCGGAGGCCCTCCCGG + Intronic
1161352740 19:3803057-3803079 AGGAATCCAGGAGGCCTCCCTGG + Intergenic
1161421314 19:4177224-4177246 AGGAGTCCGGGAAGCCTTCCTGG - Intronic
1161422500 19:4183571-4183593 GGGCATCCGGGAGGGCTTCCTGG + Intronic
1161483250 19:4521367-4521389 TGGAGTCCTGGAAGCCTTCCTGG + Intergenic
1161502403 19:4623653-4623675 GGCGGTCCGGGAGGGCTTCCTGG - Intergenic
1161816076 19:6501068-6501090 AGGATTCAGGGAAGTCTTCCTGG - Intronic
1161874126 19:6894425-6894447 AGGAGTCAGGGAAGGCTTCCTGG + Intronic
1162069352 19:8144491-8144513 GGGAGTCAGGGAGGGCTTCCTGG - Intronic
1162079967 19:8211973-8211995 AGGAGTCAGGGAAGGCCTCCTGG + Intronic
1162199862 19:9012041-9012063 GGGAATCAGGGAAGTCTTCCTGG + Intergenic
1162533357 19:11248571-11248593 AGGGGTCAGGGAGGACTTCCTGG - Intronic
1162925445 19:13928571-13928593 AGTGGTCAGGGAGGGCTTCCTGG - Intronic
1163500096 19:17671171-17671193 AGAAGTCAGAGAGGGCTTCCTGG + Intronic
1163506096 19:17707136-17707158 GGGAGTCAGGGAAGGCTTCCTGG - Intergenic
1163532756 19:17860197-17860219 AGGACTCCGGGTCTTCTTCCCGG + Intronic
1163564949 19:18045523-18045545 GGCAGTCCTGGAGGGCTTCCTGG - Intergenic
1163682738 19:18692659-18692681 GGGAATCTGGGAGGGCTTCCTGG + Intronic
1163761099 19:19137279-19137301 TGGAGTCTCAGAGGTCTTCCTGG + Intronic
1163762522 19:19145458-19145480 GGGTGTCCGGGAGGGCTGCCAGG - Intergenic
1163827362 19:19531076-19531098 GGGAGTCAGCGAGGGCTTCCTGG - Intronic
1164683169 19:30149521-30149543 AGGGGTCAGGGAAGGCTTCCTGG + Intergenic
1165362345 19:35344745-35344767 AGAAGTCCAGGATGCCTTCCAGG + Intronic
1165493154 19:36136955-36136977 TGGAGACAGGGAGGTCTTTCTGG + Intergenic
1166557852 19:43713404-43713426 GGGAGTCAGGGAGGGCTTCCTGG - Intergenic
1166658031 19:44626557-44626579 AGGAGTTAAGGAGGGCTTCCTGG + Intronic
1166663089 19:44660008-44660030 GGGGGTCAGGGAGGGCTTCCTGG - Intronic
1166666013 19:44680906-44680928 AGGACTCAGTGAGGGCTTCCTGG - Intronic
1166668816 19:44697824-44697846 TGAAGTCCAGGAGGGCTTCCTGG + Intergenic
1166674616 19:44732381-44732403 AGAAATCAGGGAGGGCTTCCTGG + Intergenic
1166717037 19:44975163-44975185 GTGAGTCAGGGAGGGCTTCCTGG - Intronic
1166784422 19:45359140-45359162 GGGGGTCAGGGAGGGCTTCCTGG + Intronic
1166795767 19:45424453-45424475 CGGAGTCCGGAAGGGCTTCCTGG + Intronic
1166826663 19:45614127-45614149 GGGAATCAGGGAGGGCTTCCTGG - Intronic
1166830451 19:45636462-45636484 TGGAGTCATGGAGGGCTTCCTGG - Intronic
1167088105 19:47324295-47324317 GGAAGTCAGGGAGGTATTCCTGG - Intergenic
1167095692 19:47373876-47373898 AGAAATCCAGGAGGGCTTCCTGG + Intronic
1167096235 19:47376326-47376348 AGGAGTCAGGGAGGGCTTCCTGG + Intronic
1167429977 19:49448579-49448601 AGGGGTCAGGGAAGGCTTCCTGG - Intronic
1167634498 19:50646650-50646672 ATGAGTCAGAGAGGGCTTCCTGG + Intronic
1167798897 19:51727642-51727664 AAGAGTCAGGGAGGGCTTCCTGG + Intergenic
1168348282 19:55661292-55661314 AGGGGGCCGGGGGGTCTTGCAGG - Intronic
926159666 2:10478599-10478621 TGGAGACAGGGAGGGCTTCCAGG - Intergenic
927180792 2:20445603-20445625 GGGAGTCGGGGAGGGCTCCCGGG - Intergenic
927446249 2:23164362-23164384 AGCAGTCAGGGAAGACTTCCTGG - Intergenic
927487721 2:23500231-23500253 GGGAGTCCAGGAGGGCTTCATGG + Intronic
928387671 2:30884012-30884034 AGGAGTCAGGGAGGTATGCAGGG + Intergenic
929253180 2:39780940-39780962 AGGAGGCAGGGAGGGCTTCCTGG + Intergenic
930800408 2:55437878-55437900 AGGGGGAAGGGAGGTCTTCCTGG - Intergenic
932220522 2:69995636-69995658 AGGAGTCTGGGAAGCCTTCTTGG + Intergenic
932334525 2:70922536-70922558 AGGGGACCAGGAGGACTTCCAGG - Intronic
932429720 2:71667042-71667064 AGCAGTCAGGGAGAGCTTCCTGG + Intronic
932743185 2:74307730-74307752 AGGAGGCCAGGAGGTCGTTCAGG + Intronic
932780553 2:74556086-74556108 GGCTGTCCGGGAGGGCTTCCTGG + Intronic
933773804 2:85759782-85759804 AGGAGTCTTGGTGGGCTTCCAGG + Intronic
935202805 2:100872816-100872838 AGGGATCAGGGAGGACTTCCTGG - Intronic
935700747 2:105809796-105809818 AGCCATCCAGGAGGTCTTCCTGG + Intronic
935868445 2:107417896-107417918 AGATGTCCAGGAGGCCTTCCAGG + Intergenic
936979365 2:118249942-118249964 AGCAGTCTGGGAAGGCTTCCTGG + Intergenic
937087142 2:119178982-119179004 AGGAGTCTGAGTGATCTTCCCGG - Intergenic
937332613 2:121041729-121041751 GGGAGTCAAGGAGGGCTTCCTGG - Intergenic
938099374 2:128487856-128487878 AGTAATCAGGGAAGTCTTCCTGG - Intergenic
939119173 2:138095572-138095594 AGTAGTCAGGGAAGACTTCCAGG - Intergenic
940017692 2:149123988-149124010 AGGAGCCCGGGGGGCCTTCCTGG - Intronic
941890086 2:170571331-170571353 AGAAGTCAGGGAAGGCTTCCAGG + Intronic
946486159 2:220102848-220102870 AGTATTCCTGGAGGGCTTCCTGG - Intergenic
946948635 2:224848688-224848710 AGGAGTCTTGGAAGTCTGCCAGG + Intronic
947691901 2:232146030-232146052 AGGAGACAGGGATGGCTTCCTGG + Intronic
947759547 2:232593713-232593735 ATGGGTCCGGGATGTCTCCCAGG + Intergenic
947872026 2:233444587-233444609 AGGACTCCGCGAGGGCTTCCTGG - Intronic
947997895 2:234544228-234544250 AGGAGTCAGGGAGGTGTGTCTGG + Intergenic
948398975 2:237668638-237668660 GGAAGTCAGGGAGGGCTTCCTGG - Intronic
948768844 2:240236999-240237021 AGGTGTCCATGAGGGCTTCCAGG - Intergenic
948769975 2:240246738-240246760 AGGAACCCGGGAGGGCTGCCTGG + Intergenic
948940827 2:241195517-241195539 AGGACTCCAGGAGCACTTCCAGG - Intronic
1169131540 20:3168432-3168454 AGTAATCCGGGAAGTCTTCCTGG - Intronic
1169723070 20:8700215-8700237 GGGAGTGGGGCAGGTCTTCCTGG - Intronic
1170047193 20:12097961-12097983 AGGAGTCCTGGAGATCTTTGGGG + Intergenic
1170666912 20:18394482-18394504 AGGAGTCAGGAAGGACATCCAGG - Intronic
1171180316 20:23086470-23086492 AGGAGTCAGGCAGCTCTGCCGGG + Intergenic
1171986145 20:31662498-31662520 AGGAGTCAGGGAGGGCTCCCTGG - Intergenic
1172148884 20:32776851-32776873 GGGAGTTGGGGAGGGCTTCCAGG + Intronic
1172167794 20:32909494-32909516 GGGAGGCAGGGAGGGCTTCCCGG + Intronic
1172762153 20:37330494-37330516 AGGAGGCTGGGATGTCCTCCAGG - Intergenic
1172903243 20:38350052-38350074 GGGAGTCAGGGAAGGCTTCCAGG + Intronic
1173418153 20:42876902-42876924 GGGAGTCAGGGAGGGCCTCCTGG + Intronic
1174050775 20:47765919-47765941 AGCAGTCAGGGAGGGCTTCCTGG + Intronic
1174288514 20:49489842-49489864 AGTAGTCAGGGAAGGCTTCCTGG + Intergenic
1174453558 20:50634397-50634419 AGGTGTCCAGGAAGGCTTCCTGG - Intronic
1174563141 20:51445402-51445424 AGGAGTCAGGGAGCTCTTGCTGG - Intronic
1175392964 20:58638667-58638689 ACTAGTCCAGGAAGTCTTCCTGG + Intergenic
1175552326 20:59825658-59825680 AGGAGTCGGGGTGGGCTTTCTGG + Intronic
1175699180 20:61124830-61124852 GGGAGTCCCAGAGGTCTGCCAGG + Intergenic
1175781601 20:61685738-61685760 TGGAGTCCAGGAGCTCTCCCAGG - Intronic
1176144709 20:63560382-63560404 GTGAGTCAGGGAGGGCTTCCTGG - Intronic
1178040856 21:28639559-28639581 AAGAGTCAGGGAAGTCTTCATGG + Intergenic
1178977390 21:37231650-37231672 TGGAGTCCTGTAGTTCTTCCTGG - Intronic
1179422894 21:41250185-41250207 AGAAGCCAGGGAGGGCTTCCTGG + Intronic
1180159797 21:45993935-45993957 AGGAGGCCGGCAGCTCCTCCTGG - Intronic
1180749066 22:18111702-18111724 AGGGGTCCAGGAGGGATTCCTGG - Intronic
1181343079 22:22198412-22198434 AGGGGTCCTGGAGGTGATCCGGG + Intergenic
1182051509 22:27316031-27316053 AGGAGTCCAGGATGACTGCCAGG - Intergenic
1182287267 22:29255753-29255775 GGGGGTCAGGGAGGTCTTCCTGG + Intronic
1182308929 22:29390928-29390950 AGTAGTCAGGGAGGCCATCCTGG + Intronic
1183505905 22:38208748-38208770 AGGGATCAGGGAGGGCTTCCTGG + Intronic
1183631700 22:39037077-39037099 AGGAGTGCTGGGGGGCTTCCAGG + Intergenic
1183744396 22:39684795-39684817 AGGAGTACTGGAGGTTTTGCAGG + Intronic
1183857334 22:40644034-40644056 AGGAATATGGGAGGGCTTCCTGG - Intergenic
1183953043 22:41362810-41362832 AGCAGCCAGGGAGGACTTCCTGG + Intergenic
1184059974 22:42075458-42075480 AGGGGTCAGGGAAGGCTTCCCGG + Intronic
1184410923 22:44325928-44325950 AGGGGTCAGGGAGGGCTTCCTGG - Intergenic
1184644089 22:45886671-45886693 TGCAGTCAGGGAGGGCTTCCTGG - Intergenic
1184673080 22:46025864-46025886 AGGAGTCCAGGAAGCCTTCCTGG - Intergenic
949430782 3:3973239-3973261 AGGAGTCTTGGTGCTCTTCCTGG + Intronic
949495711 3:4629796-4629818 AGTGGTCAGGGAGGGCTTCCTGG + Intronic
949891359 3:8735855-8735877 AGGAGTCAGGGAAGGCTTTCTGG - Intronic
950599394 3:14018571-14018593 AGGATTCAGGGAGGTAATCCAGG + Intronic
950638583 3:14333352-14333374 AGGAGACCAGGAGGGCTTCCTGG - Intergenic
950686213 3:14620330-14620352 AGGAGTCAAGGAGGACTCCCAGG + Intergenic
951320073 3:21233836-21233858 AGGAGTCAAGGATGTCTTCTTGG - Intergenic
952324332 3:32307401-32307423 AGGAGTCTAGGATGACTTCCTGG + Intronic
954456012 3:50600263-50600285 TGCAGTCAGGGAGGGCTTCCTGG + Intergenic
955068168 3:55550223-55550245 AGGCTTCAGGGAGGGCTTCCTGG - Intronic
956252479 3:67249295-67249317 TGGAGTCAGGGGGGTCTTCAAGG + Intergenic
957234634 3:77570310-77570332 AGCAGACTGGGAGTTCTTCCAGG + Intronic
957866847 3:86036563-86036585 TGGAGTCCTGGAGGTCCTTCAGG - Intronic
961446050 3:126982370-126982392 AGGCATCCGGGAGGGCCTCCCGG - Intergenic
961514503 3:127424316-127424338 AGCATTCAGGGAGGGCTTCCTGG + Intergenic
961825764 3:129598270-129598292 AGGAGTGCGGGAGGGCTTCCTGG - Intronic
962258177 3:133886244-133886266 AGGAGTCAGGGAAGGCTTTCTGG - Intronic
962277873 3:134029679-134029701 CGGAGTCCGCGGGGTCTTCCGGG - Intronic
962626312 3:137229112-137229134 AGGGGTCAGGGAGGGCTTCCTGG + Intergenic
962754281 3:138456381-138456403 GGGAGTCAGGGAAGACTTCCAGG + Intronic
962902266 3:139771822-139771844 AGAAGTCCAGGAAGGCTTCCTGG + Intergenic
964074458 3:152676326-152676348 AGGAGTCTGAGGGGTCCTCCAGG - Intergenic
965624305 3:170671870-170671892 AGGAGTCCAGGAAATCTTCCAGG - Intronic
967319062 3:188177832-188177854 AGGACTCTGGGAGGTCATCCTGG + Intronic
967894843 3:194387467-194387489 AGGGGTGCAGGAGGCCTTCCAGG - Intergenic
968061518 3:195729691-195729713 TGGGGTCAGTGAGGTCTTCCGGG - Exonic
968962686 4:3753349-3753371 AGGGGTGCAGGAGGGCTTCCTGG + Intergenic
969176495 4:5402849-5402871 AGTAGTGCAGGAGGGCTTCCTGG + Intronic
969249256 4:5956334-5956356 AGCAGTCAGGGAGGGCTTCCTGG - Intronic
969251474 4:5971181-5971203 AGGAGCCCAGGAGGACTGCCAGG - Intronic
969299181 4:6287437-6287459 AGGAAGCCAGGAGGTCATCCTGG - Intronic
969388419 4:6872481-6872503 AGCAGTCTGTGAGGCCTTCCAGG + Intronic
969492358 4:7506761-7506783 TGTAGTCAGGGAGGGCTTCCTGG + Intronic
969519108 4:7665533-7665555 AGAAGTCAGGGAAGACTTCCTGG - Intronic
969521107 4:7678195-7678217 AGGAGTCAGGGAGTGCTTCCTGG + Intronic
969521181 4:7678560-7678582 AGGAGTCAGGGAGTGTTTCCTGG + Intronic
969585219 4:8087616-8087638 AGGAGACCTGGAAGGCTTCCTGG + Intronic
969838238 4:9860788-9860810 AGGCTTCAGGGAGGACTTCCCGG - Intronic
970475087 4:16414023-16414045 TTGAGTCCCTGAGGTCTTCCAGG - Intergenic
975445223 4:74456186-74456208 ATGAGTCAGGGAGGGCTTCCTGG + Intergenic
983327331 4:166273955-166273977 AGGAGTCAGGGAAGACTCCCAGG + Intergenic
985603334 5:846105-846127 AGGAGGCCGGTGGGTCTCCCCGG + Intronic
985756361 5:1720986-1721008 GGGAGGCGGGGAGGTCTTCAGGG + Intergenic
986668437 5:10123416-10123438 ATCAGTCCAGGAGGGCTTCCTGG - Intergenic
986707440 5:10463544-10463566 TGGGGTCCCTGAGGTCTTCCCGG + Intronic
988609646 5:32712430-32712452 GGGGGTCCACGAGGTCTTCCAGG + Exonic
989564319 5:42886337-42886359 AGCAGTCAGGGAGGTCTCTCTGG - Intronic
990266641 5:54084080-54084102 AGGAAACCAGGAAGTCTTCCAGG + Intronic
991198342 5:63961167-63961189 CGGGGTCCGAGCGGTCTTCCGGG + Exonic
995055701 5:107756635-107756657 AGGAGTCCAGGATGGCTTCCAGG + Intergenic
995800576 5:115989442-115989464 AGAAGTCAGGGAAGGCTTCCTGG - Intronic
996081996 5:119267540-119267562 GGGCGTCAGGGAGATCTTCCTGG - Intergenic
996810122 5:127507056-127507078 AGGAGTCAAGGAGGTCTCCAAGG + Intergenic
997234987 5:132267554-132267576 AGGAGTCAAGGAGTGCTTCCTGG + Intronic
998370488 5:141657732-141657754 AGGAGTCCCAGAGGACTCCCAGG + Intronic
998528995 5:142868177-142868199 AGAAGTCAGGGAAGGCTTCCTGG + Intronic
998878648 5:146625622-146625644 GGGGGTCCAGGAAGTCTTCCTGG + Intronic
999247712 5:150164007-150164029 AGGAGTCAGGGAAGACTTGCAGG - Intergenic
999324971 5:150638212-150638234 AGCAATCCAGGAAGTCTTCCTGG - Intronic
1001545544 5:172568579-172568601 AGCAGTCAGGGAAGCCTTCCTGG + Intergenic
1001647718 5:173294770-173294792 AGGGGGCCAGGAGGGCTTCCTGG + Intergenic
1002176746 5:177404977-177404999 AGGAGGCCGGGTGGTGTGCCAGG - Intronic
1003065541 6:2901686-2901708 AGGAGTCAGGGAGGTCTCCCAGG - Intronic
1003086644 6:3065559-3065581 AGGAGTCAGGGAGGTCTCCCAGG + Intronic
1004887677 6:20067336-20067358 GGGCGTCAGGGAGATCTTCCTGG - Intergenic
1006512331 6:34528456-34528478 AGCAGTCAGGGAAGGCTTCCTGG + Intronic
1006683768 6:35815371-35815393 AGCAATCAGGGAGGGCTTCCTGG - Intronic
1006865578 6:37206767-37206789 GAGAGTCAGGGAAGTCTTCCTGG - Intergenic
1011242560 6:85287977-85287999 AGGAGGCCAGGAGGTCGTTCAGG - Intergenic
1012003132 6:93679755-93679777 AAAAGTCAGGTAGGTCTTCCTGG + Intergenic
1013434990 6:110094816-110094838 AGGAGTCAAGGATGACTTCCAGG - Intergenic
1017042254 6:150317070-150317092 TGGAGTCAGGGAGATCTTCTGGG - Intergenic
1017422228 6:154284428-154284450 ATGGGTCTGGGAGGTCTTCCTGG - Intronic
1017454860 6:154592375-154592397 GGGAGTTTGGGAGGGCTTCCTGG + Intergenic
1018223592 6:161606367-161606389 AGGAGTCTGGGATGACTTCAGGG + Intronic
1019732777 7:2636971-2636993 AGAAGTCCCCGAGGTCTTCACGG + Intronic
1019777247 7:2919182-2919204 AGGAGGCAGGAAGGGCTTCCTGG + Intronic
1020078677 7:5275056-5275078 AGCAGTCAGGGAAGGCTTCCTGG + Intronic
1020136753 7:5592188-5592210 AGGGGTCCTGGTGGTCTTCAGGG + Intergenic
1020141705 7:5615349-5615371 AGGAGGCTGGGAAGGCTTCCAGG - Intergenic
1021378030 7:19932746-19932768 GGGAGTCCTTGAGGACTTCCTGG + Intergenic
1021942036 7:25687538-25687560 AAGAATCAGGAAGGTCTTCCTGG - Intergenic
1022517365 7:30984434-30984456 AGCAGTCAGGGAAGGCTTCCTGG + Intronic
1023210863 7:37803818-37803840 AGGAGTCCAGTCTGTCTTCCTGG + Intronic
1024920877 7:54553606-54553628 AGGAGTCAGGGAGGGCAACCTGG + Intronic
1025200215 7:56957128-56957150 AGCAGTCAGGGAAGGCTTCCTGG - Intergenic
1025671730 7:63619804-63619826 AGCAGTCAGGGAAGGCTTCCTGG + Intergenic
1027245695 7:76365821-76365843 AAGAGTCTAGGAGGTCTGCCCGG - Intergenic
1029705909 7:102275483-102275505 TGCAGTCAGGGAGGGCTTCCTGG + Intronic
1029813817 7:103074618-103074640 AGGAGTCAGGAAAGACTTCCCGG - Intronic
1032398919 7:131610276-131610298 AGCAGTCCTGGAGGTCTTGCAGG + Intergenic
1032464652 7:132136400-132136422 AGGGGTCCTGAAGGACTTCCTGG - Intronic
1032800446 7:135313387-135313409 TGGAGTCAGGGAGGGCTTCCTGG - Intergenic
1034052455 7:147997681-147997703 AGGAGTCAGGGTGGGCTGCCGGG + Intronic
1034210139 7:149356182-149356204 AGAATTCAGGGAGGTCGTCCTGG - Intergenic
1034497730 7:151432318-151432340 CGGAGTCCCGGGGGACTTCCTGG - Intronic
1035085730 7:156255881-156255903 AGGTGTCCGGGAGTTCTCCATGG + Intergenic
1035269587 7:157711598-157711620 AGGAGAGCAGGAGGTCTGCCGGG - Intronic
1035487316 7:159236200-159236222 AGGAGTCAGGGAAGACTTCTTGG + Intergenic
1037359464 8:18057996-18058018 AGGACACCGGCAGGTCTCCCAGG - Intronic
1037833219 8:22201206-22201228 AGGGGTCCGGGAGGCCTGGCAGG - Intronic
1042068976 8:64909761-64909783 AAGAGTCAGGGATGTCTTACTGG - Intergenic
1043539352 8:81242182-81242204 AGGGGTCAGGGAGGGCTCCCTGG + Intergenic
1044772225 8:95648358-95648380 AGGATTTCAGGAGTTCTTCCAGG - Intergenic
1044802809 8:95974677-95974699 AAAAGTCAGAGAGGTCTTCCTGG - Intergenic
1045292738 8:100847746-100847768 AGGAGTCCGGGGAGAATTCCTGG - Intergenic
1045363451 8:101453983-101454005 AGGAGGCCCACAGGTCTTCCAGG - Intergenic
1048326404 8:133442588-133442610 AGAAGTCATGGAGGACTTCCAGG - Intergenic
1049245360 8:141559562-141559584 ACCAGTCAGGGAGGGCTTCCTGG + Intergenic
1049247275 8:141569572-141569594 AGGAGTGGGGGAGGGCTTCAGGG + Intergenic
1049339246 8:142103130-142103152 TGGAGTCAAGGAGGGCTTCCTGG + Intergenic
1049382493 8:142324438-142324460 AGGAGTCTGCGAGGCCTGCCTGG + Intronic
1049386629 8:142346014-142346036 AGCAGGCAGGGAGGGCTTCCTGG - Intronic
1049757523 8:144317340-144317362 TGGAGACCGGGAGTTCTACCGGG - Exonic
1051630028 9:19132367-19132389 AGGTAGTCGGGAGGTCTTCCTGG - Intronic
1052181401 9:25533346-25533368 AGGAGGCCAGGTGGGCTTCCAGG - Intergenic
1055073819 9:72193935-72193957 AGTAGTCTGGCAGGACTTCCAGG - Intronic
1059401862 9:114075776-114075798 GGGTGTCTGGGAGGGCTTCCTGG + Intronic
1059447838 9:114349923-114349945 AGGCTTCAGGGAGGGCTTCCTGG - Intronic
1060034367 9:120242420-120242442 AGAAGTCCTGGAGCTCTTCCCGG + Intergenic
1060238477 9:121883462-121883484 AGGAGGCCGCGAAATCTTCCTGG - Intronic
1061400630 9:130366257-130366279 GGCAGTCAGGGAGGGCTTCCTGG - Intronic
1061579255 9:131526878-131526900 AGGAGTCCGGGAGAGCTGACAGG + Intronic
1061777252 9:132973602-132973624 GGGCGTCTGGGAGGGCTTCCTGG + Intronic
1061903831 9:133686423-133686445 GGGAGTCAGGGAGGGCTTCCTGG - Intronic
1062142891 9:134969575-134969597 AGGACTCCGGGCAGGCTTCCTGG - Intergenic
1062174216 9:135151968-135151990 AGGAGTCAAGGAAGGCTTCCTGG - Intergenic
1062401647 9:136375397-136375419 CGGGGTACGGGAGGCCTTCCAGG + Intergenic
1062592569 9:137280837-137280859 AGGCGTCCAGGAGGGCTTCCGGG - Exonic
1189281888 X:39824867-39824889 GGGTGTCCGGTAGGGCTTCCTGG - Intergenic
1190373777 X:49768163-49768185 AGGAGTCAGAGAGGTCTTCTTGG + Intergenic
1193238847 X:79142530-79142552 AGAAGTCAGGCAAGTCTTCCAGG - Intergenic
1197206873 X:123798365-123798387 AGTAGTGGGGGAGGTCTTCAAGG - Intergenic
1197209266 X:123815846-123815868 AGTAGTGGGGGAGGTCTTCAAGG + Intergenic