ID: 1103996363

View in Genome Browser
Species Human (GRCh38)
Location 12:124832974-124832996
Sequence GCTTCCTTCTGGAGCTCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 270}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103996353_1103996363 14 Left 1103996353 12:124832937-124832959 CCCTGAGATGGGATGAAAGTCAC 0: 1
1: 1
2: 0
3: 19
4: 157
Right 1103996363 12:124832974-124832996 GCTTCCTTCTGGAGCTCAGGGGG 0: 1
1: 0
2: 3
3: 36
4: 270
1103996349_1103996363 29 Left 1103996349 12:124832922-124832944 CCAAACTGGGACTGCCCCTGAGA 0: 1
1: 0
2: 1
3: 9
4: 144
Right 1103996363 12:124832974-124832996 GCTTCCTTCTGGAGCTCAGGGGG 0: 1
1: 0
2: 3
3: 36
4: 270
1103996352_1103996363 15 Left 1103996352 12:124832936-124832958 CCCCTGAGATGGGATGAAAGTCA 0: 1
1: 0
2: 1
3: 22
4: 191
Right 1103996363 12:124832974-124832996 GCTTCCTTCTGGAGCTCAGGGGG 0: 1
1: 0
2: 3
3: 36
4: 270
1103996354_1103996363 13 Left 1103996354 12:124832938-124832960 CCTGAGATGGGATGAAAGTCACG 0: 1
1: 0
2: 1
3: 10
4: 110
Right 1103996363 12:124832974-124832996 GCTTCCTTCTGGAGCTCAGGGGG 0: 1
1: 0
2: 3
3: 36
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103996363 Original CRISPR GCTTCCTTCTGGAGCTCAGG GGG Intronic
900252375 1:1677885-1677907 GATTCCCACTGGACCTCAGGAGG - Intronic
900499301 1:2992585-2992607 GCTTGCTTCTGCAACACAGGCGG - Intergenic
900512353 1:3066699-3066721 GCCTCCTCCTCCAGCTCAGGAGG - Intergenic
900629126 1:3624628-3624650 TCGGCCTTCTGGAGCGCAGGTGG - Intergenic
901019320 1:6247984-6248006 AGTTCCTTCTGGCCCTCAGGTGG - Exonic
901501891 1:9657593-9657615 GAAAACTTCTGGAGCTCAGGAGG + Intronic
901528006 1:9836130-9836152 GCTTCAGCCTGCAGCTCAGGTGG - Intergenic
901959885 1:12817780-12817802 ACTTCCTTCAGGAGCTCTTGTGG + Intergenic
902129763 1:14249612-14249634 CCTTTCTTCTGGGGCTCAGTGGG - Intergenic
902189713 1:14753818-14753840 GTTTCCTTCTGCAGCTCTGGAGG + Intronic
902207465 1:14879691-14879713 CCTTCATTCTGGAGCCCAGTTGG - Intronic
902323784 1:15684926-15684948 GGTTCCTTCAGGAGCTCCCGGGG - Intronic
902923214 1:19679476-19679498 GCACCCCTCTGGAGCTCAGAGGG - Exonic
905959421 1:42031334-42031356 TCTTCCTTCTGGATGTCAGATGG + Intronic
906708197 1:47910082-47910104 GCTGACTGCTTGAGCTCAGGAGG - Intronic
907191033 1:52649156-52649178 GCTTCCTTCTGCATCTGAGATGG + Intronic
907980608 1:59477049-59477071 ACTTGCTTCTGGATCTCAGTTGG + Intronic
911394189 1:97286083-97286105 GCTTCCTTCAGGAGCTCTTTAGG + Intronic
912361937 1:109102363-109102385 GCTTCTTTCAGGCACTCAGGTGG - Intergenic
912567271 1:110597087-110597109 GCTTCCTTCTGCAGCTCTCACGG + Intronic
912806445 1:112760320-112760342 GCTTAATTCTGTAACTCAGGGGG + Intergenic
913389381 1:118293465-118293487 GCTTTCTTCTGGAACTCACTGGG + Intergenic
915132685 1:153706696-153706718 GTTTCCTTCTGTCACTCAGGTGG + Intergenic
915596009 1:156896847-156896869 AATTCCTGCTGGAGGTCAGGAGG + Intronic
916556831 1:165900617-165900639 CCTTCCTTCTGTAGATCTGGTGG - Intronic
918042982 1:180924391-180924413 GCCTCCTTCTGGGGCTCAGCAGG + Intronic
918783718 1:188735722-188735744 GGTTCCTTCTGGAGCACTAGAGG + Intergenic
919048589 1:192484268-192484290 GCTTCCTTCAGGAGCTCTTTTGG - Intergenic
920839782 1:209544901-209544923 GGATCCCTCTGGAGTTCAGGAGG + Intergenic
920913688 1:210240735-210240757 GCTTCCTTGTGGAGCTGAGTGGG - Intronic
920964790 1:210692800-210692822 GGTTCCTTCTGGAGGTTTGGAGG - Intronic
921257972 1:213359720-213359742 GCTTCCTTCAGGAGCTCTTTAGG + Intergenic
923522423 1:234745865-234745887 GCTTCGTCCTGGAGCTCCAGCGG + Intergenic
923523711 1:234756558-234756580 GCTTCTTTCTGGGGTTCAGATGG + Intergenic
924138017 1:240991399-240991421 GCCCTCTACTGGAGCTCAGGAGG + Intronic
1063342634 10:5282512-5282534 GCTTTGGTCTGGAGCTCAGGGGG - Intergenic
1068256412 10:54517039-54517061 GCTTCCTTCAGGAGCTCTTTTGG - Intronic
1072383207 10:94897075-94897097 GCTTCCTTCAGGAGCTCTTTTGG + Intergenic
1074346277 10:112689401-112689423 TCTGCATTCTGGAGGTCAGGAGG + Intronic
1074443632 10:113500092-113500114 AGTTCCTTCTGGAACTCATGTGG - Intergenic
1075823593 10:125334715-125334737 GCCTGCTACTGGAGCTCTGGAGG + Intergenic
1075903820 10:126063911-126063933 GCTTCATTTTGGAGCTTTGGTGG + Intronic
1076735244 10:132456045-132456067 GGGTCCTTATGGAGCACAGGTGG + Intergenic
1077309081 11:1880588-1880610 GCTTCCTCCTTGGGCCCAGGAGG + Intronic
1077611018 11:3643005-3643027 GCTGCCTGCTGGGGCTGAGGTGG + Intergenic
1079587856 11:22148530-22148552 GCCTCCTTCAGGAGCTCTGGTGG + Intergenic
1081788503 11:45766098-45766120 GGTTCCTTCTGGAGCTTCTGGGG - Intergenic
1082708999 11:56529794-56529816 GCTTCCTTGTAGATTTCAGGAGG - Intergenic
1082767288 11:57179997-57180019 GCTTCTTTCTGAAACTCAGCTGG - Intergenic
1084005744 11:66322712-66322734 GCTCCCTTCTGGAGGCCATGGGG + Intergenic
1084284413 11:68121856-68121878 GCCTCCTCCTGGGGCTCAGTGGG + Intergenic
1084913938 11:72413636-72413658 GCTTTCATCTGGATCACAGGGGG - Intronic
1086037314 11:82432234-82432256 GGTTGCTTCTGGAGCTCTGAAGG - Intergenic
1089373345 11:117977311-117977333 TCTTCCTTCTGCAGCCCAGATGG - Intergenic
1090874049 11:130773315-130773337 GCTTGCTTCTGAAGGCCAGGTGG - Intergenic
1090914873 11:131154521-131154543 GCTTCTATTTGGAGCTCAGCAGG + Intergenic
1090983204 11:131741766-131741788 GCTTCCTTCGATAGCTCAGCTGG + Intronic
1091615269 12:2046286-2046308 GGTTCCTTCTGGGGGTCAGCAGG + Intronic
1091798942 12:3312619-3312641 GCTTCCTTCGTGAGCTAGGGAGG + Intergenic
1092650355 12:10628157-10628179 GCTGCCTTCTGGAGCTTATTGGG + Intronic
1092786779 12:12033550-12033572 GCTTCCTTCTGGGGCTCTTGTGG + Intergenic
1093329840 12:17822596-17822618 GCTTCCTTCAGGAGCTCTTTAGG - Intergenic
1095491299 12:42736574-42736596 GCTTCCTTTTGGGGCAAAGGTGG + Intergenic
1096811350 12:54172538-54172560 CCTGGCTTCAGGAGCTCAGGTGG + Intronic
1096837106 12:54358011-54358033 GCTTCCTTCTCTGGCTCAGGAGG + Intergenic
1097829117 12:64205505-64205527 GCTTGCTGCTGTAGCTTAGGTGG - Intronic
1097877005 12:64652951-64652973 GCTTCCTTCTGAGGGTTAGGAGG + Intronic
1099644952 12:85341348-85341370 GCTTCCTTCTGTAGGTTAGAAGG + Intergenic
1099678050 12:85787377-85787399 GCTTCCTTCAGGAGCTCTTGTGG - Intergenic
1100697197 12:97107787-97107809 GCTTCCTTCAGGAGGTCTGTGGG + Intergenic
1101552786 12:105777908-105777930 GCTTCCTTCAGGAGCTCTTTAGG - Intergenic
1102015368 12:109644751-109644773 GCTGCCTCCTGGGGCTCAAGGGG - Intergenic
1102485468 12:113252410-113252432 GCTTCCTCCTTGTGCTCAGGAGG - Intronic
1102953540 12:117045555-117045577 GTTTGCCTCTGGAGCCCAGGGGG - Intronic
1102980012 12:117234006-117234028 GCTTCATCCAGGAGCACAGGTGG - Intronic
1103529692 12:121592347-121592369 TCATCGTTCTGGAGCCCAGGAGG - Intergenic
1103996363 12:124832974-124832996 GCTTCCTTCTGGAGCTCAGGGGG + Intronic
1105778070 13:23681027-23681049 ATTGCCTTCTGTAGCTCAGGAGG + Intergenic
1106306125 13:28511911-28511933 GCATCCTTCTCAAGCTCATGTGG - Intergenic
1108093669 13:46878282-46878304 GCTTGCATGTGGAGCTTAGGAGG + Intronic
1108247766 13:48534096-48534118 GCCTCCTTCTGAGGCTCAGTGGG - Intergenic
1109152404 13:58860689-58860711 GCTTACTCCTGGAGCTCAATGGG + Intergenic
1111953061 13:94725763-94725785 GCTTCATTTTGGAGGTGAGGGGG - Intergenic
1112041820 13:95554368-95554390 GCTTCCTTCTGTAGGACAGTTGG + Intronic
1112200114 13:97266498-97266520 CCCTCCTTCTGGAGATCAAGTGG + Intronic
1112612376 13:100968357-100968379 GCTTCCTTCAGGAGCTCTTGAGG + Intergenic
1113054952 13:106258002-106258024 GCTTGGTTCTAGAGCTCGGGCGG - Intergenic
1113414606 13:110118325-110118347 GCTTCCTGCTGGAGCTCGTAGGG + Intergenic
1113885210 13:113655259-113655281 GGTTCCTGCTGGAGCTGGGGTGG - Intronic
1114219396 14:20683269-20683291 GCTTCCTTCGATAGCTCAGCTGG + Intergenic
1114670485 14:24408340-24408362 GCTTCCTTCTGCTGCTGGGGAGG - Exonic
1114710274 14:24770418-24770440 GCTTCCTTCAGGAGCCCTGGTGG - Intergenic
1115569184 14:34651024-34651046 GCTTCCTTCTGAAGCTCTAGTGG + Intergenic
1115717505 14:36122594-36122616 GCTTCCTTCAGGACCTCTGTAGG + Intergenic
1117986035 14:61387038-61387060 GCTTCATTCTGTAGCTCAGTGGG + Intronic
1118066967 14:62203268-62203290 GCTTCCTTCAGGAGCTCTTTTGG + Intergenic
1118842557 14:69524120-69524142 ACTTCCTGATGGGGCTCAGGAGG - Intronic
1119940826 14:78639367-78639389 ACTCCTTTCTGGAGCTCAGCAGG + Intronic
1120901343 14:89578463-89578485 GTACCCATCTGGAGCTCAGGGGG - Intronic
1122488307 14:102096119-102096141 GCTGCCTTGGGGAACTCAGGTGG - Intronic
1123009415 14:105340560-105340582 GGGTTCTTCCGGAGCTCAGGTGG + Intronic
1123027351 14:105432954-105432976 GCTTTCGACTGAAGCTCAGGCGG - Intronic
1202849376 14_GL000225v1_random:7603-7625 GTTTGCTTCTGGAGCTCTGTGGG + Intergenic
1123998812 15:25737590-25737612 GCATCCTTCTGGAACTGGGGAGG + Intronic
1125520425 15:40345151-40345173 GTTCCCTTCTGGACCTCAGGGGG - Intergenic
1126459189 15:48897001-48897023 GATTTCTCCTGGGGCTCAGGGGG + Intronic
1127374345 15:58369302-58369324 TCTTCCTCCTGGTGCTCAGTTGG + Intronic
1128344972 15:66847899-66847921 GCTTCCCCCTCGAGCCCAGGTGG + Intergenic
1128749158 15:70136328-70136350 GGTTCCTTCTGAAGCTGAGAAGG - Intergenic
1130906371 15:88243352-88243374 GCTCCCTCCTGGATCTCAGGTGG + Intronic
1131555383 15:93394121-93394143 GCTTCCTTCAGGAGCTCTTTAGG + Intergenic
1131595543 15:93794193-93794215 GCTTCCTTCAGGAGCTCTTCAGG - Intergenic
1132216328 15:100064273-100064295 GGTTCCTTCTGCAGGTCACGAGG - Intronic
1133802064 16:9092159-9092181 GCCTCCTCCTGCAGCTCGGGGGG - Exonic
1133985598 16:10665783-10665805 GATTCCTCCTGGTGCTAAGGTGG + Intronic
1135894363 16:26385449-26385471 GCTTCCTTCAGGATGTCAGCAGG - Intergenic
1136029081 16:27489777-27489799 CCTTCCTGCTGCAGCTCTGGTGG + Intronic
1136278712 16:29194540-29194562 TCTTCCCTCTGGGGATCAGGTGG + Intergenic
1136337291 16:29618419-29618441 GCTTCCTTCTGAGGCTCTAGGGG - Intergenic
1136678671 16:31939517-31939539 GCTTCCTTCAGGAGCTCTTTTGG - Intergenic
1137601940 16:49762277-49762299 ACTTCCTTCTGGGGCGCTGGGGG - Intronic
1138357337 16:56393191-56393213 GCTTCCTTCAGGAGCTCTTAGGG - Intronic
1138475434 16:57268145-57268167 GCTTTCTTCTGGGGCTCTGAGGG - Intronic
1138531794 16:57638486-57638508 GCTTCCTTCTAGAGCTCCCGGGG - Intronic
1141840610 16:86571924-86571946 GTTGCCTTCTGGTCCTCAGGAGG + Intergenic
1142083104 16:88160621-88160643 TCTTCCCTCTGGGGATCAGGTGG + Intergenic
1144265304 17:13562763-13562785 GCTGGCTCCTGGAGCTCAGCTGG - Intronic
1145903874 17:28506040-28506062 TCTCCCTTCTGGAGTGCAGGCGG + Intronic
1148091181 17:45023282-45023304 GAGTCCTCCCGGAGCTCAGGGGG - Intergenic
1149434995 17:56626122-56626144 GCTTCAGTCTGGTGCCCAGGAGG - Intergenic
1150161374 17:62901020-62901042 GCTTCCTGCTGCACCTCAGACGG + Intergenic
1150321083 17:64215090-64215112 GCTTCTTTCTGGAGCTTAGCTGG + Intronic
1152352682 17:79792214-79792236 GCTTCACTCTTGAGCTGAGGCGG + Exonic
1154234097 18:12586820-12586842 TTTTCCTTCAGGGGCTCAGGAGG - Intronic
1154355958 18:13623405-13623427 GCTCCGTTCTGGAGCTGAGCTGG + Intronic
1155164427 18:23221050-23221072 GCTTCCTGAAGGTGCTCAGGGGG - Intronic
1155187653 18:23401595-23401617 GCTTCCTTCTGGTGCACAACAGG - Intronic
1155504149 18:26516473-26516495 GCTTCCTTCTGAAGATCCTGGGG + Intronic
1156293570 18:35770847-35770869 GGCTCCTTCTGGGGCTCAGTTGG - Intergenic
1157775031 18:50387303-50387325 GCTTCCTTCGATAGCTCAGCTGG - Intronic
1158101229 18:53832538-53832560 GCTTCCTTCAGGAGCTCTTGTGG + Intergenic
1158783675 18:60682918-60682940 GCTTCTTTCAGGGGCTGAGGTGG - Intergenic
1158811971 18:61048053-61048075 GCTTCCTTCTTGAAGTCAGCCGG + Intergenic
1160363666 18:78306391-78306413 GCTTCCTTCCGGTGCCCTGGGGG + Intergenic
1160536004 18:79592582-79592604 ACATCCTTCTGGAGCTCACCTGG + Intergenic
1160550225 18:79690142-79690164 CCTTCCTTCTACAGATCAGGAGG - Intronic
1161294973 19:3514923-3514945 TCTTCATTCTGGGGCCCAGGGGG + Intronic
1161741457 19:6023323-6023345 GCGGCCTTCTGCAGGTCAGGCGG - Intronic
1161912521 19:7205182-7205204 GCTTGTATCTGGAGCTCAGATGG - Intronic
1162201697 19:9025161-9025183 GGTTCCTTCTGGGGCTGTGGAGG - Intergenic
1162474305 19:10890878-10890900 GATTGCTTCTTGAGCACAGGAGG + Intronic
1162790110 19:13058303-13058325 GCTTCCATCTGGACCTCGGTAGG + Intronic
1164464003 19:28472164-28472186 GCTGGCTGCTGGACCTCAGGAGG + Intergenic
1164570224 19:29368961-29368983 GCTGCCTTCTGGGGCTCTGATGG - Intergenic
1166269902 19:41707510-41707532 CCTCCCTTCTGAAGCTCTGGGGG - Intronic
1166311052 19:41962838-41962860 GCTTCCTTGGGGATCCCAGGAGG - Intergenic
1166679875 19:44759590-44759612 GCTGCCTCCTGGAGCTGGGGAGG - Exonic
1166738236 19:45098611-45098633 GCTGCCTTCCAAAGCTCAGGTGG - Intronic
1168296414 19:55379160-55379182 GCTTCCTTCTAGCACCCAGGTGG - Intergenic
925238162 2:2297277-2297299 GCTTCCTACTTGAGCTGAGCAGG - Intronic
925359643 2:3268354-3268376 GCTGCCCTCTGGAGTGCAGGTGG - Intronic
926417424 2:12663580-12663602 GCTTCTCTCTGCAGCTCAGGGGG + Intergenic
929541265 2:42824244-42824266 GTTTCCTGCAGGAGCTGAGGGGG + Intergenic
931040083 2:58287598-58287620 GCTTCTCTCTGGGGCTCAGTAGG + Intergenic
932376044 2:71236883-71236905 TATTCCTTCTGGAGCTCTAGGGG + Intergenic
933029560 2:77311326-77311348 TTTTTCTTCTGGGGCTCAGGAGG + Intronic
935929757 2:108111770-108111792 GCTTCCTTCAGGAGCACACAGGG + Intergenic
936528689 2:113259864-113259886 CCTTCCTTCTGCAGCCCAGAGGG - Intronic
940279936 2:151978642-151978664 GCTTGCTTGTGGAGCACAGTTGG - Intronic
940797117 2:158091669-158091691 GCTCACTTCTGGGGCTCAGCTGG + Intronic
942744293 2:179213959-179213981 GCTTCCTTCAGGAGCTCTTTTGG - Intronic
946432344 2:219632407-219632429 GTAGCCTTCTGGAGCTCAGGAGG + Exonic
947946011 2:234102850-234102872 GTTTCCTCCTGGAGCTCTGGTGG + Intergenic
948446550 2:238038042-238038064 GCTACAGTCTTGAGCTCAGGAGG + Intronic
948537831 2:238659168-238659190 CCTTCCTTCTCGCCCTCAGGAGG + Intergenic
948606756 2:239140827-239140849 GCGTCCTCCTGGAGCCCACGAGG + Intronic
948692046 2:239712226-239712248 CCTTCCTTCTGGAACTTAGTGGG - Intergenic
948807828 2:240460559-240460581 GCTTCCTCCTGGCTCTTAGGGGG + Intronic
1170439772 20:16367279-16367301 GCTTCCTGAAGGTGCTCAGGTGG + Exonic
1172221266 20:33276652-33276674 GGTGCTTTCTGAAGCTCAGGAGG - Intronic
1172595591 20:36149041-36149063 GCTCCCTTCTGCACCTCAGATGG - Intronic
1173924279 20:46769147-46769169 GCTTTCCTCTAGAGCTCTGGGGG + Intergenic
1174118251 20:48242719-48242741 GCTTGCTGATGGATCTCAGGTGG - Intergenic
1175082171 20:56429741-56429763 GCTTCCATCTGGGGGTAAGGAGG - Intronic
1176058631 20:63161957-63161979 GCTTCCTCCAGGAGCTCTGTTGG - Intergenic
1179385148 21:40934353-40934375 GGTTCCTTCTGGAGCTCTGGGGG - Intergenic
1179647325 21:42783961-42783983 GCCGCCTTATGCAGCTCAGGCGG - Intergenic
1179786732 21:43734536-43734558 CCTGCCTCCTGGAGCTGAGGAGG + Intronic
1180108665 21:45637396-45637418 GCTCTCTCCTGGAGCTCAGCAGG - Intergenic
1181512486 22:23395097-23395119 GCTGCCTTCTGGAGGGCAGGTGG - Intergenic
1182310009 22:29397813-29397835 GCTTCCATCTGGGGCTGAGCTGG + Intronic
1182320348 22:29474949-29474971 GCTTCCTTCTGGTGCCTTGGTGG - Intergenic
1182912137 22:33993619-33993641 GCTTTCTTCTGGGACTCAGTGGG - Intergenic
1183218847 22:36498798-36498820 GGTTCCTCCTGGAACCCAGGAGG - Intronic
1184672700 22:46023695-46023717 GCTGCCAGCTGGAGCCCAGGCGG + Intergenic
1185082554 22:48718017-48718039 GCTGCCTTCACGAGCCCAGGTGG + Intronic
1185372538 22:50467686-50467708 GTTTCCTGCTGGGGGTCAGGGGG + Exonic
950194356 3:10998743-10998765 GCTTCCCTCTGGGGTGCAGGGGG + Intronic
952694798 3:36251939-36251961 GCTTCCTTCAGGAACTCTTGCGG - Intergenic
953130800 3:40135862-40135884 GCTTCCTTCAGGAGCTCTTTTGG - Intronic
953219641 3:40958033-40958055 GCTTCCTTCAGGAGCTCTTTCGG + Intergenic
954890724 3:53925911-53925933 GCTTCCTTCAGGAGCTCTTTTGG + Intergenic
956374025 3:68594928-68594950 CCTTCCTTCTGGAGTTCTAGGGG + Intergenic
957483065 3:80823431-80823453 GCTACCTTTTGAAACTCAGGTGG - Intergenic
957668439 3:83268109-83268131 CCTTCCTTCTGGAACTGAGTTGG + Intergenic
958102909 3:89036456-89036478 GCTTCCTTCAGTAGCTCTTGTGG - Intergenic
959180371 3:102971401-102971423 GCTTCCTTCAGGAGCTCTTTTGG - Intergenic
959515418 3:107261169-107261191 GCTTCTTGCTGGGGCTGAGGTGG + Intergenic
961753096 3:129108885-129108907 GCTTCATCCTGCAGCACAGGAGG - Intronic
962832897 3:139159766-139159788 GCTTCCCTCTGGATCACAGAGGG - Intronic
965907565 3:173727900-173727922 ACTTCCTTCTGCAACTCAGTGGG - Intronic
966305302 3:178526307-178526329 GCTTCCTTCAGGTGTTCAGGAGG - Intronic
967821879 3:193846188-193846210 GTTTCCTTCTAAAGCTGAGGTGG + Intergenic
969079638 4:4608370-4608392 GCTACCCACTGGAACTCAGGAGG + Intergenic
970383519 4:15532369-15532391 CCTGCCTTCTGGAGGTCATGAGG + Intronic
971058868 4:22944313-22944335 GGTTCCTTCTGGAGGTTCGGAGG + Intergenic
972127009 4:35780550-35780572 GCTTCCTTCTGGTCCACAGGGGG - Intergenic
975295768 4:72732342-72732364 GCTTCCTTCAGGAGCTCTTGTGG - Intergenic
975736703 4:77388345-77388367 GATTCCATCTGGAGCTCAGTAGG - Intronic
979562116 4:122111933-122111955 GCTTCCTTCAGGAGCTCTTGTGG - Intergenic
980640080 4:135565959-135565981 GCTTCCTCCAGGATCTGAGGGGG + Intergenic
982663223 4:158230019-158230041 CCTCCCTTCGGGAGCTCAGCAGG + Intronic
983869956 4:172813683-172813705 TCTGCCCTCTGGAGCTCTGGAGG - Exonic
983994460 4:174164543-174164565 GATTCCTTCTAGAGATCAGGAGG + Intergenic
985094041 4:186394386-186394408 GGTTCCTTCTGAGGCTCAGAGGG + Intergenic
988530420 5:32022590-32022612 GATTCCTTCTGGGGATCAGTAGG + Intronic
989662209 5:43812337-43812359 GCTTCCTTCAGGAGCTCTTGTGG + Intergenic
990393739 5:55355154-55355176 GCTTCCTTGTGGAGGACAGTGGG + Intronic
990572646 5:57094700-57094722 GCTTCCTTCAGGAGGTCTGTGGG - Intergenic
991949557 5:71934078-71934100 CCTTCCCTCTGGGGCTCAGCTGG - Intergenic
991990069 5:72328893-72328915 GTTTCCTTTTGGGGATCAGGGGG + Intronic
992571185 5:78059300-78059322 TGTTCCTTCTGGAGCTCTAGGGG - Intronic
995226371 5:109705749-109705771 CATTCCTTCTGGAGCTCCAGGGG + Intronic
995699527 5:114918825-114918847 GCTTCCTTCAGGAGCTCTTTTGG + Intergenic
1000587713 5:163120997-163121019 GCTTCCTTCAGGAGCTCTTTAGG + Intergenic
1004321041 6:14631696-14631718 CCTTCCCTCTGAAGCCCAGGGGG + Intergenic
1005376085 6:25184213-25184235 GCTTCCTTCAGGAGCTCTTCTGG + Intergenic
1005378487 6:25209207-25209229 GCTTCCTTCAGGAGCTCTTCTGG - Intergenic
1005972537 6:30772593-30772615 CCTGCCTTGTGGAGCTCAGAAGG - Intergenic
1006466160 6:34196164-34196186 GGACCCTCCTGGAGCTCAGGAGG - Intergenic
1006839221 6:37017705-37017727 GCTCCCTTCTGGGGCTGAAGGGG - Intronic
1008615510 6:53222010-53222032 GCTTCCTCCTTGTGTTCAGGTGG + Intergenic
1012594074 6:101020223-101020245 TCTTCATTCATGAGCTCAGGAGG - Intergenic
1014129754 6:117817280-117817302 GGTTCCTTCTGGAGCTTCTGGGG - Intergenic
1016688068 6:146903679-146903701 GCTTCCTTCTGGAGAGGAAGAGG - Intergenic
1018357027 6:163028493-163028515 GCTTGCTTCTGGATCTCAGGTGG + Intronic
1020116290 7:5478261-5478283 GCTTCCTTCTGCAGCAGAGGGGG - Intronic
1022477341 7:30720177-30720199 GCCTCCTTCTGGAGACCAGGTGG + Intronic
1022827536 7:34031115-34031137 CCTTCCTTCTAGACCTCAGATGG + Intronic
1023539707 7:41251960-41251982 GCTGCCTTATGGAGCTCAGCAGG + Intergenic
1024955145 7:54910580-54910602 GCCTCCTGGTGGAGTTCAGGAGG - Intergenic
1029595547 7:101535730-101535752 CCTTCCCTCTGGATCTCAGTCGG + Intronic
1030159247 7:106490755-106490777 GCTTCGTTCTGCAGCTCCTGGGG - Intergenic
1031421355 7:121555807-121555829 TCTACCTTCCTGAGCTCAGGGGG - Intergenic
1031920947 7:127600180-127600202 TCTTCCTTCTCCAGCACAGGGGG + Exonic
1032002459 7:128274311-128274333 GCGACCTTCAGGAGCTCAGAAGG + Intergenic
1032957758 7:136991620-136991642 GCTACCATCTGGAGGTGAGGAGG + Intronic
1033246085 7:139717357-139717379 GCTTTCTACTGAAACTCAGGAGG + Intronic
1034032625 7:147785097-147785119 GCTTCCATCTGGAGCTCAAGAGG + Intronic
1034079291 7:148261646-148261668 GCTGCCCTCTGGAGTGCAGGTGG + Intronic
1034126085 7:148672683-148672705 GATTGCTTCTTGAGCCCAGGAGG + Intergenic
1034222289 7:149455787-149455809 GGTCCCTTCTGGAGCACATGTGG + Exonic
1034532872 7:151707652-151707674 GACTCCTTCTGGAGATGAGGTGG - Intronic
1034722708 7:153309388-153309410 GCTTCCTTCTGGGTCCCAGTTGG - Intergenic
1036242170 8:7090582-7090604 GCTGCCATCAGGAGCTCAGTGGG + Intergenic
1036635633 8:10548143-10548165 GCTTCCTTAGGGAGCTGGGGCGG + Intronic
1037885661 8:22594834-22594856 GAGCCCTCCTGGAGCTCAGGAGG + Intronic
1037902103 8:22694443-22694465 TCCTCCTTCTGGAACTCTGGCGG - Intergenic
1038330056 8:26601084-26601106 TCTGCCCTCTGGAGATCAGGAGG - Intronic
1038416575 8:27400796-27400818 GCGTGGGTCTGGAGCTCAGGAGG + Intronic
1038960914 8:32518580-32518602 TCTTCCTTGTGCAGCTCAGGAGG - Intronic
1039655932 8:39406657-39406679 GTTTCCTTCCTGAGGTCAGGAGG + Intergenic
1040093996 8:43425692-43425714 GCTTCCTTCAGGAGCTCTTTTGG - Intergenic
1041748021 8:61230675-61230697 GCTTCCTACTTGAGCTGAGCAGG + Intronic
1041914770 8:63127699-63127721 AGTTCTTTCTGGAGCTCAGCAGG + Intergenic
1043244237 8:77977900-77977922 GCTTCCTTCAGGAGCTCTTTAGG + Intergenic
1045356469 8:101393561-101393583 GTTTCCTTCTGTAGCTCACAAGG - Intergenic
1045652521 8:104354275-104354297 TCTACCTTCTGGAGCTTAGGGGG - Intronic
1046099999 8:109603133-109603155 TCTTCCTTCTCGAGCTGGGGCGG + Intronic
1047309041 8:123676825-123676847 ACTTCCTTCTGCTGCACAGGTGG - Intergenic
1049175977 8:141192972-141192994 GCTTCCCTCGGGGGCTCGGGGGG + Intronic
1051035959 9:12745880-12745902 GCTTCTTTCAGGAGCTCTTGTGG + Intergenic
1055651109 9:78408007-78408029 CTTTCCTTCAGGAGTTCAGGGGG + Intergenic
1055696770 9:78893335-78893357 TTTTCCTTCAGGAACTCAGGAGG + Intergenic
1057372777 9:94489108-94489130 CATTTCTTCTGGAGCTCAGTGGG + Intergenic
1057502307 9:95605364-95605386 GCTGACTTGTGCAGCTCAGGAGG + Intergenic
1058618831 9:106862699-106862721 GCCTCCTTCTGGGGTTCAGCAGG + Intergenic
1059234376 9:112750186-112750208 GCTTGCTTCTGCAGCTGAGCTGG - Intergenic
1060364828 9:123000736-123000758 GCAGACTTCTGGAGCCCAGGAGG - Intronic
1060883730 9:127136236-127136258 GCAGCCAGCTGGAGCTCAGGGGG - Intronic
1061128341 9:128690133-128690155 GCTTCTGCCTGGAGCTCGGGTGG + Intronic
1061592538 9:131607267-131607289 CCTTCTTTCAGGAGCTCGGGGGG + Intronic
1061709318 9:132476817-132476839 GGTTCCTTCTGGGGCTCCGAGGG - Intronic
1185527148 X:789012-789034 GCTTCCACCTGGACCTCCGGTGG - Intergenic
1186612986 X:11156601-11156623 ACTTCGTTCTGGAGATCTGGGGG + Exonic
1186625202 X:11285962-11285984 GCTTCCTTTTGCTGCTCAAGGGG + Intronic
1187645422 X:21341540-21341562 GCTTCCTTCAGGAGCTCTTTTGG - Intergenic
1188025593 X:25205602-25205624 GCTTCCTTCCAGAGGTCTGGAGG + Intergenic
1189271632 X:39756025-39756047 GTGTCCTTCTGCAGCTCTGGAGG + Intergenic
1191001103 X:55660440-55660462 TCTGCCATCTGGAGCTCAGGAGG - Intergenic
1191592680 X:62905345-62905367 GCTTCCTTCAGGAGCTCTTTTGG + Intergenic
1192720930 X:73697069-73697091 GCTTCCTTCAGGAGCTCTTTAGG - Intergenic
1193487311 X:82102649-82102671 GCTTCCTTCTGGCCCCCAGCAGG + Intergenic
1195283086 X:103356536-103356558 GCTTCCTTCAGCAGCGCAGGCGG + Exonic
1196465872 X:115970715-115970737 GCTTCCCTCTGGTTCCCAGGTGG + Intergenic
1198447610 X:136733901-136733923 GGTTCCTGCTGGAGTTCAGAGGG + Intronic
1198767229 X:140091845-140091867 GCCTCCTCCTGCAGCTCGGGGGG - Intergenic
1199047606 X:143194644-143194666 GCTGCCTTATGGAGATTAGGTGG - Intergenic
1202344201 Y:23904539-23904561 GCTTCCTTCAGGAGCTCTTTTGG + Intergenic
1202526567 Y:25765544-25765566 GCTTCCTTCAGGAGCTCTTTTGG - Intergenic