ID: 1104002864

View in Genome Browser
Species Human (GRCh38)
Location 12:124871505-124871527
Sequence CAGGGCAACGACTCTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 318}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104002860_1104002864 -5 Left 1104002860 12:124871487-124871509 CCAGGCAGAGGGAATAGCCAGGG 0: 1
1: 11
2: 84
3: 390
4: 1298
Right 1104002864 12:124871505-124871527 CAGGGCAACGACTCTGAGGCAGG 0: 1
1: 0
2: 3
3: 32
4: 318
1104002856_1104002864 10 Left 1104002856 12:124871472-124871494 CCAGGGAAGAACATTCCAGGCAG 0: 1
1: 4
2: 15
3: 55
4: 310
Right 1104002864 12:124871505-124871527 CAGGGCAACGACTCTGAGGCAGG 0: 1
1: 0
2: 3
3: 32
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104002864 Original CRISPR CAGGGCAACGACTCTGAGGC AGG Intronic
901050627 1:6424340-6424362 GAGGACAACGGCCCTGAGGCAGG - Intronic
901099403 1:6707839-6707861 CAGGGCAAAGCCTTTGAGGCAGG + Intergenic
901102045 1:6726446-6726468 CAGGGCAAAGGCCCTGAGGCAGG - Intergenic
901690115 1:10967323-10967345 CAGTGCAAGGGCCCTGAGGCAGG - Intronic
902447055 1:16474205-16474227 CAGGGAAAAGGCCCTGAGGCGGG + Intergenic
905078438 1:35295327-35295349 AAGGGCAAAGATTATGAGGCAGG + Intronic
905788491 1:40776645-40776667 CAGGGCCAGGACTCTAAGGAGGG - Intergenic
905913975 1:41672403-41672425 CAGGGCAGAGAAGCTGAGGCCGG - Intronic
907266841 1:53267038-53267060 CTGAGCAAAGGCTCTGAGGCAGG - Intronic
908241699 1:62194233-62194255 CAGTGCAAGGGCCCTGAGGCAGG + Intergenic
909325121 1:74341809-74341831 CAGGGCATTGAATCTGTGGCTGG + Intronic
912545622 1:110449047-110449069 CAGTGCAACAACCCTGTGGCAGG - Intergenic
913677507 1:121155331-121155353 CATGGCTATGACTCTGTGGCAGG - Intergenic
914029340 1:143942960-143942982 CATGGCTATGACTCTGTGGCAGG - Intergenic
914160109 1:145124990-145125012 CATGGCTATGACTCTGTGGCAGG + Intergenic
916432496 1:164744626-164744648 CTGGGCAATGACTCTGTGCCAGG - Intronic
916447360 1:164885680-164885702 AAGGGCAAAGACCCTGAGGTAGG - Intronic
917277196 1:173343408-173343430 AAGTGCAAAGACTCTGAGGCAGG + Intergenic
917669356 1:177257568-177257590 CAGAGCACCCACTCTGAGGCAGG + Intronic
918371533 1:183866533-183866555 CACGGGAAAGCCTCTGAGGCAGG + Intronic
919866681 1:201788183-201788205 AAAAGCAACAACTCTGAGGCAGG + Intronic
920464812 1:206173845-206173867 CATGGCTATGACTCTGTGGCAGG - Intergenic
921816861 1:219574178-219574200 TAGTGCAAAGACCCTGAGGCAGG + Intergenic
923150025 1:231224584-231224606 CAGTGCAAGGGCCCTGAGGCAGG - Intronic
923951402 1:238959604-238959626 CAGGCCAACGCCACTAAGGCTGG - Intergenic
924466337 1:244302065-244302087 CAGAGCAAAGAATCTGAGCCTGG - Intergenic
924625304 1:245692478-245692500 CAGGGCATCGAGGCTGAGGCAGG + Intronic
1062992377 10:1832593-1832615 CAGTGCAAAGACCCTGGGGCAGG + Intergenic
1063337393 10:5229163-5229185 CAGGGCCCCGGGTCTGAGGCAGG + Intergenic
1063987958 10:11527264-11527286 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
1064325175 10:14343733-14343755 CAGTGCAAAGGCTCTGAGGCAGG - Intronic
1066600496 10:37100851-37100873 CTGTGTGACGACTCTGAGGCAGG + Intergenic
1069891060 10:71652781-71652803 CAGGGCCACAGCTCTGAGGGTGG - Intronic
1071397499 10:85238248-85238270 CAGGGCTACAAATCTGCGGCTGG + Intergenic
1071476710 10:86031865-86031887 CAGTGCAAAGACTCTGAGCAGGG - Intronic
1073638115 10:105220210-105220232 TAGGGCAAAGATTCTGAGCCAGG - Intronic
1074115178 10:110451764-110451786 CAGGGCATGCACTGTGAGGCTGG + Intergenic
1074941668 10:118241865-118241887 CAGGGGAAAGATTCTGTGGCAGG + Intergenic
1075341919 10:121653782-121653804 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1075545211 10:123350134-123350156 CAGGGCCAGGACACTGACGCTGG + Intergenic
1075851885 10:125595651-125595673 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1077121549 11:911077-911099 CAGCGCCACGGCTCTTAGGCAGG + Intronic
1077694228 11:4379016-4379038 CATGGAAATGACTCTGAGGTGGG - Intergenic
1079395641 11:20060768-20060790 ATGGGCAGAGACTCTGAGGCAGG + Intronic
1083302244 11:61745307-61745329 CAGGGCACTGACTCTGCAGCTGG - Exonic
1083613029 11:64013436-64013458 CAGGGCAAAGGCCCGGAGGCAGG + Intronic
1083791298 11:64988085-64988107 CAGGACAAGCACTCTGAGGCGGG - Exonic
1083859403 11:65411904-65411926 CTGGGCCACCACTCTGAGGAGGG + Exonic
1084062492 11:66685513-66685535 CAGGAGAATGACCCTGAGGCAGG + Exonic
1084512941 11:69617428-69617450 CAGTGCAAGGGCCCTGAGGCAGG + Intergenic
1085447009 11:76607647-76607669 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1085739477 11:79066503-79066525 CAGGGCACCTACTCTGCAGCAGG - Intronic
1087816754 11:102666263-102666285 GAGAGCAAAGACTCTGCGGCAGG + Intergenic
1090109205 11:123886710-123886732 CTGGGAAAAGGCTCTGAGGCAGG + Intergenic
1090431237 11:126648352-126648374 AAGTGCAAAGACCCTGAGGCAGG - Intronic
1092173729 12:6389262-6389284 CAGTGCAAAGACCCTGAGGCAGG + Intronic
1092215517 12:6679062-6679084 GAGGGCAGGGACACTGAGGCAGG + Exonic
1094027723 12:25976359-25976381 GACAGCAACCACTCTGAGGCTGG - Intronic
1094449295 12:30567291-30567313 AAGGGCAAAGTCCCTGAGGCTGG - Intergenic
1097626211 12:62003406-62003428 CAGTGCAAAGGCTCTGAGGTGGG - Intronic
1098573931 12:72019404-72019426 AAGTGCAAAGACCCTGAGGCAGG - Intronic
1098855632 12:75650289-75650311 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1101433398 12:104645285-104645307 GAGGGCACCCACTCTGAGCCAGG + Intronic
1101725655 12:107386104-107386126 CAGGGCAAAGGCCCTGAGGCAGG - Intronic
1101920140 12:108925739-108925761 CAGTGCAAAGATCCTGAGGCAGG - Intronic
1102278684 12:111601145-111601167 GAGGGCAAAGGCTCTGAGGGGGG + Intergenic
1103162526 12:118741452-118741474 AAGTGCAAAGAGTCTGAGGCAGG - Intergenic
1103201667 12:119092970-119092992 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1103662031 12:122527763-122527785 GAGTGCAAAGACTCGGAGGCTGG - Intronic
1104002864 12:124871505-124871527 CAGGGCAACGACTCTGAGGCAGG + Intronic
1105039386 12:132949788-132949810 CAGAGCAAGGACACTGAGGTAGG + Intronic
1105210746 13:18255434-18255456 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1105560286 13:21484303-21484325 CAAGGCAATGACTTTGAGGCAGG + Intergenic
1106335273 13:28777993-28778015 CAGGGCCCTGACTCTGAGCCCGG + Intergenic
1106517331 13:30466102-30466124 CCGGGCAAAGAGGCTGAGGCGGG + Intronic
1107452429 13:40521988-40522010 AAGGGCAAAAACACTGAGGCAGG - Intergenic
1107954957 13:45502772-45502794 CGGGGCAAAGACTGGGAGGCAGG - Intronic
1108242109 13:48475526-48475548 CAGAGCAGGGACTCTGAGGGAGG + Intronic
1108841721 13:54626094-54626116 GAGGGCAAAGACCCTGAGACAGG + Intergenic
1108974800 13:56425868-56425890 AAGTGCAAAGGCTCTGAGGCAGG - Intergenic
1110443902 13:75555138-75555160 AAGTGCAAAGACTCTGAAGCAGG - Intronic
1111834750 13:93374439-93374461 CAGGGTAAAGACTCTGTTGCAGG - Intronic
1112469010 13:99671089-99671111 TAGTGCAACAACCCTGAGGCAGG - Intronic
1113451393 13:110412649-110412671 CAGGGCAACTACTGTGACTCAGG - Intronic
1117099649 14:52333412-52333434 CAGGGCAATGACCCTGAGATGGG - Intergenic
1117336228 14:54759364-54759386 AAGGGCAAAGGCTCTGAGGGGGG - Intronic
1121011081 14:90520680-90520702 CAGGGCAGCTACTCTCAGGAGGG + Intergenic
1121501249 14:94440123-94440145 CATGACAAAGACTCAGAGGCAGG - Intergenic
1121564015 14:94895213-94895235 CAGGGCAACAGCCTTGAGGCAGG - Intergenic
1121598086 14:95181121-95181143 CAGTGCAAAGGCACTGAGGCAGG - Intergenic
1121731775 14:96192477-96192499 CAGGGGACCAACTCTGGGGCAGG + Intergenic
1121824218 14:96997492-96997514 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1122283298 14:100636814-100636836 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1122370025 14:101224554-101224576 CAGGGAAGGGACACTGAGGCAGG + Intergenic
1122886854 14:104714037-104714059 CAGACCAAGGACGCTGAGGCCGG + Intronic
1123035184 14:105469073-105469095 CAGGGCAGCCACGCTGTGGCCGG - Intronic
1124233726 15:27968781-27968803 CAGGGAAACCACACAGAGGCGGG + Intronic
1125212466 15:37233235-37233257 CAGGTCAAAGACAGTGAGGCAGG + Intergenic
1125790225 15:42359887-42359909 CAGAGCAAGGCCACTGAGGCTGG + Exonic
1125931775 15:43605225-43605247 CAGGGCAGCAAATCTGAGTCTGG + Intronic
1125944875 15:43704703-43704725 CAGGGCAGCAAATCTGAGTCTGG + Intergenic
1126534579 15:49747521-49747543 CAGTACAAAGGCTCTGAGGCAGG + Intergenic
1129052391 15:72793310-72793332 CAGAGCAAAGACTCTTAGGAAGG - Intergenic
1129102840 15:73282105-73282127 AAGGGAAAGGACCCTGAGGCAGG - Intronic
1129269147 15:74410393-74410415 GAGGGCACCGACTGTGAAGCTGG - Exonic
1129719069 15:77868029-77868051 AGTGGCAACGACTCTCAGGCTGG - Intergenic
1130020899 15:80230809-80230831 CAGTCCAAGGACGCTGAGGCAGG + Intergenic
1130888790 15:88115795-88115817 TAGGGCAGTGTCTCTGAGGCCGG + Intronic
1130905150 15:88234929-88234951 CAGTGCAACGCCTCTCAGGTTGG - Intronic
1131366306 15:91845023-91845045 CAGGGCTCCCTCTCTGAGGCAGG + Intergenic
1132113285 15:99117711-99117733 CAGGCCCCGGACTCTGAGGCAGG - Intronic
1132649641 16:1014651-1014673 CAGGGAGACGACTCTGGGCCAGG - Intergenic
1132672780 16:1108532-1108554 AAGGGCACCTGCTCTGAGGCCGG - Intergenic
1134041329 16:11070768-11070790 CAGAGCAAAGACTCTGAGGTGGG - Intronic
1136378057 16:29877005-29877027 CAGAGCAAAGCCTCCGAGGCTGG - Intronic
1137610035 16:49811844-49811866 CAGGGCAGCTGCCCTGAGGCTGG + Intronic
1139430194 16:66907055-66907077 CAGGGGTTGGACTCTGAGGCTGG - Intergenic
1140508743 16:75492163-75492185 CAGGGCAGTGGCTCTGAGCCAGG - Intronic
1141112157 16:81278702-81278724 CAGTGCAAAGGCCCTGAGGCTGG - Intronic
1141735413 16:85848969-85848991 CATGGCAACACCTCGGAGGCAGG - Intergenic
1142341058 16:89522865-89522887 CAGGGAGACGCCTCTGAGGAGGG - Intronic
1145241921 17:21245178-21245200 CAGTGCAAAGGCTCTGAGGCAGG + Intronic
1147218930 17:38916945-38916967 AAGTGCAAAGGCTCTGAGGCAGG + Intronic
1148758923 17:49989437-49989459 CAGGGAAAAGGCTCTGAGTCAGG + Intergenic
1149137797 17:53390767-53390789 CAGGGCCACGTCTCTGGGGAAGG - Intergenic
1150149816 17:62799880-62799902 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1150805566 17:68316127-68316149 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1151252267 17:72845389-72845411 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1151555035 17:74842554-74842576 CAGGGGCAGGACTCTGGGGCTGG - Exonic
1151716422 17:75833276-75833298 AAGGGCAGAGACCCTGAGGCAGG - Intronic
1152555699 17:81052166-81052188 CAGGGCAAAGGCCCCGAGGCAGG - Intronic
1152822400 17:82444026-82444048 CAGAGCAGCGACAGTGAGGCCGG - Exonic
1153147989 18:2055593-2055615 AAGTGCAAAGGCTCTGAGGCAGG + Intergenic
1155623348 18:27806861-27806883 CAGTGCAAAGAATCTGATGCCGG + Intergenic
1156595753 18:38545850-38545872 CAGGGGAATGACTTTGAGTCTGG - Intergenic
1159081652 18:63742228-63742250 CAGGACATTGACTCTGAAGCTGG - Intergenic
1161001597 19:1913682-1913704 CAGGGCACCGACCCTAAGGAAGG + Intronic
1161246794 19:3257226-3257248 CAGTGCAAAGGCCCTGAGGCTGG + Intronic
1161629367 19:5344554-5344576 CAGTGCAAAGGCTCTGTGGCAGG - Intergenic
1161640329 19:5418728-5418750 CAGGGCAAGGACCCTGAGGCTGG + Intergenic
1161700691 19:5793392-5793414 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1161859212 19:6785065-6785087 CAGTGCAAAGGCCCTGAGGCTGG - Intronic
1162080701 19:8215971-8215993 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1162153636 19:8662454-8662476 CTGTGCAAAGACCCTGAGGCAGG + Intergenic
1162518980 19:11167858-11167880 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1162528970 19:11224618-11224640 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
1162819375 19:13213239-13213261 CAGTGCAAAGGCTCTGAGGCTGG - Intronic
1162853507 19:13450290-13450312 CAGTGCAAAGGCTCTGAGGCTGG - Intronic
1162871645 19:13591031-13591053 CAGTGCAAAGGCCCTGAGGCTGG + Intronic
1162950106 19:14066358-14066380 CAGTGCAAAGACCCTGAGGTGGG + Intergenic
1163272975 19:16265401-16265423 CAGTGCCAAGACCCTGAGGCAGG + Intergenic
1163581037 19:18138892-18138914 CAGGGCAAAGGCTCTGAGGTGGG - Intronic
1164743430 19:30593974-30593996 CATGGGACAGACTCTGAGGCTGG - Intronic
1165700445 19:37933235-37933257 CAGGGCAAAGTCTCCGAGGGAGG - Intronic
1165791972 19:38498091-38498113 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
1166109999 19:40616077-40616099 CAGTGCAAAGGCTCTGAGGCAGG + Intronic
1166535458 19:43571264-43571286 TAGGGAAAAGACTCTGAAGCTGG - Intronic
1166946904 19:46402952-46402974 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1166952482 19:46438803-46438825 CAGTGCAAAGGCCCTGAGGCTGG + Intergenic
1166952677 19:46440217-46440239 CAGTGCAAAGGCCCTGAGGCTGG + Intergenic
1167793374 19:51693918-51693940 CAGGGCAAAGACTCAGAGAGGGG + Intergenic
1168311645 19:55463778-55463800 CAGGGCAGCGAGACTCAGGCTGG + Intergenic
1168313526 19:55473507-55473529 CAGGGCTCAGAGTCTGAGGCTGG + Intergenic
925801869 2:7609654-7609676 GAGGGGAACCACTCTGAGGTGGG - Intergenic
925915350 2:8600585-8600607 GAGGGCACCCCCTCTGAGGCAGG + Intergenic
927177796 2:20422545-20422567 CAGGGCCAGGACTCTGAGTGGGG - Intergenic
927195325 2:20542653-20542675 CAGGCCAAGGAGTCAGAGGCAGG - Intergenic
927720851 2:25381004-25381026 CAGGGCAAGGCCTCAGTGGCTGG + Intronic
929537662 2:42793402-42793424 GAGGGCTAGGACACTGAGGCCGG - Intergenic
929852442 2:45604604-45604626 AAGTGCAAAGACCCTGAGGCAGG - Intronic
929870891 2:45758467-45758489 AAGTGCAAAGACTCTGAGGTAGG - Intronic
931746354 2:65294854-65294876 AAGGGCAAACATTCTGAGGCAGG + Intergenic
932017276 2:68043951-68043973 CAGGGCAAAGACCCCAAGGCAGG - Intronic
932817804 2:74875623-74875645 CAAAGCAAGGACTCTCAGGCCGG - Intronic
934657002 2:96121630-96121652 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
937341791 2:121095936-121095958 CTGGGGAACCAGTCTGAGGCCGG + Intergenic
937466155 2:122134908-122134930 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
937985284 2:127635558-127635580 CAGGGGAATGACCCTGAGTCAGG - Intronic
941162983 2:162055978-162056000 AAGTGCAAAGTCTCTGAGGCAGG - Intronic
944293654 2:198036904-198036926 CAGGGCAACATCCCAGAGGCTGG + Intronic
944668545 2:201976381-201976403 CAGTGCAAAGGCCCTGAGGCTGG + Intergenic
944968240 2:204960993-204961015 AAGTGCAAAGACCCTGAGGCAGG + Intronic
945660891 2:212683960-212683982 CAAGGCAAACACCCTGAGGCAGG + Intergenic
946149492 2:217754621-217754643 CAGAGCAATGTGTCTGAGGCTGG + Intronic
946788773 2:223277007-223277029 TGGGGCAAAGACACTGAGGCAGG + Intergenic
948446778 2:238039362-238039384 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
1168968517 20:1914742-1914764 CTGGGCAAAGACTCAGAGGTAGG - Intronic
1170048312 20:12111548-12111570 GAGTGCAAAGACTATGAGGCAGG + Intergenic
1170184385 20:13571870-13571892 CAGGGTGAAGACCCTGAGGCTGG - Intronic
1171250012 20:23639677-23639699 CAGTGCAAAGGCCCTGAGGCGGG + Intergenic
1171266755 20:23777401-23777423 CAGTGCAAAGGCCCTGAGGCGGG + Intergenic
1171276301 20:23859045-23859067 CAGTGCAAAGGCCCTGAGGCGGG + Intergenic
1171291888 20:23987123-23987145 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
1171976135 20:31595946-31595968 AAGGGCAAGGGCCCTGAGGCAGG + Intergenic
1172025252 20:31943974-31943996 CAGAGAAACTACTCTGAAGCAGG - Exonic
1172027047 20:31955614-31955636 CAGTGGAAAGACCCTGAGGCAGG - Intergenic
1173021142 20:39269073-39269095 CAGGGCACCAGCTCTGAGCCTGG - Intergenic
1173693281 20:44983067-44983089 CAGTGCAAAGACCTTGAGGCTGG + Intronic
1174117614 20:48237992-48238014 AAGTGCAAAGACCCTGAGGCAGG - Intergenic
1174121482 20:48268924-48268946 CAGGGCAAAGGCCCTGAGGCAGG - Intergenic
1174147188 20:48460125-48460147 CAGGGCACGAACTCTGAGACCGG - Intergenic
1174264966 20:49324712-49324734 CAGTGCAAAGTCGCTGAGGCAGG - Intergenic
1174360899 20:50028376-50028398 CAGTGCAAAGGCCCTGAGGCTGG - Intergenic
1174394693 20:50239723-50239745 AAGTGCAAAGGCTCTGAGGCAGG + Intergenic
1174397687 20:50258056-50258078 CAGTGCAAAGGCCCTGAGGCGGG + Intergenic
1174447968 20:50602911-50602933 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1174586031 20:51609075-51609097 CAGTGCAAAGGCACTGAGGCGGG + Intronic
1174624674 20:51904181-51904203 CAGGGCAAAGGCTCTGGTGCAGG + Intergenic
1175105447 20:56611532-56611554 CTGGGCACCGACTCTGTGCCAGG - Intergenic
1175192485 20:57220892-57220914 CAGGGCAAAGATACTGTGGCCGG + Intronic
1175486069 20:59347280-59347302 ATGGGCTAAGACTCTGAGGCAGG - Intergenic
1178749219 21:35284498-35284520 CAGGGCAAAGACCCTGAGGTGGG - Intronic
1180179885 21:46113270-46113292 CTGAGCAGCGATTCTGAGGCAGG - Intronic
1180765509 22:18343983-18344005 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1180780808 22:18518409-18518431 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1180813521 22:18775716-18775738 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1181199705 22:21210046-21210068 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
1181274162 22:21677962-21677984 CAGTGCAAAGACCCTGAGGTGGG + Intronic
1181400057 22:22645812-22645834 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1181649307 22:24249978-24250000 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1181702031 22:24626910-24626932 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1181770214 22:25119780-25119802 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
1181796120 22:25312326-25312348 CAGGGCAAAGACCCTGAGCCTGG + Intergenic
1181836665 22:25615936-25615958 CAGGGCAAAGACCCTAAGGCTGG + Intronic
1183030281 22:35098789-35098811 CAGTGCCAAGACCCTGAGGCAGG - Intergenic
1184059488 22:42073638-42073660 AAGGGCAAAGGCTCTGAGGCGGG + Intergenic
1184272759 22:43394021-43394043 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1185220382 22:49626555-49626577 CAGGCCCACGGCTCTGTGGCAGG - Intronic
1203227130 22_KI270731v1_random:84873-84895 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1203263621 22_KI270734v1_random:1398-1420 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
950399702 3:12760457-12760479 CAGGGCAAAGGCCCTGAGGAGGG - Intronic
951467081 3:23013288-23013310 CAGTGCAAAGACTCCGAGGCTGG - Intergenic
952416097 3:33092760-33092782 CAGGCAAACCACTCTGAAGCAGG + Exonic
953386944 3:42512125-42512147 CAGGGCAACAGCACTTAGGCAGG + Intronic
953708760 3:45251852-45251874 CAGGGAAACAACTATAAGGCAGG - Intergenic
955507935 3:59650694-59650716 CAGTGCAAAGACCCTGAAGCAGG + Intergenic
955964085 3:64370159-64370181 AAGTGCAAGGGCTCTGAGGCTGG + Intronic
956167207 3:66405799-66405821 CAGGGCGCTGACTCTGAGCCAGG + Intronic
956169872 3:66424418-66424440 CATGGCATCAACTCTCAGGCAGG - Intronic
956450614 3:69371215-69371237 GTGGGCTACAACTCTGAGGCTGG + Intronic
956897979 3:73683319-73683341 AAGTGCAAAGTCTCTGAGGCAGG + Intergenic
958715832 3:97779250-97779272 CAGTGCAATGATTCTGAGGAAGG - Intronic
960616770 3:119602953-119602975 CCGGGCAAAGACCCTCAGGCAGG + Intronic
961380617 3:126494422-126494444 CAAGGCCAAGACTCGGAGGCTGG - Intronic
961426421 3:126851933-126851955 CAGGGCAAGCAACCTGAGGCTGG - Intronic
961717056 3:128864970-128864992 TGGGGCAATGACTCTGAGGGGGG - Intergenic
961751922 3:129101622-129101644 CAGGACAAAGGCTCAGAGGCAGG + Intronic
961788021 3:129359131-129359153 CAGGGCAAAGGCCCGGAGGCTGG + Intergenic
967300177 3:188004865-188004887 CAGGGCAATGTCTCTGATGTTGG + Intergenic
967741570 3:193008850-193008872 AAGTGCAAAGACCCTGAGGCTGG - Intergenic
968181140 3:196596248-196596270 CAGCCCTACGACTCTGTGGCTGG + Intergenic
968627536 4:1633960-1633982 CAGGGCAATGAGGCTGTGGCTGG + Intronic
968821976 4:2861124-2861146 AAGTACAAAGACTCTGAGGCAGG + Intronic
968920100 4:3518033-3518055 CAGGGCTACAGCACTGAGGCTGG - Exonic
969503854 4:7571361-7571383 AAGGGCAAAGACTCAGAGGTGGG + Intronic
969586842 4:8098821-8098843 CAGGGCCTCGACACTGAGCCAGG - Intronic
970060701 4:12030200-12030222 CAGAACAAAGACTTTGAGGCAGG - Intergenic
970459525 4:16258911-16258933 CAGGGCAAGGACTCTGATCCAGG - Intergenic
971552122 4:27970531-27970553 CAGAGCAAAGATTCTGAAGCAGG - Intergenic
972633243 4:40859845-40859867 CAGTGCAAAGGCTCTGAGGTGGG - Intronic
973644572 4:52937204-52937226 AAGTGCAAAGGCTCTGAGGCAGG + Intronic
976106617 4:81625796-81625818 AAGGGCAAAGGCTCTGAGGCAGG - Intronic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
978781281 4:112557661-112557683 TAGGGCAAGAACACTGAGGCTGG + Intronic
979890122 4:126081896-126081918 AGGGGCAAACACTCTGAGGCAGG + Intergenic
982241757 4:153306837-153306859 CAGGGCAAGGACTGGGAGCCTGG - Intronic
984731374 4:183070880-183070902 CACAGCAAGGACTCTGAGGAAGG - Intergenic
984785530 4:183564248-183564270 CTGGGGAAAGACTCTTAGGCTGG + Intergenic
985843735 5:2329240-2329262 CAGGTCAGCGACAGTGAGGCAGG + Intergenic
987039892 5:14052574-14052596 AAGGGCAAAGGCCCTGAGGCGGG + Intergenic
988865947 5:35335241-35335263 AAGGGCAAAGACCCTGAGGTGGG - Intergenic
992186177 5:74246877-74246899 AAGGGCACAGACTTTGAGGCTGG - Intergenic
992633098 5:78700598-78700620 CATGGCACCGTCTCTGGGGCTGG + Intronic
992940947 5:81760725-81760747 CAAGGCAAAGGCCCTGAGGCTGG - Intergenic
994128440 5:96196614-96196636 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
994278691 5:97871873-97871895 CATGGGAAAGGCTCTGAGGCAGG + Intergenic
995466261 5:112452187-112452209 CAGGGCATGCACTGTGAGGCTGG - Intergenic
996570149 5:124924891-124924913 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
996628066 5:125594295-125594317 CAAGGCAAAGGCCCTGAGGCAGG + Intergenic
997214571 5:132100139-132100161 CAGCGCAAAGGCTCTGAGGCTGG - Intergenic
997440733 5:133907111-133907133 CAGAGCTACGACTCAGGGGCTGG - Intergenic
998391792 5:141791809-141791831 CAGTGCAAAGGCTCTGAGGTGGG + Intergenic
998835236 5:146196857-146196879 AAGTGCAAAGACCCTGAGGCAGG - Intergenic
999111428 5:149124912-149124934 CAGTGCAAAGACACAGAGGCGGG + Intergenic
999177689 5:149642897-149642919 CAGTGCAACGGCCCTGAGTCAGG - Intergenic
1000235557 5:159356386-159356408 AAGGGCAAAGGCTCTGAGACAGG - Intergenic
1001133092 5:169080440-169080462 CAAGGCAAGGAGTCTGCGGCTGG + Intronic
1001296224 5:170501181-170501203 CAGGGCACCGACTCAGGGCCAGG + Intronic
1001300837 5:170532611-170532633 CAGGCCAATGGATCTGAGGCAGG - Intronic
1001637639 5:173223483-173223505 CAGTGCAAAGACTCTGAGGCAGG + Intergenic
1002417073 5:179126261-179126283 CAGGGCACCGAGCCTGCGGCTGG + Intronic
1004329750 6:14710601-14710623 AAGGGCCAAGACTGTGAGGCAGG + Intergenic
1004761488 6:18671539-18671561 AAGGGCAAGGACTCTGAGGCAGG - Intergenic
1005665840 6:28053417-28053439 CAGGGAAACCACTGTGAGGTGGG + Intergenic
1006452631 6:34113974-34113996 CAGTGCAAAGACCCTGAAGCAGG - Intronic
1007116111 6:39344529-39344551 CAGAGCAAAGGCCCTGAGGCTGG - Intronic
1007709570 6:43813656-43813678 CAGGGCAGCTTCTATGAGGCTGG + Intergenic
1007718873 6:43873579-43873601 AAGCGCAAAGGCTCTGAGGCAGG + Intergenic
1010067133 6:71695911-71695933 CATGGCAACCATTTTGAGGCTGG - Intergenic
1012119013 6:95340097-95340119 CTGGGCAAAGACTATGATGCAGG - Intergenic
1013099875 6:106977192-106977214 GAGAGCTACTACTCTGAGGCAGG - Intergenic
1013292706 6:108732709-108732731 CAGGGCAAGGCCTCTGAGATGGG - Intergenic
1016811294 6:148263534-148263556 CAGGGCAACCATTCTGATGGAGG + Intergenic
1016813134 6:148280246-148280268 CAGGGCAACCACCCAGAGGCAGG - Intronic
1018152816 6:160956164-160956186 AAGGGCAAGGGCCCTGAGGCAGG + Intergenic
1018469668 6:164084235-164084257 GAGGACATGGACTCTGAGGCGGG - Intergenic
1019062222 6:169264791-169264813 CAGGGCAGGGGCTCTGAGGATGG + Intergenic
1019647534 7:2139141-2139163 CAGGGCGAGGACTGTGAGGAGGG + Intronic
1020256713 7:6506492-6506514 CAGGGCAGGGACACTGAGGATGG + Intronic
1021543395 7:21785998-21786020 CAGGGCAAACACTTTGAGGCAGG - Intronic
1022315148 7:29238810-29238832 CAGGACAAAGACCCTGAGGTGGG + Intronic
1023044986 7:36202986-36203008 CAGGGCAAGGACACAGATGCTGG - Intronic
1023119047 7:36890949-36890971 CAGGGCAAAGGCCCTGAGGTTGG - Intronic
1024167431 7:46748779-46748801 GAGGGCAAAGACCCTGAAGCAGG - Intronic
1024478637 7:49840858-49840880 CAGGGCAACAGCTCTGACTCGGG - Intronic
1024673525 7:51617795-51617817 CAAGGCAGGGACTCAGAGGCAGG - Intergenic
1025247893 7:57331201-57331223 CAGCGCAAAGGCCCTGAGGCAGG - Intergenic
1026858838 7:73771589-73771611 AAGTGCAGGGACTCTGAGGCAGG - Intergenic
1029479799 7:100805512-100805534 CCGGGCCACGATTTTGAGGCTGG + Exonic
1032695131 7:134329240-134329262 CAGGGCAGAGACGCTGGGGCAGG - Intergenic
1034553046 7:151833292-151833314 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
1035411282 7:158644659-158644681 CAGGGGAAGGACTCTGAAACAGG - Intronic
1036749356 8:11434285-11434307 CAGGGCGGGGACTCTGAGCCTGG + Intronic
1037991702 8:23326022-23326044 AAGGGCAATGACTGTGAGTCGGG - Intronic
1040541619 8:48362158-48362180 CAGGGAAACCACTCAGAGGGGGG + Intergenic
1042864250 8:73343781-73343803 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1044934487 8:97279587-97279609 CAGTGCAAAGGCTCTGAGGCAGG - Intergenic
1045358060 8:101406695-101406717 AAGGGCAAAGGCTGTGAGGCAGG - Intergenic
1047668471 8:127118627-127118649 CAGGGCAAAGCCTCTGAAGCAGG - Intergenic
1048364224 8:133724287-133724309 TAGTGCAAAAACTCTGAGGCAGG - Intergenic
1049034996 8:140068422-140068444 CAGGGCAAAGACGCTTGGGCAGG + Intronic
1049215472 8:141405881-141405903 CAGTGCAAGGGCTCGGAGGCAGG + Intronic
1049693784 8:143973825-143973847 CAGGGGAGCGTCTCGGAGGCAGG - Intronic
1049770257 8:144376840-144376862 CCGGGCAGCGACTCGTAGGCGGG - Intronic
1050163021 9:2737540-2737562 CAGGGCGACGATTCTGAGGTTGG - Intronic
1055874379 9:80924561-80924583 CTGGGCAAAGGCCCTGAGGCAGG + Intergenic
1058903337 9:109460591-109460613 CAGTGCAAAGGCCCTGAGGCTGG - Intronic
1059180930 9:112211404-112211426 CAGGGGAAAGAATCTGGGGCTGG + Intergenic
1186515581 X:10164250-10164272 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
1186672223 X:11779659-11779681 CAGGGCCAAGACCCTGAGGCAGG + Intergenic
1186892385 X:13971772-13971794 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1188107935 X:26165283-26165305 CAGGGCAAGGACAATGAGGAAGG + Intergenic
1188375627 X:29424628-29424650 CAGGGGAACAACTGTGAAGCAGG + Intronic
1189198068 X:39168285-39168307 CAGGTCCAGGACACTGAGGCAGG - Intergenic
1189301846 X:39957979-39958001 CAGTGCAAGGGCCCTGAGGCAGG + Intergenic
1191846288 X:65550324-65550346 CTGGGCCACCACTCTGAGGAGGG - Intergenic
1192157022 X:68754250-68754272 CAGTGCAAAGACCCTGAGGCAGG - Intergenic
1192223543 X:69213400-69213422 CAATGCAAAGGCTCTGAGGCAGG + Intergenic
1193367027 X:80646960-80646982 CAGGGCAATGGCACTGAAGCTGG - Intergenic
1197689661 X:129484962-129484984 CAGGGCAGCGCCCCTGTGGCAGG - Intronic
1199271067 X:145883196-145883218 CAGTGTAAAGACTCTGAGGTGGG - Intergenic
1199607100 X:149586110-149586132 CAGGGCCAGGACCCTGAGGGAGG - Intronic
1199632022 X:149783258-149783280 CAGGGCCAGGACCCTGAGGGAGG + Intronic
1200613210 Y:5348569-5348591 AAGGGCAAAGACACAGAGGCAGG - Intronic