ID: 1104003033

View in Genome Browser
Species Human (GRCh38)
Location 12:124872583-124872605
Sequence CTCAAAAAAAAGTAAGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 586
Summary {0: 1, 1: 0, 2: 5, 3: 53, 4: 527}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104003033_1104003039 6 Left 1104003033 12:124872583-124872605 CCCTGGCCTTACTTTTTTTTGAG 0: 1
1: 0
2: 5
3: 53
4: 527
Right 1104003039 12:124872612-124872634 TATGGTTCTGTCACCCAAGCTGG 0: 1
1: 8
2: 347
3: 8030
4: 71474

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104003033 Original CRISPR CTCAAAAAAAAGTAAGGCCA GGG (reversed) Intronic
900255392 1:1695555-1695577 CTCAAAAAAAAATAAAGGCCGGG - Intronic
900263953 1:1747786-1747808 CTCAAAAAAAAATAAAGGCCGGG - Intergenic
901577772 1:10214581-10214603 CCCAAAAAAAAAAAAGGGCAGGG - Intronic
903039344 1:20516788-20516810 CTCAAAAAAATGGAAGGGAAGGG + Intergenic
903492507 1:23740219-23740241 CTCAAAAAAAAATAAAGTAAGGG + Intergenic
904560944 1:31397014-31397036 CTGAAAATTAAGCAAGGCCATGG + Intergenic
905097778 1:35489143-35489165 TTCAAAAAGAAGTAAAGCCTAGG + Intronic
905115331 1:35634320-35634342 CATAAAAAATAGTAAAGCCAAGG + Intronic
905559824 1:38917753-38917775 CTCAGACAAAGGTAAGGCTAAGG - Intronic
905624030 1:39475103-39475125 CTCAAAAAAACGAAAAGTCACGG + Intronic
906659526 1:47572691-47572713 CTCTAAAAACAGTAAGACTAAGG - Intergenic
907109439 1:51913470-51913492 CTCAAAAAAAAAAAAGGGGAGGG - Exonic
907128780 1:52076273-52076295 CTCAAAAAAAAGAAAGAAAAAGG + Intronic
907170514 1:52459283-52459305 CTCAAAAAAAAAAAAGAACAAGG + Intronic
907455096 1:54570513-54570535 CTCAAAAAATAAAAAGGGCAAGG - Intronic
908365966 1:63424139-63424161 CTCAAAAAAAAAATAGGCAAAGG - Intronic
908371806 1:63489406-63489428 CTCAAAAAAAAAAAACCCCACGG + Intronic
908471457 1:64447817-64447839 GGAAAAAAAAAGCAAGGCCAGGG + Intergenic
908743695 1:67355111-67355133 ATCTAAAAAAAAGAAGGCCAGGG + Intronic
908743911 1:67356741-67356763 CTATAAAAAAAGAAAAGCCAAGG + Intronic
910317748 1:85906339-85906361 CTTAAATCAAAGTAAGGTCAAGG + Intronic
910372539 1:86531873-86531895 CTCAAAAAAAAAAAAGACCTGGG + Intergenic
910804668 1:91178692-91178714 CTCAAGAAAAAGGAACCCCATGG - Intergenic
911003847 1:93197685-93197707 CTCAAAAACAAGTTATGGCAAGG + Intronic
911211624 1:95145154-95145176 AACAACAAAAAATAAGGCCACGG - Intronic
911703266 1:100980657-100980679 CTTAAAAAAAAAAATGGCCAAGG - Exonic
911710388 1:101064814-101064836 CTCAAAAAAAATTAAGGACTTGG + Intergenic
911743460 1:101412872-101412894 CTCACATAAAATTAAGGCAAAGG + Intergenic
912850737 1:113121740-113121762 CTCAAAAAAAAAAAAAGACAGGG + Intronic
913274646 1:117124986-117125008 ATCAAAAAAAATAAAGGGCAGGG - Intergenic
914137653 1:144915724-144915746 CTCAAAAAAAAGAAAAGAAAAGG + Intronic
914738964 1:150447248-150447270 TAAGAAAAAAAGTAAGGCCAGGG - Intronic
914745798 1:150500174-150500196 CTCAAAAAAAAAGAAGCCAAGGG + Intronic
914803933 1:150978961-150978983 CTCAAAAAAAAGAAAAGAAAAGG + Intergenic
915387825 1:155512417-155512439 TTAAAAAAAAAGAAAGGCAAAGG + Intronic
915461180 1:156071412-156071434 CTCAAAAAAAAAAAAGAACAGGG - Intergenic
916362686 1:163988808-163988830 GTCAAAAATAAGTAATGACAAGG - Intergenic
916804486 1:168244846-168244868 CTAAAAAAAAAAAAAGGACATGG - Exonic
917048949 1:170896271-170896293 CTCAAAGAGAAGGAATGCCAGGG + Intergenic
918207190 1:182319967-182319989 CTCAAAAAAAAGGTATGGCAGGG + Intergenic
919912174 1:202118388-202118410 CTCAAAAAAAAGAAAAGAAAAGG - Intergenic
920373061 1:205491903-205491925 CTCAGAAAGGAGTCAGGCCACGG - Intergenic
922331253 1:224578481-224578503 ATCAAAAACAAGGAAGGCAAAGG - Intronic
922361594 1:224827937-224827959 CTCATAAGAGAGTAAGGCAATGG + Intergenic
922535825 1:226379934-226379956 CTCCAAAAAAAGCAAGGGCCAGG - Exonic
922644520 1:227273295-227273317 CTCAAAAAAAAGGCCGGGCATGG + Intronic
924385174 1:243493127-243493149 CTCAAACAAAAGACAGGCCAGGG - Intronic
924424135 1:243934285-243934307 CTCAAAAAAAAGGAAAGGAAAGG - Intergenic
1063005958 10:1970849-1970871 CTTAGAAAAAAATATGGCCAAGG + Intergenic
1065226356 10:23547621-23547643 CTCAAAAAAAAGTTATTCAAAGG - Intergenic
1065416660 10:25495585-25495607 ATTAAAAAAAAGTCAGGCCTGGG - Intronic
1065507898 10:26447719-26447741 CTCAAAAAAAAGAAAAGTCATGG - Intronic
1066378079 10:34876666-34876688 CTCAAAAAAAAGAAAAGAAAAGG + Intergenic
1066506305 10:36048432-36048454 CTAAAAAAAAAGTGAGGAGAAGG + Intergenic
1066728025 10:38411618-38411640 CTCAAAAAAAAGAAAGAATATGG + Intergenic
1067276358 10:44838533-44838555 CTCAAAAAAAAAAAAAGACAAGG - Intergenic
1068075110 10:52242893-52242915 CTCAAAAAAAAAGAAGGAGAAGG + Intronic
1068232737 10:54191916-54191938 CTCAAAAGAAAGAAAAGCAAGGG + Intronic
1068401664 10:56535565-56535587 CTCTAAGAAAAGGAAGGTCAGGG + Intergenic
1070182240 10:74025609-74025631 GTCAAAAAAAAGAAAGGGAAGGG + Intronic
1071379192 10:85040687-85040709 CAAAAAAAAAAGTAAGCCCTTGG - Intergenic
1071534586 10:86417368-86417390 CTCAAAAATAAGTAAATACATGG - Intergenic
1071810459 10:89175443-89175465 CTCTACAAAAAGTATGGGCATGG + Intergenic
1072070640 10:91912957-91912979 GTTAACAAAAAGTAATGCCAAGG - Intergenic
1072076626 10:91981444-91981466 CTAAAAAAAAAGTCATGCAAAGG - Intronic
1072242889 10:93513943-93513965 CTCAAAAAAAAAAAAGGGGAGGG - Intronic
1072560599 10:96570019-96570041 CTCAAAAAAAAGAAAGAAAATGG + Intronic
1072833836 10:98690111-98690133 CTCAAAAAGAAGGAACTCCAAGG - Intronic
1073314248 10:102567319-102567341 GTCAAGAAAAAAAAAGGCCAGGG + Intronic
1074338457 10:112602261-112602283 CTCAATAAACAGTAAGTCCCAGG - Intronic
1074505605 10:114067721-114067743 CTCAAAAAAAAGGCTGGGCATGG - Intergenic
1074844139 10:117382056-117382078 CTCAAAAAAAAAATAGGCAAAGG - Intergenic
1076137964 10:128057877-128057899 CTCAAAGGAAAGGAAGGCCATGG + Intronic
1076292640 10:129359488-129359510 CTTAAAAAAAAATAAAGCTATGG - Intergenic
1076296673 10:129391217-129391239 CTCAAAAGAAAGAAAGGGAAGGG + Intergenic
1077084326 11:740905-740927 CTCAAAAAAAAAGCTGGCCATGG + Intergenic
1077489919 11:2856164-2856186 CTAAAAAAAAAAAAAGTCCAGGG - Intergenic
1078344289 11:10531081-10531103 CTTAAAAAAAAGGTTGGCCAGGG + Intronic
1080412829 11:32042310-32042332 CTCAAAAAAAAAAAAGACTAAGG + Intronic
1081882819 11:46468496-46468518 CTTAAAGAAAAGGAAGGCCAGGG + Intronic
1082142296 11:48623242-48623264 ATTAAAAGAAGGTAAGGCCAGGG - Intergenic
1083408659 11:62476390-62476412 CTCAAAAAAAAGTTTTGCAAAGG + Intronic
1083424908 11:62578541-62578563 CTCAAAAAAAAGAAAGGTACCGG + Exonic
1083687844 11:64387841-64387863 AAAAAAAAAAAGTATGGCCAAGG + Intergenic
1084122941 11:67080070-67080092 CTCAAAAAGAAGTAAAGGCTGGG - Intergenic
1084330601 11:68427677-68427699 CTCAAAAAAAAAAAAGGGCCAGG + Intronic
1084680262 11:70662681-70662703 CTTAAAAAAAAAAAATGCCATGG - Intronic
1085394336 11:76199472-76199494 CTTAAAAAAAAAAAAGGCTATGG + Intronic
1085628366 11:78091085-78091107 CTCAAAAAAAAAAAAGGGCGGGG - Intergenic
1085641477 11:78195733-78195755 CTCAAAATAAATTAACCCCAGGG - Intronic
1086256147 11:84878841-84878863 TTCAAAAAATAGTAAGTCAATGG - Intronic
1088195547 11:107269890-107269912 GTGAAAAAAAATAAAGGCCAAGG - Intergenic
1088432236 11:109771256-109771278 CTCAAAAAAAAAGAAAGACAGGG + Intergenic
1088578491 11:111295701-111295723 CTCAAAAAAAAAAAAAGCCAGGG + Intergenic
1089127829 11:116189925-116189947 CTCCAAATAAAATCAGGCCAGGG - Intergenic
1089380630 11:118028703-118028725 CTAAAAACAAAGTAAGGTCAAGG + Intergenic
1089417590 11:118305155-118305177 CTAAAGAAAAAGATAGGCCACGG + Intronic
1090206735 11:124888553-124888575 TTCAACAAAAAGTATGGGCAGGG - Intronic
1090348674 11:126091995-126092017 CTCAAAAAAAAAAAAGGAAAGGG + Intergenic
1090377321 11:126300336-126300358 CTTAAAAAAAAAGAATGCCAAGG - Intronic
1090602196 11:128384757-128384779 CTCAAAAAAAATATAGGCTAGGG + Intergenic
1090918094 11:131184718-131184740 CACAAAAACAAGTAAGTCAACGG - Intergenic
1091037606 11:132247621-132247643 ATCAAAAGGAAGTATGGCCAGGG + Intronic
1091438326 12:492053-492075 CTCAAAAAAAAAAAAGAACAAGG + Intronic
1095949090 12:47772125-47772147 CACAAAAAAAACTAATGCAAGGG + Intronic
1096281928 12:50262816-50262838 CTCAAAAATAAGTAAGTAAAGGG + Intronic
1097017669 12:55998797-55998819 CTCAAAAAAAAAAAAAGCCTGGG - Intronic
1097776118 12:63648424-63648446 CTCAAAAAAAAAAAAGCCCAGGG - Intronic
1098262018 12:68681478-68681500 CTCAAAAAAAAGAAAAGAAATGG + Intergenic
1098768311 12:74518096-74518118 GTCAAAAAAAGGAAAGCCCAAGG + Intergenic
1099031441 12:77530521-77530543 AAAAAAAAAAAGCAAGGCCAAGG - Intergenic
1099052308 12:77794921-77794943 CTCAGAGAATAGTAAGGCCCAGG - Intergenic
1099616427 12:84941503-84941525 CTCAAAAAAAAAGAAGGAAAAGG + Intergenic
1100172987 12:91998470-91998492 CTCAAAAAAAACTGATGCAAAGG + Intronic
1100509284 12:95253566-95253588 CACAAAACAAAGAATGGCCAGGG + Intronic
1100534245 12:95491805-95491827 CTCAAAAAATAGTAATGACCAGG - Intronic
1101005614 12:100398383-100398405 ATCCAAAGAAAGTAAGGTCAAGG - Intronic
1101240906 12:102839167-102839189 CAGAAAATAAAGTAAAGCCATGG - Exonic
1101774983 12:107785407-107785429 CTCAAAAAAAAAAAAGACCAAGG + Intergenic
1102340520 12:112117825-112117847 CTCAAAAAAAAAAGAAGCCAGGG + Intergenic
1102537283 12:113590940-113590962 TTCAAAAAAAAGTAGGGGTACGG + Intergenic
1103112306 12:118291154-118291176 CTCAAAAAAAAGTAAAAACCCGG - Intronic
1103190387 12:118996516-118996538 CAAAAAGAAAATTAAGGCCAAGG + Intronic
1104003033 12:124872583-124872605 CTCAAAAAAAAGTAAGGCCAGGG - Intronic
1104285358 12:127419675-127419697 CTCCAAGAAAAGGGAGGCCAGGG + Intergenic
1104856356 12:131904146-131904168 CTCAAAAAGAAGAAAGGCAGAGG - Intronic
1104913702 12:132252879-132252901 CTCAAAAAAAAAAAAAGACACGG + Intronic
1105045987 12:133003545-133003567 CTAAAAGAAAAGGGAGGCCAGGG - Intronic
1105900801 13:24750955-24750977 CTCAAAAAAAAGTGTGCCAAAGG - Intergenic
1106439336 13:29751590-29751612 ATGAGAATAAAGTAAGGCCATGG + Intergenic
1106497312 13:30292033-30292055 CTCAAAAAAAAATAAAGTTACGG + Intronic
1107680934 13:42849471-42849493 CTTAAACACAGGTAAGGCCAAGG - Intergenic
1107681963 13:42861525-42861547 CTCAAAAAAAAAAAAAGACAAGG - Intergenic
1107913608 13:45127628-45127650 TCCAAAAAAAAACAAGGCCAGGG - Intronic
1108054193 13:46469790-46469812 CTCAAAAAAAAGAAAAGAAAAGG + Intergenic
1108252312 13:48579417-48579439 CTCAAAAATAAGAAAGGGAAGGG - Intergenic
1108297090 13:49032733-49032755 CTCAAAAAAAAAAAAGTCTATGG + Intronic
1108420059 13:50239774-50239796 CTCAAAAAAAAGTGCTGACAGGG - Intronic
1109041050 13:57337755-57337777 CTCAAATAAGAGAAAGACCATGG - Intergenic
1109237904 13:59847076-59847098 CTCAAAAAAAAGAAAGACAAAGG + Intronic
1109897597 13:68713455-68713477 CTCTAAGAAAAGGAAGGTCAAGG - Intergenic
1109995485 13:70118959-70118981 CTCAAAAATATGTCAAGCCATGG + Intergenic
1110070584 13:71172059-71172081 CTGAAAAAAAAAAAAAGCCAGGG - Intergenic
1110952659 13:81515942-81515964 CTCAAAAAAAAAAAAGGCTAGGG - Intergenic
1111064233 13:83069966-83069988 CTCAAAAGAAAATAATTCCAAGG - Intergenic
1111562214 13:89966563-89966585 TTCAAAAAAAAAAAAGTCCAGGG - Intergenic
1111959122 13:94790324-94790346 TGAAAAAAAAATTAAGGCCAAGG + Intergenic
1112805308 13:103158456-103158478 CTCAAAAAAAACTGAAGCAATGG - Intergenic
1112919779 13:104597874-104597896 CTCAGAAAGAAGGAGGGCCAGGG - Intergenic
1113024727 13:105928299-105928321 CTCAAAACTAAGTAAGGAGAAGG - Intergenic
1113520671 13:110938260-110938282 CTCCAAAAAAAGCAAGGGCCAGG + Intergenic
1114101288 14:19384422-19384444 CTAACAAAAAGGTAGGGCCAAGG + Intergenic
1114398150 14:22385300-22385322 CTAAGAAAAAAGTAGGCCCAAGG + Intergenic
1114454059 14:22844194-22844216 CTCAAAAAAAAAAAAGGCGGGGG + Intronic
1115599097 14:34938510-34938532 CTCAAAGAAAAAAAAGGGCAGGG - Intergenic
1116075085 14:40100885-40100907 CTCAAAAAAAGGAAAGGGAAGGG - Intergenic
1116191244 14:41670932-41670954 CTCAAAGAAAAGTCAGTTCAAGG - Intronic
1116543547 14:46133479-46133501 CTTAAATAAAAGTAAAGACAAGG + Intergenic
1116662183 14:47724568-47724590 CTCCAAAAAAAGAAAGTGCAAGG - Intergenic
1118832164 14:69444188-69444210 CTCAAAAAAAATAAAGACAAAGG + Intronic
1119497207 14:75090131-75090153 TTTAAAAAAAAATAAGGCCAGGG - Intronic
1120014091 14:79450562-79450584 GTCAATTAAAAATAAGGCCAGGG + Intronic
1120062840 14:80004600-80004622 CATCAAATAAAGTAAGGCCATGG - Intergenic
1121110917 14:91312385-91312407 CTCAAAAATAAGTAAGGGTCGGG + Intronic
1121556513 14:94841795-94841817 CTCAATAGAATGAAAGGCCAAGG + Intergenic
1122184314 14:99978399-99978421 CTCAAAAAAAAAAAAAGGCATGG + Intronic
1122622803 14:103069360-103069382 CTCAAAAAAAAATAAAGGCCGGG + Intergenic
1123692715 15:22852466-22852488 CTAAAAAAAAAAAAAAGCCATGG + Intronic
1123763405 15:23450469-23450491 CTCAAAAAAAAGAAAAGACCGGG - Intergenic
1123807924 15:23894521-23894543 CTCAAAAAAAAAAAAGGACTTGG - Intergenic
1123838324 15:24220254-24220276 CTCAAAAAAAAAAAAGGTAAAGG - Intergenic
1123993294 15:25700927-25700949 CTTAAAAAAAAAAAAGGCCCTGG + Intronic
1125207657 15:37173002-37173024 TTAAAAAAAAATTCAGGCCATGG - Intergenic
1126097817 15:45101696-45101718 CTCAGAAAAGAGTAAGACCTGGG + Intronic
1126700808 15:51366015-51366037 TTAAAAATAAAGTAAGGGCAAGG + Intronic
1127371820 15:58348610-58348632 CTCAAAAAGACATAAGGCCTTGG - Intronic
1127451186 15:59118113-59118135 CACAAGACAAAGGAAGGCCAAGG + Intronic
1128503157 15:68243771-68243793 CACAAAAAAAAGGATGGGCATGG + Intronic
1128519436 15:68365734-68365756 CTCAAAAAAAAGAAAAGAAAAGG - Intronic
1128722582 15:69961605-69961627 CTCAAAGAATAGGGAGGCCAAGG - Intergenic
1129803566 15:78436019-78436041 CTCAAAAAAAGATAAGGCCGGGG - Intergenic
1130975758 15:88772904-88772926 CTCAAAAAAAAAAAGGCCCAAGG - Intergenic
1131462955 15:92632514-92632536 CTCAAAATAAAATAAAGACAGGG + Intronic
1132509368 16:330059-330081 CTCAAAAAAAAAAAAGGGCCGGG - Intronic
1132595101 16:745601-745623 CTCAAAAAAAAAAAAAGACAGGG + Intronic
1132633482 16:931118-931140 CTCAAAAAAAAAAAAGGTCTGGG + Intronic
1134089310 16:11383064-11383086 CTCAAAAAAAAAAAAGACCCTGG - Intronic
1134159509 16:11875186-11875208 CTCAAAAAAAGGAAAGGAAAGGG + Intronic
1134417445 16:14056599-14056621 CTCCAAAAAAAGAGAGACCAGGG - Intergenic
1135490224 16:22903042-22903064 CTTAAAAAAAAATAAGTCCCTGG - Intronic
1135768664 16:25199573-25199595 CTCAAAAAAAAAAAAGGCGGGGG + Intergenic
1136255486 16:29036158-29036180 CTCAAAAAAAAAGAAGCCCTCGG - Intergenic
1136309826 16:29400079-29400101 CTCAAAAAAAAAGAAGCCCTCGG + Intronic
1136852206 16:33621109-33621131 CTCAAAAAAAAAAAAGGGCAGGG - Intergenic
1136906802 16:34100329-34100351 CTCAAAAAAAAGAAAGGTTCAGG + Intergenic
1137262120 16:46839620-46839642 CTCAAAAAAAAAAAAAGTCATGG + Intergenic
1137371076 16:47906304-47906326 CTCAAAAAAAAAAAATGCCAAGG - Intergenic
1138014699 16:53417963-53417985 TTAAAAAAAAAAAAAGGCCATGG - Intergenic
1138410936 16:56839750-56839772 CTCACAGAAAAGCCAGGCCAAGG - Intronic
1139623933 16:68169937-68169959 CTCAAAAGAAAGAAAGGAAATGG + Intronic
1139624570 16:68175977-68175999 CTCAAAAAAAAGAAAAGCAAGGG - Intronic
1139831697 16:69803905-69803927 CTCAAAAAAAAATAAAGTAAAGG + Intronic
1140250177 16:73288267-73288289 CTCAAATAAAAATCCGGCCAGGG + Intergenic
1140264080 16:73405370-73405392 AACATAAAAAAGGAAGGCCAGGG + Intergenic
1140303353 16:73779717-73779739 CTCAAAAAAAGGAAAGGCTTGGG - Intergenic
1140365164 16:74375462-74375484 CTCAAAAAAAAAGAAGCCCTCGG - Intergenic
1140438009 16:74964377-74964399 CTCAAAAAAAAAAAAGAGCAGGG + Intronic
1141361043 16:83395311-83395333 CTCAAAAAAAAAAAAAGTCAAGG + Intronic
1141450232 16:84094757-84094779 CTCATAAAAAGGTAAAACCATGG + Intronic
1141526067 16:84612756-84612778 CTCAAAAAAAAGAAAAGCAGTGG + Intronic
1141595722 16:85095754-85095776 CTCAAAAAAAAAAAAAGGCAGGG + Intergenic
1142117778 16:88369076-88369098 CTCAAAAAAAAAAAAAGCCCTGG + Intergenic
1203113802 16_KI270728v1_random:1469580-1469602 CTCAAAAAAAAAAAAGGGTAGGG - Intergenic
1142550432 17:735021-735043 CTCAATAAAAAGAAAGGCGGCGG - Intronic
1142572713 17:885475-885497 CTCAAAAAAAAGAAAAGAAAAGG + Intronic
1142920896 17:3184767-3184789 CTAAAAAAAAAACAAGGCCGGGG - Intergenic
1143378786 17:6482943-6482965 CTCAAAAAAAAAAAAAGACACGG - Intronic
1147734018 17:42623001-42623023 CTCAAAAAAAAAAAATGCCTGGG + Intergenic
1147803740 17:43114072-43114094 CTCAAAAAAAAAAAAAGACAGGG + Intronic
1148043328 17:44725987-44726009 CTCAAAAAAAAGAAAGAAAAAGG - Intronic
1148532897 17:48411839-48411861 CTCAAAAACAAGAAAGGTCTGGG + Intronic
1148577299 17:48720895-48720917 CTGAAAAAATAGAAAGCCCAGGG - Intergenic
1149706020 17:58695770-58695792 CTCAAAAAAAAAAGAGGCCGGGG + Intronic
1149776063 17:59358180-59358202 CTTGAAAACAAGTCAGGCCAGGG - Intronic
1150146704 17:62775121-62775143 AAAAAAAAAAAGGAAGGCCAGGG - Intronic
1150472692 17:65450673-65450695 CTCAAAAAAAAGTAACTTCTTGG - Intergenic
1150747985 17:67831809-67831831 CTCAAAGAGAAGGAAGACCAAGG - Intronic
1151251151 17:72836339-72836361 CTCAAAAAAAAAAAAGCCCGAGG - Intronic
1151614937 17:75203845-75203867 CTCAAAAAAAAAAAAGAACAAGG - Intergenic
1152131706 17:78481101-78481123 CTCAAAAAAAAAAAAAGCCGGGG - Intronic
1152773240 17:82183659-82183681 CCCAAGAAAATGTGAGGCCAGGG + Intronic
1152874823 17:82780622-82780644 CTCAAAAAAAAGGAAGACTTGGG + Intronic
1153403682 18:4710444-4710466 TTAAAAAAAAAGCAAGCCCATGG - Intergenic
1153894925 18:9550019-9550041 CTCACAAACAGGTAAGCCCAGGG + Intronic
1153950064 18:10051095-10051117 ACCAAGAAAAAGTAAGGCAAAGG - Intergenic
1155436048 18:25814119-25814141 CTGCAAAAAAGGTAAGGCAAGGG + Intergenic
1155850130 18:30764043-30764065 CTCTAAGAAAAGGAAGGTCACGG - Intergenic
1156106905 18:33674616-33674638 CTCAAAAAAAAAAAAAGACATGG - Intronic
1156707686 18:39902754-39902776 CCCAAACAAAAGTATGGCAATGG - Intergenic
1157683518 18:49625318-49625340 CTCCAAAGAAAATAAGGTCATGG + Intergenic
1158460984 18:57645498-57645520 CTCAACCAAAAGTAAGGACTGGG - Intergenic
1158666570 18:59438145-59438167 CCCTAAAAACAGAAAGGCCAGGG + Exonic
1158813812 18:61070696-61070718 CTGAAATAATACTAAGGCCAAGG + Intergenic
1159269584 18:66131169-66131191 CTCAAAAATAGGGAAGCCCACGG - Intergenic
1160339961 18:78081043-78081065 CACACAAACCAGTAAGGCCAGGG - Intergenic
1162068354 19:8139051-8139073 CTCAAAAAAAATAAAGGGCCGGG + Intronic
1162075361 19:8183208-8183230 CTTAAAAAAAAAAAAGCCCATGG + Intronic
1162564889 19:11440445-11440467 CTCAAAAAAAAGTGTGGGCCAGG - Intronic
1162634838 19:11959391-11959413 ATCAAAAATAAGTGAGACCAAGG - Intronic
1162816668 19:13199632-13199654 CTCAAAAAAAAAAAAAGTCAGGG - Intergenic
1162981986 19:14246436-14246458 CTCAAAAAAAAAAAAGGCCAGGG + Intergenic
1163256590 19:16159720-16159742 CTCAAAAAAAAAAAAGGCTGGGG + Intergenic
1163271385 19:16256280-16256302 CTCAAAAAAAAAAAAGGCAGGGG - Intergenic
1163278826 19:16302629-16302651 TTAAAAAAAAAGTAATGGCAAGG + Intergenic
1163597577 19:18229241-18229263 GTCTCAAAAAAGTAAGGCCAGGG - Intronic
1163703308 19:18797981-18798003 CTCAAGAAAAAGAAAGGCCCAGG + Intergenic
1163703326 19:18798061-18798083 CTCAAGAAAAGGAAAGGCCCAGG + Intergenic
1164073026 19:21786601-21786623 ATTAAAACAATGTAAGGCCAGGG + Intergenic
1164107674 19:22123240-22123262 CTCAGAAAAAAGTAGGTCAAAGG - Intergenic
1164625066 19:29722363-29722385 CTCAAAAAAAATTAATACCAGGG - Intergenic
1164922111 19:32095979-32096001 CTCAAATAAAAGAAAGGTGAGGG + Intergenic
1166370565 19:42298194-42298216 CTCAAAAAATAAATAGGCCAAGG + Intronic
1166718065 19:44981614-44981636 ATAATAAAAAGGTAAGGCCAGGG + Intronic
1166834888 19:45661289-45661311 CTCAAAAGAAAAGAAGGGCAGGG - Intergenic
1166889981 19:45985263-45985285 CTTAAAAAAAAGAAAGGGCTGGG - Intergenic
1167496369 19:49821280-49821302 CTCAAAAACAAGAGAGGCCTGGG - Intronic
1168269810 19:55243413-55243435 AAAAAAAAAAAGAAAGGCCAAGG + Intronic
925322869 2:2990375-2990397 GTAAAAGAAAAGTGAGGCCAGGG + Intergenic
926536617 2:14121135-14121157 CTGAAAAAAAAGAAAGACAAAGG - Intergenic
927622962 2:24681703-24681725 CAAAAAAAAAAAAAAGGCCAGGG - Intronic
927675201 2:25100491-25100513 CTCAAAAAAAAGAAAATACAGGG - Intronic
927853829 2:26515931-26515953 CTCAAGAGGAAGAAAGGCCAGGG + Intronic
928964085 2:36959827-36959849 CTCAAAAAATACTAATGCTAGGG + Intronic
929155491 2:38785126-38785148 CTTAAAAAAAACTAAGTGCATGG - Intergenic
929371972 2:41236448-41236470 CTCAAAAAAAAGAAAGAAAATGG + Intergenic
929719271 2:44350959-44350981 CTCAAACAAAAAAAAAGCCAGGG - Intronic
931430500 2:62205405-62205427 CTCAAAAAAAAGTAACACTTTGG - Intronic
931740926 2:65243274-65243296 CTCAAAAAAAAGAAAAGAAAAGG + Intronic
932067371 2:68579964-68579986 GTCACAAAAAAGTAATGCAAAGG + Exonic
932525102 2:72457377-72457399 CCTAAGAGAAAGTAAGGCCAGGG + Intronic
933368914 2:81390443-81390465 ATCAAGAAAAAGTAAGGTGAGGG + Intergenic
933595481 2:84278780-84278802 CCCAAAAATAGATAAGGCCAGGG + Intergenic
933775120 2:85767025-85767047 CCCAAAAAAAGGGAAGGACAAGG - Intronic
933794909 2:85911817-85911839 CTCAAAAAAAAGGCCGGGCACGG - Intergenic
934483183 2:94672888-94672910 CTCAAAAAAAAAAAAACCCATGG + Intergenic
934638151 2:96009769-96009791 CTCAAATAGAAGTCGGGCCATGG + Intergenic
934795500 2:97095641-97095663 CTCAAATAGAAGTCGGGCCATGG - Intergenic
935663085 2:105486698-105486720 CTCATAAAATAGGAAGTCCATGG + Intergenic
936113579 2:109684532-109684554 CTCAAAAAAAAAAAAAGCCCGGG - Intergenic
936771967 2:115924386-115924408 CTCAAAAAAAAAAAAAGACATGG - Intergenic
937440569 2:121912022-121912044 CTGAAAAAAAAATAAGGTAATGG - Intergenic
937448550 2:121979852-121979874 ATCAAAAAAAAGTAGGGGTAGGG - Intergenic
937583333 2:123515715-123515737 CTCAAATAAAAGTGTTGCCAGGG - Intergenic
938247841 2:129792667-129792689 CTCCAAAAAAAACGAGGCCATGG - Intergenic
938637073 2:133239954-133239976 TTGAAAAAAAAATAAGGCCAGGG - Intronic
938783459 2:134605685-134605707 CTCAAAAAAAGGAAAGGCAAGGG + Intronic
939018070 2:136924619-136924641 CTTGAAAAAAAATAAGGCCAAGG - Intronic
939550530 2:143609890-143609912 CTCAAAAGAAAGTGAGATCAAGG + Intronic
939628711 2:144510041-144510063 CTGAAAAAAAAGTATGGAGAAGG + Intronic
939715317 2:145576758-145576780 AACAAAAAAGAATAAGGCCAAGG + Intergenic
940876518 2:158903069-158903091 CTCAACAACAAGTAAGGCCCTGG - Intergenic
941164657 2:162072627-162072649 TTAAAAGGAAAGTAAGGCCAGGG + Intronic
941775201 2:169385952-169385974 AAAAAAAAAAAGAAAGGCCAAGG + Intergenic
942073773 2:172338463-172338485 CTAAAATAAAGGTAAGGCAAGGG + Intergenic
943161015 2:184251471-184251493 AGCAAAAACAGGTAAGGCCATGG - Intergenic
943484223 2:188458920-188458942 CTCACAAATAAGTAAGATCATGG + Intronic
944595627 2:201258213-201258235 CTCAACAGGAAGTGAGGCCATGG + Exonic
944625026 2:201561871-201561893 CTCAAAAAAAAGGAAAGAAAAGG + Intronic
945069459 2:205976452-205976474 ATCAAAAACAAGAAGGGCCATGG + Intergenic
945913997 2:215683321-215683343 CTCTAAAAAAAGGAAGACAAAGG - Intergenic
946118919 2:217491757-217491779 ATTAAAAAAAAATAAGGCAAGGG - Intronic
946235190 2:218320207-218320229 AGCAAAAAAGAGTAGGGCCAAGG - Intronic
946567135 2:220979145-220979167 CTCAAAAGATAAAAAGGCCACGG - Intergenic
947966601 2:234287418-234287440 TTAAAACAAAAGTAAGGCCCAGG + Intergenic
1169219954 20:3816354-3816376 CTCTAAATAAAGGAGGGCCAGGG + Intergenic
1169393146 20:5206442-5206464 CTCAAAAAAAAAAAAGGAAAAGG - Intergenic
1169617384 20:7464086-7464108 CTCAAAAAAATGTAGAGCTATGG + Intergenic
1170356470 20:15497291-15497313 CTCAAAAAAAAAGAAGGAGAAGG - Intronic
1172500630 20:35424078-35424100 CTCAAAAAAAAGTAAAAATATGG + Intergenic
1173589785 20:44215758-44215780 CTCAAAAAAAAGAAAAGAAAAGG - Intergenic
1173807020 20:45932876-45932898 CTCAAAAAAAAGTACTGCTTTGG - Intergenic
1173894474 20:46540125-46540147 AACAATAAAAAGTAGGGCCATGG + Intergenic
1174229702 20:49035673-49035695 CTGAAAAAGAAATAAGGCCTTGG - Exonic
1174230791 20:49044328-49044350 CTCAAAAAAAAAAAAAGCCCCGG - Intergenic
1174602473 20:51735978-51736000 TTCCAAAGAAAATAAGGCCAGGG + Intronic
1174665754 20:52256274-52256296 CTCAAAAAAAAAAAATGCTAAGG + Intergenic
1175111657 20:56652770-56652792 CTCAAAAAAAAAAAAGGGCCAGG - Intergenic
1175140020 20:56854060-56854082 CTCAAAAAAAAGAAAAGAAAAGG + Intergenic
1175235099 20:57504277-57504299 CTCAAAAAAAAAAAAGGAGACGG - Intronic
1176661992 21:9645699-9645721 CTCAAAAATTAGTTGGGCCATGG - Intergenic
1176870222 21:14078183-14078205 CTAAAAAAATAGTAAGGCCCAGG + Intergenic
1177945095 21:27457672-27457694 AAAAAAAAAAAATAAGGCCAGGG + Intergenic
1178562685 21:33653820-33653842 CTCAAAAAAAAGAAAGACATTGG - Intronic
1178569331 21:33720555-33720577 CTTAAAAAAAAAGAAGGGCAGGG - Intronic
1178593740 21:33934092-33934114 TTAAAAATAAAATAAGGCCAGGG - Intergenic
1178867854 21:36345246-36345268 CTCAAAAAAAAGGAAGGGAAAGG - Intronic
1179094711 21:38302625-38302647 ATCAACAAAAAATAATGCCACGG + Exonic
1179242822 21:39607066-39607088 TTAAAAAAAAAAAAAGGCCAGGG - Intronic
1179515109 21:41900799-41900821 GTCAAAAAAAAGTAAGGGCCGGG + Intronic
1180479450 22:15738169-15738191 CTAACAAAAAGGTAGGGCCAAGG - Intergenic
1180795779 22:18604368-18604390 CTCAAAAAAAGGAAAGGTCCAGG + Intergenic
1181225947 22:21390904-21390926 CTCAAAAAAAGGAAAGGTCCGGG - Intergenic
1181252687 22:21543908-21543930 CTCAAAAAAAGGAAAGGTCCGGG + Intergenic
1181269043 22:21648164-21648186 CTCAAAAAAAAAAAAAGCCTTGG + Intergenic
1181531521 22:23520195-23520217 CTCAAAAAAAAGAAAGACTTAGG - Intergenic
1181565127 22:23731891-23731913 AAAAAAAAAAATTAAGGCCAAGG + Intergenic
1181665557 22:24393639-24393661 ATTAAAAAAAAGGAAGCCCAAGG - Intronic
1182258593 22:29056099-29056121 CTCAAAAAAAAAAAAGGCAATGG - Exonic
1182406928 22:30142284-30142306 CTCAAAAAAAAGTAAATATATGG + Intronic
1182641981 22:31775476-31775498 CTCATAAAAAAGGAAGACAAAGG - Intronic
1182643513 22:31788571-31788593 CTCAAAAAAAAATATGGGCTAGG - Intronic
1182684520 22:32111310-32111332 CACAGACAAAAGGAAGGCCACGG - Exonic
1182708340 22:32304129-32304151 CTCAAAAAAAAGAAAGGAAAAGG - Intergenic
1183473348 22:38021474-38021496 CTCAAAAAAGAAAAAGGTCAGGG - Intronic
1183495527 22:38141353-38141375 CTCAAAAAAAAGAAAGTGCTAGG + Intronic
1184205685 22:43001038-43001060 CTCAAATAAAACTTAGGCCAAGG + Intronic
1184704434 22:46200921-46200943 CTCAAAAAAAAGTTGGGGCGTGG + Intronic
1184751437 22:46488658-46488680 CTCAAAAAAAAAAAAGGGCAGGG - Intronic
949881645 3:8665726-8665748 CTCAAAACAAAGCAAGGCTGTGG + Intronic
951703158 3:25516625-25516647 CTCAAAAAAAAAAAAAGACAAGG - Intronic
951904986 3:27696825-27696847 CTCAAAAGAAAAAAAGGGCAGGG - Intergenic
952307256 3:32157244-32157266 CTCAAAAAAAAAAAAGGCAGAGG - Intronic
952379359 3:32792530-32792552 CTAAAAAAAAAAAAAAGCCAGGG + Intergenic
952396256 3:32922998-32923020 CTCAAAAGAAAATAGGGACATGG + Intergenic
952502342 3:33975446-33975468 CTTAAAAAAAAATAAGGATAAGG + Intergenic
953931215 3:47006745-47006767 CTAAAAAAAAAGTCAGGCCTGGG - Intronic
954176488 3:48849332-48849354 CTCAAAAAAAAATAGGGGCCTGG - Intergenic
954206511 3:49062997-49063019 CTCAAAAAAAAAAAAGGCTCAGG + Intronic
954206921 3:49066284-49066306 CTCAGAAAAAAATAAGGGTAAGG + Intronic
954262352 3:49448692-49448714 CTCAAAAAAAAAAAAGGGCCAGG - Intergenic
954469922 3:50684478-50684500 CTCAAGAAAGAGAAAGGCCAAGG - Intronic
955043842 3:55341347-55341369 GTCAATAAAAAGCAAGGCCCTGG + Intergenic
955600575 3:60641178-60641200 CTCAAAAAAAAGAAAAGAAAAGG + Intronic
956414396 3:69012391-69012413 GTCAAAAAATAGGAAGGCCTGGG - Intronic
959717301 3:109446858-109446880 CTCAAAAAAAAGAAAGAGAAAGG - Intergenic
959810146 3:110608449-110608471 CTCCCAAAAAAGAAAAGCCATGG + Intergenic
959924282 3:111904275-111904297 CTCAAAAAAAAAAAAGGCCAAGG + Intronic
960196950 3:114780487-114780509 CTCAAAAAAAAGAAAAGAGAAGG - Intronic
961883228 3:130077823-130077845 CTCAAAAAAAAAAAAGTGCACGG + Intergenic
962228308 3:133635252-133635274 CTCAAAAAGAAATAAGTACAAGG - Intronic
963155656 3:142093448-142093470 CTCAAAAAAAAAAAAGGTGAGGG + Intronic
963610785 3:147465475-147465497 ATCAAGAAAAAGGGAGGCCAAGG + Intronic
963894810 3:150673893-150673915 TTCAAAAAAAAGAAAGCTCAAGG - Intronic
964249459 3:154694825-154694847 CTCAACACAAAGCAAGGCAAGGG - Intergenic
964430066 3:156596086-156596108 CTGAATAAAAAGAAAAGCCAGGG - Intergenic
965618111 3:170615290-170615312 AACAAAAAAAAGTAAGGTTAGGG - Intronic
965762762 3:172097186-172097208 ATCTAAAAAAAGTAAGGCTGTGG + Intronic
965797327 3:172454064-172454086 CTCAAAATAAAGGAATGCAAAGG - Intergenic
966630190 3:182064335-182064357 CTAAAAAAAAACTCAGGCCAAGG - Intergenic
966794801 3:183702831-183702853 CTCAAAAAAAAAAAAGGGAATGG + Intronic
967415138 3:189208448-189208470 CTCATAAAAAATTGGGGCCAGGG + Intronic
967929263 3:194678907-194678929 CTAAAAAACAAGGAACGCCAAGG + Intergenic
968532727 4:1102849-1102871 CTCAAAAAAAAGGCCGGGCACGG + Intronic
970598519 4:17621856-17621878 CTGAACAAGAAGTAAAGCCAAGG + Intronic
971335961 4:25724418-25724440 CTCAAAGAAAAGAAAAGACAAGG + Intergenic
972393855 4:38640295-38640317 ATCAAAAAAAATTAAGGTCTAGG - Intergenic
972472497 4:39420523-39420545 CTCAAAAAAAAAGAAGTCAAGGG - Intronic
972645478 4:40964045-40964067 CTTAACAAAAAGAAAGCCCATGG - Intronic
972701551 4:41498868-41498890 TTAAAAAAAAAAAAAGGCCAAGG - Intronic
974013354 4:56627004-56627026 CTCACAAAAAAGAAAGTCAATGG - Intergenic
974057733 4:57001168-57001190 CTCCAAAAAAAATAAGGCCAAGG - Intronic
975933206 4:79552379-79552401 CTCAAAGAAAAGGGAGGTCAAGG - Intergenic
976400916 4:84606678-84606700 TTAAAAAAAAAGTAAGGGAAGGG - Intronic
978272757 4:106910755-106910777 ATCTAACAAAAGTAAGGCAAAGG + Intergenic
978367142 4:107994303-107994325 TTAAAAACAAAGTAAGGGCAGGG + Intronic
978870079 4:113565358-113565380 GTCAAAAAAAAGGCTGGCCATGG + Intronic
979142075 4:117189845-117189867 TTCAGAAAATAGTAAGGACAGGG + Intergenic
980187503 4:129480544-129480566 CTCAAAAAATATTAAGACTATGG - Intergenic
980930692 4:139179561-139179583 CTCAAAAAAAAGCAAGTCCGAGG + Intergenic
981989843 4:150904674-150904696 CTCAAAAAGAAGTAAGACTGAGG + Intronic
982059915 4:151594575-151594597 CTCAAAAAAAAAAAAGACAAAGG - Intronic
983141099 4:164150597-164150619 CTCAAAAAGAACCAAGGTCAAGG - Intronic
983558997 4:169082793-169082815 CTAAAAAAAAAAAAAGGCCGAGG - Intergenic
983606030 4:169585186-169585208 CTGAAGAAAAAGAAAGACCATGG + Intronic
984591616 4:181623971-181623993 CTCAAAAAGGAGCAAGGACAAGG - Intergenic
985413403 4:189710847-189710869 CTCAAAAATTAGTTGGGCCATGG + Intergenic
986376942 5:7141955-7141977 CTCTGAGAAAAGAAAGGCCAGGG + Intergenic
986536720 5:8795598-8795620 CAGAAAAAAAAGTAAGTCAAAGG + Intergenic
986723264 5:10575700-10575722 TTAAAAATAAAGGAAGGCCAGGG + Intronic
987277334 5:16375631-16375653 CTCAGAATAAAGCAATGCCAAGG - Intergenic
988997464 5:36727891-36727913 CTCAAAAAAAAAAAAAGTCAGGG + Intergenic
989288989 5:39739650-39739672 CTAAAAATAAAGGAAGGCCTAGG + Intergenic
989297631 5:39848363-39848385 CTAAGAATAAAGTATGGCCAAGG - Intergenic
989510574 5:42282588-42282610 ATCAAAATAAAGTAATACCATGG + Intergenic
990558081 5:56954977-56954999 CCAAAGAAAAAGTAAGGACAAGG + Intronic
991556515 5:67901000-67901022 CTCAAAATGAGGTTAGGCCAAGG + Intergenic
992251655 5:74882294-74882316 CTCAAAAAAAAAAAAAGACAGGG + Intergenic
993687982 5:90964185-90964207 CCCAAAAATAAATAAGACCATGG - Intronic
993983889 5:94574096-94574118 CCCAAGAAAAAGGAAGGCAAAGG + Intronic
993991718 5:94665752-94665774 CAAAAAAGAAAGTTAGGCCAGGG + Intronic
994538929 5:101069729-101069751 TTCAAAAAGATGTAGGGCCAAGG - Intergenic
995095849 5:108234878-108234900 AAGAAAAAAAAGTAAGGACAGGG + Intronic
996009514 5:118466002-118466024 TTAAAAAAAAAGTAAGGGAAGGG + Intergenic
996380143 5:122855070-122855092 CTCAAAAAAAAAAAAGGAAAAGG - Intronic
997109641 5:131060721-131060743 CTCTATAAAAAATAAGGCCGAGG + Intergenic
997511321 5:134456584-134456606 CTCAAAAAAAAAAAAAGACATGG + Intergenic
998339196 5:141401340-141401362 CTCAAAAAAAAGGAAGGAGAAGG + Intronic
998452100 5:142242678-142242700 CTCAAAAAAAAAAAAGGACTTGG - Intergenic
999144566 5:149383712-149383734 CTCAAAAAAGGGAAAGGCCTGGG + Intronic
999514008 5:152282316-152282338 CTCAAAAAAGAGAAAAGTCAAGG - Intergenic
1000125135 5:158236647-158236669 TGCAAAAAAAAATAAGGACAGGG - Intergenic
1000587284 5:163116007-163116029 CTCCAAGAAAAGTAAAGCCCAGG - Intergenic
1000645040 5:163750921-163750943 ATCAAGAAGAACTAAGGCCAAGG - Intergenic
1000928679 5:167225792-167225814 CTCTAAACAAAGAAAAGCCAAGG - Intergenic
1002179332 5:177422309-177422331 CTCAAAAAAAAGGAAGGGTCTGG - Intronic
1002617118 5:180462855-180462877 CTCAAAAAAAATCCTGGCCAGGG - Intergenic
1002681220 5:180966625-180966647 CTCAAAGAAAAGAACAGCCAAGG + Intergenic
1002850988 6:996210-996232 CTAAAAAGAAAGTGAAGCCATGG + Intergenic
1003794610 6:9586936-9586958 CTCAAAAATAAGTCAGAGCATGG - Intergenic
1003833058 6:10036079-10036101 CTCAAAAAAAAAAAGGGCTAAGG + Intronic
1003842515 6:10136706-10136728 AAAAAAAAAAAGAAAGGCCAGGG + Intronic
1004359202 6:14956064-14956086 AACAAAAAAAAGAAAGGCCAAGG - Intergenic
1004621324 6:17333145-17333167 CTCAAAAAAAAGAAGAGTCAAGG - Intergenic
1005692155 6:28317690-28317712 CTCCAAAAAAAATAAGACCCAGG + Intergenic
1006534585 6:34688097-34688119 ATAAAAAAAGAGTGAGGCCAGGG + Intronic
1006613139 6:35307396-35307418 CTCAAAAAAAGATAAGGACACGG + Intronic
1006871889 6:37258483-37258505 CTCAAGATAAAGTAAGGTCAGGG - Intronic
1006889199 6:37410238-37410260 CTCAAAAAAAATTAACGACCGGG + Intergenic
1006961392 6:37934181-37934203 CTCAAAAAAAAAAAAGGGCCGGG - Intronic
1010017214 6:71119326-71119348 CTCACATAAACGTAAGGCAAAGG - Intergenic
1010138073 6:72578275-72578297 CTCAAAAAAAAGAAAGAAAAAGG + Intergenic
1010333564 6:74654040-74654062 CTCAAAAAAAAGAAGGGTTATGG + Intergenic
1010393069 6:75359001-75359023 CTCAAAAATAAATAAGGGCTGGG - Intronic
1010456917 6:76066899-76066921 CTCAAAACAATGTAAGTACATGG + Intronic
1011211194 6:84958427-84958449 CTCCAAAAACAGCAAGGCCCTGG - Intergenic
1011502228 6:88003404-88003426 CTCATATAAAAATAAGACCATGG + Intergenic
1012417874 6:99029374-99029396 CTCAAACATAAGTATGGCAATGG + Intergenic
1013005353 6:106068089-106068111 CTCAAAAAAAAAAAAGAACAGGG - Intergenic
1014796490 6:125731171-125731193 TTCAAAAAAAAATAATGCAAAGG - Intergenic
1015842024 6:137487466-137487488 CTCCAAAAGAAGTAATGCCAAGG + Intergenic
1016487451 6:144557301-144557323 CTCAAACAAAGGTAAGTCTAAGG + Exonic
1016750659 6:147627802-147627824 CTCAAAAAAAAGGAAGCCAGTGG + Intronic
1017212657 6:151874257-151874279 CTGAAAAAAAATTAAAGTCAAGG - Intronic
1017349160 6:153419250-153419272 CTCAAAAAAAAGAAAGGTAAAGG + Intergenic
1017562314 6:155641973-155641995 CTCAAAAAAAAAAAAGGAAAAGG - Intergenic
1019554793 7:1623880-1623902 CTCAGAAAAAAGAAAAGCTAGGG + Intergenic
1020250010 7:6460032-6460054 CTCAAAAAAAAGAAAGAGCCAGG - Intronic
1020340653 7:7106087-7106109 CTCAAAAAAAAAAAAAGACAAGG - Intergenic
1020457899 7:8395032-8395054 CACAACAAAAAGAAGGGCCAGGG - Intergenic
1022139860 7:27484151-27484173 CTCAAAAAAAAGACAGCACATGG - Intergenic
1023132312 7:37015149-37015171 CTCCAGATAAAGTAAGGGCATGG + Intronic
1023994279 7:45149581-45149603 TTCAATAAAAAGTAAAGTCATGG - Intergenic
1024001835 7:45194914-45194936 CTCAGAAAACAGTAAGGCCCAGG - Intergenic
1024266377 7:47609993-47610015 CTCAAAAAAAAAAAAGGCCCTGG + Intergenic
1024384559 7:48736939-48736961 AACAAAAAAAACTAAGGCCCAGG + Intergenic
1024387950 7:48774951-48774973 CAAAAAAAAAAGTAAGGATATGG - Intergenic
1025789624 7:64677169-64677191 CTCAAAAAAAAAAAAATCCATGG - Intronic
1026036106 7:66831692-66831714 CTCAAAAAAAAGAAATGGCCAGG - Intergenic
1028052950 7:86207813-86207835 CTCAAACAAAACTCAGGCAAAGG - Intergenic
1029487073 7:100849871-100849893 CTCAAAAAAAAAAAAGGGAAGGG - Intronic
1030742720 7:113128747-113128769 CCCCAAGAAAAGTAAGGCCCTGG + Intergenic
1031432663 7:121691775-121691797 CTTAAAAAAAAATAAGTCAAAGG - Intergenic
1032130293 7:129222502-129222524 CTCAAAAAAAAAGAAGGAGAAGG - Intergenic
1032158941 7:129495375-129495397 CTCAAAAAAAAAAGAGGACACGG + Intergenic
1033047040 7:137971676-137971698 TACAAAAAAAAAAAAGGCCAGGG + Intronic
1033266703 7:139893181-139893203 CTGAAAAGACAGTGAGGCCAGGG - Intronic
1033477639 7:141706088-141706110 CCAAAAAAATAGTGAGGCCATGG + Intergenic
1034653863 7:152713065-152713087 CTCAAAAAAAAATAAAGAAAAGG - Intergenic
1034705028 7:153134000-153134022 CTCGAAAAAAAGTATGGGAATGG - Intergenic
1035194903 7:157209779-157209801 ACCAAAACAAAATAAGGCCAGGG - Intronic
1035418804 7:158710149-158710171 CTAAAAAAAAAGAATGCCCAGGG - Intergenic
1036004295 8:4644406-4644428 CTCAAAAAAAAATAGGGCAAAGG - Intronic
1036065407 8:5375519-5375541 CTCAACGAAAAGTTAAGCCATGG + Intergenic
1037377618 8:18249073-18249095 TTTAAAAAATAATAAGGCCAGGG + Intergenic
1037412589 8:18614189-18614211 CCCAAAGAAAAGTAAAGTCAAGG - Intronic
1038149144 8:24927316-24927338 CATATGAAAAAGTAAGGCCAAGG + Intergenic
1038157385 8:25002582-25002604 CTCATAAAAGAGTATGGGCATGG + Intergenic
1039110508 8:34036370-34036392 AAAAAAAAAAAGGAAGGCCAGGG - Intergenic
1040074579 8:43216164-43216186 ATGAAAAAAAAGAAAAGCCATGG - Intergenic
1040502743 8:48019524-48019546 CTCAAAAAAACGGCAGGGCATGG + Intronic
1040823526 8:51591617-51591639 CTCAAAAAAAAAAAATGCTAAGG - Intronic
1041019649 8:53625962-53625984 CTCAACAATTTGTAAGGCCAAGG + Intergenic
1041447219 8:57965520-57965542 TAAAAAAAAAAGTCAGGCCAGGG + Intergenic
1041872855 8:62654865-62654887 CTCAAATAAGAGAGAGGCCATGG + Intronic
1042837199 8:73089872-73089894 CTCAAAAAAAAGTAGGGGCAGGG - Intronic
1043023708 8:75040004-75040026 CTCAAAAAAAAGTAAGTGGATGG - Intergenic
1043072134 8:75651507-75651529 CTCAAAAAAAAATAAGGCAATGG + Intergenic
1043320901 8:78985142-78985164 TTCAAAAAAAATTAAGAGCAGGG + Intergenic
1043690179 8:83141302-83141324 CTCTAAAAAAAGAAAGGTCAGGG + Intergenic
1043707876 8:83376712-83376734 CTCAAAAAGAAGTACAGCAATGG - Intergenic
1044059101 8:87611971-87611993 TTAAAAAAAAAATAAGACCAGGG - Intronic
1046965811 8:120164236-120164258 CTCAAAAAATAATAAGGCAAAGG - Intronic
1048369388 8:133764352-133764374 CACAAAGAAAAGAAAGGCCAGGG - Intergenic
1048470506 8:134700341-134700363 CTCAGCAAGAAGCAAGGCCAAGG + Intronic
1049088219 8:140494230-140494252 GTCAAGAGCAAGTAAGGCCAAGG + Intergenic
1050454180 9:5817186-5817208 CTCAAAAAAAAGGCTGGGCACGG - Intronic
1051345412 9:16146856-16146878 CACAAAAGGAAGTAAGGTCATGG - Intergenic
1051407865 9:16758338-16758360 CTAAAAAAAAAGGAAAGACAAGG - Intronic
1052191350 9:25666653-25666675 TACAGAAAAACGTAAGGCCAAGG + Intergenic
1053205885 9:36186333-36186355 CTCAAAAAAAAAAAAGGAAAGGG - Intergenic
1053213105 9:36248312-36248334 CTCAAAAAAAAAAAAAGCAAAGG - Intronic
1053466941 9:38315713-38315735 CTAAAAAAACAGAATGGCCAGGG - Intergenic
1055364581 9:75528798-75528820 CTCAAAAAAAAGAAAAGGCTGGG - Intergenic
1055453908 9:76455570-76455592 TTAAAAAAAAAGTAAGGGGATGG - Intronic
1056642718 9:88385256-88385278 CTCTAAAAAAAGTCAAGCTAGGG - Intergenic
1057194584 9:93109992-93110014 CTCGAAAAAAAGAAAGCACAGGG - Intronic
1057293160 9:93819911-93819933 CTCTACATAAAGTCAGGCCATGG - Intergenic
1057882062 9:98799921-98799943 CTCAAAAAAAAAAAAGTCCTGGG - Intergenic
1058075824 9:100649793-100649815 CTTAAAAAAAAGTTAGGGAATGG + Intergenic
1058468562 9:105253723-105253745 CTCAAAAAAAAATAAAGACAGGG - Intronic
1058621683 9:106889603-106889625 GTAAAAAACAAGTAAGCCCACGG - Intronic
1058630310 9:106979530-106979552 GTCAAAAGAAAAAAAGGCCAAGG - Intronic
1059698982 9:116757067-116757089 CTCAAAAAAAGGGAAGGAGAGGG - Intronic
1059874664 9:118620944-118620966 CTCATTAAAAACAAAGGCCATGG - Intergenic
1060201864 9:121656006-121656028 CTCAAAAAAAAAAAAAGCCAGGG - Intronic
1060490604 9:124081391-124081413 CTAAAAAAAAAAAAAGGACAAGG + Intergenic
1060650741 9:125324587-125324609 CTCAAAAAAAAGAAAGTATAGGG + Intronic
1061810498 9:133159993-133160015 AAAAAAAAAAATTAAGGCCAGGG + Intronic
1061864068 9:133483293-133483315 CTCAAAAAAAAAAAAGGAAAAGG + Intergenic
1062646047 9:137548745-137548767 CTCAAAAAAAAGAAAACTCAGGG + Intronic
1062708448 9:137958076-137958098 CTCAAAATGAAGCAAGGCCCAGG - Intronic
1203639553 Un_KI270750v1:147542-147564 CTCAAAAATTAGTTGGGCCATGG - Intergenic
1185680204 X:1882332-1882354 CTCAAAAAAAAAAAAGGTAAAGG - Intergenic
1186692951 X:11998591-11998613 CAGAAAAGACAGTAAGGCCATGG - Intergenic
1186711520 X:12202848-12202870 CTCCAAGAAAAGGAATGCCAAGG + Intronic
1187353117 X:18540687-18540709 CTCAAAAAAAAAGAAGGGAAGGG - Intronic
1187474992 X:19602727-19602749 CTAAATAAAAATTAGGGCCAGGG + Intronic
1188181025 X:27056228-27056250 CTCAAAAAAAAGAAAAGGAAAGG - Intergenic
1188302578 X:28523878-28523900 CTCAACAAAAAGTTAGACCAGGG + Intergenic
1188346625 X:29074384-29074406 CTTAAAAATGAGTTAGGCCATGG - Intronic
1188418820 X:29971779-29971801 CTCAAAAAAAAGAAAAGAAAAGG + Intergenic
1188459904 X:30412473-30412495 TTGAAATAAAATTAAGGCCACGG - Intergenic
1189408833 X:40751301-40751323 CTCAAAAAAAAGGAATCCAAAGG - Intergenic
1189993637 X:46618172-46618194 CTGACAAAAAAGAAAGTCCAGGG + Intronic
1190028914 X:46952988-46953010 CTCAAAAAAAAAAAAAGCAATGG + Intronic
1190230970 X:48581599-48581621 CTCAAAAATAAGCATGGCCTTGG + Intergenic
1190834756 X:54090229-54090251 CTCAAAAAAAAAGAAGGGCAAGG - Intronic
1192140855 X:68646519-68646541 CTGAAACAGAAGTGAGGCCAGGG + Intergenic
1192936627 X:75866175-75866197 CTCAAAAAAAAAAAAAGCCAAGG - Intergenic
1193453226 X:81697112-81697134 TTAAAAAAAAAGTCAAGCCAAGG + Intergenic
1194555841 X:95357894-95357916 CTCTCAAAAATGTAAGGTCAGGG + Intergenic
1194728405 X:97426283-97426305 CTCAAAAAAAAAAAAAGGCAGGG - Intronic
1195335410 X:103848688-103848710 CTCAAAAAAAAAAAATGCAATGG - Intergenic
1195907910 X:109863660-109863682 CTGAAAACAAAGTTAGGTCAAGG + Intergenic
1195950577 X:110268017-110268039 CTCCAAAACAAGCAAGGGCATGG + Intronic
1196063994 X:111442657-111442679 AGCAAACAAAAATAAGGCCATGG + Intergenic
1197382045 X:125756741-125756763 CTCAAAAGATAGCAAGGGCACGG + Intergenic
1197840028 X:130736356-130736378 CTCAAAAAAAAAAAATGCTATGG + Intronic
1198182967 X:134227374-134227396 CTCAAGAAGAAGTAATGCCAGGG - Intergenic
1198448240 X:136739957-136739979 CTCAATAAAAGAAAAGGCCAAGG - Intronic
1198661876 X:138978261-138978283 CTCAAAAAAAAAAAAAACCAGGG - Intronic
1198771406 X:140134632-140134654 TTCAAAAAATAGAAAAGCCAGGG - Intergenic
1199033143 X:143024731-143024753 CTCAAAAAATATTAAGGCTTAGG - Intergenic
1201053175 Y:9961539-9961561 AAAAAAAAAAAGTAAGGACAAGG + Intergenic
1201512741 Y:14783273-14783295 CTCAAACAATAGAAAAGCCATGG - Intronic
1202063969 Y:20917916-20917938 TTTAAAAAAAGGTAAGGGCATGG - Intergenic