ID: 1104004129

View in Genome Browser
Species Human (GRCh38)
Location 12:124880257-124880279
Sequence GCTGGAGCCCACAGAGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 518
Summary {0: 1, 1: 0, 2: 6, 3: 77, 4: 434}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104004119_1104004129 28 Left 1104004119 12:124880206-124880228 CCTGAGGGGGAACTGTTCTTAGG 0: 1
1: 0
2: 1
3: 12
4: 81
Right 1104004129 12:124880257-124880279 GCTGGAGCCCACAGAGAAGCTGG 0: 1
1: 0
2: 6
3: 77
4: 434
1104004126_1104004129 -2 Left 1104004126 12:124880236-124880258 CCGAGGCGTCTGCCAGGGATGGC 0: 1
1: 0
2: 0
3: 14
4: 148
Right 1104004129 12:124880257-124880279 GCTGGAGCCCACAGAGAAGCTGG 0: 1
1: 0
2: 6
3: 77
4: 434

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104004129 Original CRISPR GCTGGAGCCCACAGAGAAGC TGG Intronic
900164666 1:1239907-1239929 GGTGGAGGTCACGGAGAAGCCGG + Intergenic
900315327 1:2053456-2053478 GCTGAGGCCAACAGAGACGCAGG + Intronic
900525364 1:3125853-3125875 GCTGGGGCCCACAAAGGAGCCGG - Intronic
900975700 1:6014922-6014944 GCTCCAGCCCCCAGAGGAGCAGG + Intronic
901201559 1:7470126-7470148 GCTGGAGGACACAGAGGAGAGGG - Intronic
901711869 1:11122126-11122148 GCTGGCGCCCACAGAAAAGCAGG + Exonic
901836384 1:11926394-11926416 GCTGGAGGCCACCGAGAAGAAGG - Exonic
902329355 1:15723623-15723645 GCCTCAGCCCACAGAGTAGCTGG - Intronic
902682019 1:18050308-18050330 TCCCGAGCCCACAGAGGAGCAGG + Intergenic
902688856 1:18097013-18097035 GCTGGAGCCCACATACCTGCAGG - Intergenic
902692896 1:18121293-18121315 GCTGGAGCTCAGGGAGTAGCTGG + Intronic
904248758 1:29207232-29207254 GCTGCAGCCCCCTGAGTAGCTGG + Intronic
904598021 1:31658847-31658869 AATGGAGCCCACAGTCAAGCAGG + Intronic
904949628 1:34226076-34226098 GCTGCTGCCCAAAGAGAAGAGGG + Intergenic
905078952 1:35299907-35299929 GCCGCAGCCTACAGAGTAGCTGG + Intronic
905259143 1:36705382-36705404 CCTGGAGCCCCCAGAGGAGGAGG + Intergenic
905695385 1:39969723-39969745 GCAGGAGGCCACAGAGCAGCCGG - Exonic
906237625 1:44221419-44221441 GCATGAGCCCACAGGGCAGCTGG + Exonic
906860816 1:49357197-49357219 GCAGGAGGACACAGAGAAGCAGG - Intronic
908008169 1:59748230-59748252 GGTGAGGACCACAGAGAAGCAGG + Intronic
908078545 1:60548074-60548096 CCTGAAGCCAACAGAGAAACAGG + Intergenic
909931135 1:81501853-81501875 GATGGATGCCAGAGAGAAGCAGG + Intronic
910373480 1:86543511-86543533 GCTGGAGTTCAGGGAGAAGCAGG + Intergenic
913960845 1:143337125-143337147 GCTGGAGCCCACATAGCTCCAGG - Intergenic
914055199 1:144162697-144162719 GCTGGAGCCCACATAGCTCCAGG - Intergenic
914123947 1:144803664-144803686 GCTGGAGCCCACATAGCTCCAGG + Intergenic
915034394 1:152910253-152910275 GTTGGAGCTCCCAGAGCAGCAGG + Exonic
915034413 1:152910343-152910365 GCTGGAGCTCCCAGAGCAGCAGG + Exonic
915034420 1:152910373-152910395 GCTGGAGCTCCCAGAGCAGCAGG + Exonic
915034427 1:152910403-152910425 GCTGGAGCTCCCAGAGCAGCAGG + Exonic
915034434 1:152910433-152910455 GCTGGAGCTCCCAGAGCAGCAGG + Exonic
915034441 1:152910463-152910485 GCTGGAGCTCCCAGAGCAGCAGG + Exonic
915034448 1:152910493-152910515 GCTGGAGCTCCCACAGCAGCAGG + Exonic
915034455 1:152910523-152910545 GCTGGAGCTCTCTGAGCAGCAGG + Exonic
915034460 1:152910553-152910575 GCTGGAGCTCTCTGAGCAGCAGG + Exonic
915034528 1:152910883-152910905 GCTGGGGCTCCCAGAGCAGCAGG + Exonic
915034599 1:152911264-152911286 GCTGGAGCTCCCAGAGCAGCAGG + Exonic
915041609 1:152972364-152972386 GCTGGAGCCTGCAGAGAATGAGG - Exonic
915341519 1:155179209-155179231 ACTGGAGCCCACAGGCAAGAGGG - Intronic
915737400 1:158093771-158093793 GCAGGAGGCCAGAGAGGAGCAGG - Intronic
917441574 1:175073576-175073598 GCTGGAACCTGCAGAGAAGCTGG + Intronic
917707283 1:177647335-177647357 TCTGGCTCCCACAGAGAAGTTGG + Intergenic
918085433 1:181240919-181240941 GCGGGAGCTGACAAAGAAGCCGG + Intergenic
919207689 1:194437834-194437856 GTGAGAGCCCACAGGGAAGCAGG + Intergenic
920328458 1:205185906-205185928 GCCTGAGCCTACAGAGTAGCTGG - Intronic
921029475 1:211325170-211325192 GCTTCAGCCCCCAGAGTAGCTGG - Intergenic
922108118 1:222530234-222530256 TCAGGAGGCCACAGAGAACCTGG - Intronic
922749501 1:228063949-228063971 GCTGGGGCCCAGAGAGGAGATGG + Intergenic
922915147 1:229251414-229251436 GCCCCAGCCCACAGTGAAGCAGG - Exonic
923013209 1:230105283-230105305 GCTTGAGTCCACAGAGCAGTGGG - Intronic
1063450150 10:6145446-6145468 GCTGGAGCGCAGCGGGAAGCGGG - Intronic
1064658410 10:17579908-17579930 ACTGGATCCCACAGGGCAGCTGG - Intergenic
1064698260 10:17989510-17989532 GAGGGAGCCCACAGCGAAGGTGG + Intronic
1064863964 10:19858302-19858324 TCAGGAGCCCACAGTTAAGCGGG - Intronic
1065047779 10:21759394-21759416 GCTGGAGGCTACAGCGAAGCCGG - Exonic
1065352046 10:24804340-24804362 GCTGGGACCCACACAGGAGCGGG + Intergenic
1066375170 10:34851569-34851591 GCCTGAGCCCCCTGAGAAGCGGG + Intergenic
1066441957 10:35448073-35448095 GCTGGTTCCCACAGTGAAGGCGG - Intronic
1066564842 10:36710637-36710659 TCTGGAGTCCACAAAGAATCAGG - Intergenic
1067029284 10:42869380-42869402 GCTGGAGCCCACATAGCTCCAGG - Intergenic
1069019421 10:63468862-63468884 GTTGCAGCCTCCAGAGAAGCTGG - Intergenic
1070570088 10:77634554-77634576 GCTGGAGTCCAGAGGAAAGCAGG - Intronic
1070945097 10:80384172-80384194 TCTGGAGCTTACAGAGTAGCTGG + Intergenic
1070957049 10:80471076-80471098 GCTGGAGGGCAGAGAGAAGGAGG - Intronic
1073167631 10:101471303-101471325 GCTGGAGCCCACTGAGTTGGAGG + Intronic
1073286620 10:102393701-102393723 GCTGCAGCCTACCGAGTAGCTGG - Intergenic
1074011920 10:109490778-109490800 GCTGCAGCCACCAGAGTAGCTGG - Intergenic
1074232715 10:111553815-111553837 GGAGGAACCCACAGAGGAGCAGG - Intergenic
1074257008 10:111812717-111812739 GCTTCAGCCCCCAGAGTAGCTGG - Intergenic
1074819032 10:117165572-117165594 GCTGGAGCCCCCAAAAATGCAGG - Intergenic
1074882058 10:117667222-117667244 GCTGAAGCCCAGAGAGAGGTTGG + Intergenic
1075280033 10:121131147-121131169 GCTGGATCCTCCAGAGAAGCAGG + Intergenic
1075438547 10:122461972-122461994 GCTGGCGCACACACAGAGGCCGG - Exonic
1075575083 10:123572135-123572157 ACTGGAGCCCACTGTGAAGCTGG - Intergenic
1076769261 10:132654219-132654241 GCTGGAGCCCACTGAGCTGAAGG - Intronic
1077100669 11:820961-820983 GCTGGAGCCCATAGTGCAGCAGG + Intronic
1077195990 11:1280451-1280473 GGTTGTGCCCACAGAGACGCAGG + Intronic
1077755841 11:5026187-5026209 GCTCCATCCCAGAGAGAAGCAGG - Intergenic
1078470310 11:11581083-11581105 GCTGGTGTCCCGAGAGAAGCCGG + Intronic
1078489912 11:11759163-11759185 GCTGGAGACCACTGAGACACAGG + Intergenic
1080060782 11:27954662-27954684 GCTAGAGCCAACAGAGACACTGG + Intergenic
1080502882 11:32887171-32887193 GCTGCAGCTTCCAGAGAAGCAGG + Intergenic
1081126899 11:39333150-39333172 GCAGGAGCCCACGGAGGGGCAGG + Intergenic
1081734023 11:45391118-45391140 TCTTGAGCCCACAGAGGAGCAGG + Intergenic
1081750790 11:45509558-45509580 GAGGCAGCTCACAGAGAAGCAGG + Intergenic
1083899852 11:65638309-65638331 GCTGGAGCCCGGAGGGAAGTTGG - Intronic
1083922758 11:65789341-65789363 GGAGGAGCCTACAGAGAAGCCGG - Intronic
1083954842 11:65977567-65977589 GCTGGAGACCACAGTGCAGAAGG + Exonic
1084589105 11:70079757-70079779 TCTGGAGCTCACAGAGAGGCAGG + Intronic
1084656855 11:70524742-70524764 GGGGAAGCCCACAGAGATGCAGG + Intronic
1084860677 11:72015906-72015928 GCAGCAGGCCAAAGAGAAGCAGG - Exonic
1084870212 11:72093635-72093657 GTTGGAGCACCCAGAGAACCTGG + Exonic
1085088954 11:73693171-73693193 GCTTGAGCCTACTGAGTAGCTGG - Intronic
1085646522 11:78227024-78227046 TCTGGTGCCCTGAGAGAAGCTGG + Exonic
1085665629 11:78413564-78413586 ACTGGAGCCGACTGAGAAGAAGG + Intronic
1087077895 11:94142453-94142475 TCTGGAGCACACAGTCAAGCTGG - Intronic
1088481678 11:110301018-110301040 GCAGGAGCCCACGGAGAAGGCGG + Intergenic
1088927871 11:114320593-114320615 CCTGGAGCCCACAGTTAAGATGG + Intergenic
1089202002 11:116730204-116730226 GCTGGACACCATAGAGGAGCAGG - Intergenic
1089361275 11:117888403-117888425 GCTGGAGCCCAAAGAGAGAGTGG - Intergenic
1089384480 11:118058886-118058908 GCTGGTAACTACAGAGAAGCAGG + Intergenic
1089642841 11:119859113-119859135 GCTGGACCAGACAGTGAAGCAGG + Intergenic
1090608234 11:128447018-128447040 GTTGGAGTCCCCAGAGAGGCAGG - Intergenic
1091678989 12:2512763-2512785 GCAGGAGAGCACAGAGAAGGAGG - Intronic
1092113090 12:5978375-5978397 GCTTCAGCCTACAGAGTAGCTGG + Intronic
1092523693 12:9296670-9296692 GCAGGAGCTCACTGAGAGGCTGG - Intergenic
1092543604 12:9435229-9435251 GCAGGAGCTCACTGAGAGGCTGG + Intergenic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1093016239 12:14157234-14157256 TCTAGAGCCCACAGAGCAGGTGG + Intergenic
1094509339 12:31086822-31086844 GCAGGAGCTCACTGAGAGGCTGG - Intronic
1095300682 12:40580967-40580989 GCAGAAGGCCAAAGAGAAGCAGG + Intergenic
1095852980 12:46831101-46831123 GCTGGATCACAAAGAGGAGCTGG + Intronic
1095949284 12:47773202-47773224 GCGGGAGCCGCCAGAGCAGCCGG - Exonic
1095964364 12:47857163-47857185 GGAGGAGTCCCCAGAGAAGCTGG + Exonic
1096597214 12:52703439-52703461 GCTGGAGCATCCAGAGAAGCAGG + Exonic
1096974592 12:55692921-55692943 GCTGGAGCCACCTGAGCAGCAGG - Exonic
1097257882 12:57694409-57694431 GCTGGAGCCTACGGGGAATCGGG + Intronic
1097903636 12:64898109-64898131 GCTGCAAGGCACAGAGAAGCTGG - Intergenic
1097905170 12:64912222-64912244 GCTGGAGACCTCTGGGAAGCAGG + Intergenic
1100669822 12:96799504-96799526 GCTGGAGAACAAAGAGAGGCAGG - Intronic
1101734612 12:107453755-107453777 GTTGGAGCCCCCAGACAAGAAGG + Intronic
1103092802 12:118109386-118109408 ACTTCAGCCCCCAGAGAAGCTGG + Intronic
1103991982 12:124805443-124805465 GCTGGATCCTTCAGAGAGGCCGG + Intronic
1104004129 12:124880257-124880279 GCTGGAGCCCACAGAGAAGCTGG + Intronic
1104025819 12:125025343-125025365 GCTGGAGCACCTGGAGAAGCAGG + Exonic
1104082577 12:125443393-125443415 GCTGGAGTTCACAGAGAAAGGGG - Intronic
1104960201 12:132484945-132484967 GCTGGAGCCCACGGTGCTGCAGG + Intergenic
1105587324 13:21757131-21757153 TGTGGAGCCCACAGAGCAGCCGG - Intergenic
1105989433 13:25603558-25603580 GCAGGAGCCCACCTAGTAGCTGG + Intronic
1106592007 13:31105979-31106001 GCTGGACCCCACAGCCAAGTGGG + Intergenic
1106923322 13:34588144-34588166 GAAGGAGCCTCCAGAGAAGCTGG - Intergenic
1107731981 13:43357853-43357875 GCTGGAGCCCACAAACAGGAGGG + Intronic
1108601389 13:51998105-51998127 GCAGGATTCCACAGAGAGGCAGG - Intronic
1113023468 13:105915039-105915061 GCTGGAGCCAACTGACATGCAGG - Intergenic
1113541839 13:111115351-111115373 GCCGGGGCGCACGGAGAAGCGGG + Exonic
1114484969 14:23056949-23056971 GCTGGGGACCAGAGAGAAGGCGG + Intronic
1114529642 14:23387857-23387879 GCTGGAGTCCTCACAGAAGGAGG - Exonic
1116795256 14:49383362-49383384 GCTGCAGCCTCCTGAGAAGCTGG - Intergenic
1117051740 14:51867111-51867133 GTTGGAGCCCGCAGAGAGGTAGG - Intronic
1117561584 14:56945632-56945654 CTTGGAGGCCACAGAGAAGTAGG + Intergenic
1118378876 14:65201505-65201527 CCTGGAGCCCAGAGAGAAGGGGG + Intergenic
1118497621 14:66324512-66324534 GGTGGAGCCCAGAGAGATGAAGG + Intergenic
1118762796 14:68890761-68890783 CCTGGAGCCTACAGAGACCCCGG + Intronic
1119644892 14:76341080-76341102 GCTGGAGCACACAGATTAGAGGG - Intronic
1119664126 14:76472409-76472431 CCCGGAGCCCACAGAGCAGCTGG + Intronic
1119923729 14:78471879-78471901 GCTGCACCACAAAGAGAAGCTGG + Intronic
1120300956 14:82706046-82706068 GCTCCAGCCCAGAGAGATGCAGG + Intergenic
1120381226 14:83782170-83782192 GATGGAGCTCAGAGAAAAGCTGG - Intergenic
1120529368 14:85613733-85613755 CCTAGAGCTTACAGAGAAGCAGG + Intronic
1121585857 14:95062395-95062417 GCACGTGCCCACCGAGAAGCAGG - Intergenic
1121603881 14:95226421-95226443 TGTGGAACCCACAGAGAAGGAGG + Intronic
1122012351 14:98760601-98760623 GCTGGAGGCCACAGAGAGCAAGG - Intergenic
1122043624 14:99008137-99008159 GCAGGAGACCCCAGAGAAACGGG - Intergenic
1122719416 14:103713968-103713990 GCGGGAGCTCTCTGAGAAGCTGG - Intronic
1122724716 14:103742653-103742675 ACTGGGACCCACGGAGAAGCCGG - Exonic
1123030171 14:105447852-105447874 CCATGAGCTCACAGAGAAGCAGG - Intronic
1123042974 14:105497985-105498007 GCTGGTGCCCAGAGCGAGGCTGG - Intronic
1123123043 14:105926909-105926931 CATAGAGCCCACTGAGAAGCGGG - Intronic
1202839550 14_GL000009v2_random:108923-108945 ACTGGAGCCCACTGAGTAGCTGG - Intergenic
1123920618 15:25067287-25067309 CATGGAGCCCAAGGAGAAGCCGG + Intergenic
1124035291 15:26048851-26048873 CCTGGGGCCCAGGGAGAAGCGGG - Intergenic
1125604964 15:40934986-40935008 GCAGGAGCCCCCATTGAAGCAGG - Exonic
1125732198 15:41899272-41899294 GCTGGTGCCCACAGAGGGGGAGG + Exonic
1127679061 15:61275251-61275273 GCTTTAGCCTCCAGAGAAGCTGG + Intergenic
1127882806 15:63173009-63173031 GCTGCAGACAACAGAGGAGCAGG - Intergenic
1127901694 15:63345719-63345741 CCTGGAGCCCAGAGAGAGGCAGG + Intronic
1127974098 15:63984494-63984516 CCTGGAGCACTCAGGGAAGCTGG - Intronic
1128310773 15:66630713-66630735 GCTGGAGGCCAGTGAGAAGGTGG + Intronic
1128709063 15:69858378-69858400 ACTGGAGCCCAGTGAGAAGCAGG - Intergenic
1129108011 15:73322527-73322549 GCTGGACCCCAGAGGGAACCTGG - Exonic
1129288382 15:74544008-74544030 GATGGATGCCAGAGAGAAGCAGG + Exonic
1129797045 15:78385655-78385677 GCTGGAGACGAAGGAGAAGCTGG - Intergenic
1129929319 15:79396554-79396576 ACTGGAGCCCAGAGGGAAGATGG - Intronic
1130661992 15:85838007-85838029 GCTGCCACTCACAGAGAAGCAGG + Intergenic
1131117990 15:89806097-89806119 GGTGGAGCCCACCGAGTACCTGG - Exonic
1131440862 15:92458652-92458674 CCAGGAGCCCACAGATCAGCGGG + Intronic
1131688120 15:94793299-94793321 GCTTGATCCCACAGAGAGGGAGG + Intergenic
1131741497 15:95397872-95397894 GCTTCAGCCTACCGAGAAGCTGG - Intergenic
1132498080 16:273244-273266 CCTTGGGCCCAGAGAGAAGCTGG + Intronic
1132532844 16:462055-462077 GTCGGAGCTCACAGAGGAGCAGG - Intronic
1132667528 16:1089067-1089089 GCTGGAGACCCCAGGGCAGCCGG + Intergenic
1132867942 16:2103104-2103126 GCTGGGGGCCACGGAGAAGCAGG - Intronic
1133270741 16:4609798-4609820 GCTGGAGGCCGCAGAGCTGCTGG + Exonic
1133626276 16:7573360-7573382 GTTGGAGACCACTGAGAAGGGGG + Intronic
1133926594 16:10197818-10197840 CCTGGACCCCACAGAGAATCTGG + Intergenic
1134523827 16:14930010-14930032 GCTGGGGGCCACGGAGAAGCAGG + Intronic
1134549076 16:15130925-15130947 GCTGGGGGCCACGGAGAAGCAGG - Intronic
1134655386 16:15944466-15944488 GCTGCAGCCTCCAGAGTAGCTGG + Intergenic
1134663285 16:16000259-16000281 GCTTCAGCCCACTGAGTAGCTGG + Intronic
1134711418 16:16328495-16328517 GCTGGGGGCCACGGAGAAGCAGG + Intergenic
1134719269 16:16371794-16371816 GCTGGGGGCCACGGAGAAGCAGG + Intergenic
1134948157 16:18340091-18340113 GCTGGGGGCCACGGAGAAGCAGG - Intergenic
1134955411 16:18380198-18380220 GCTGGGGGCCACGGAGAAGCAGG - Intergenic
1136396505 16:29995384-29995406 CCTGGAGCCCGAGGAGAAGCAGG - Exonic
1138168394 16:54824924-54824946 GCTGGAGCTATCAGAGAAGGAGG + Intergenic
1138259564 16:55605649-55605671 GCTGGAGTCCAAAGACAACCTGG + Intergenic
1138525037 16:57600312-57600334 ACTGGAGCCCAGAGAGGGGCAGG - Intergenic
1139399802 16:66672288-66672310 GCTTCAGCCTACTGAGAAGCTGG - Intronic
1139952299 16:70678323-70678345 GCTGGAGGAGACGGAGAAGCAGG - Exonic
1140506772 16:75478559-75478581 GCTGGGGCGCACGGAGAAGCAGG - Exonic
1142024027 16:87802841-87802863 GCAGATGCCCACAGAGAAACAGG - Intergenic
1142049485 16:87948858-87948880 GCTTGAGCCTCCAGAGTAGCTGG - Intergenic
1142246581 16:88972998-88973020 GCTGGAGCCCACAGACACCCTGG + Intronic
1142560272 17:805345-805367 GGTGGAGCCCACCGAGGACCTGG + Intronic
1142560645 17:807151-807173 GCTGCAGCCCAAAGGGAATCCGG + Intronic
1143114905 17:4576846-4576868 GCTGCAGCCCATAGATCAGCGGG - Intergenic
1143428776 17:6863239-6863261 GCTGGAGCCCCAGGAGAGGCTGG + Intergenic
1143608470 17:8003907-8003929 CCTGGAGGCCGCAGAGGAGCTGG + Exonic
1143897692 17:10149215-10149237 GCCTGAGCCTACAGAGTAGCTGG + Intronic
1144955683 17:19017785-19017807 GCTGCAGCCCAGGGAGATGCTGG + Intronic
1145848670 17:28068791-28068813 GCTGCAGCCTTCAGAGTAGCTGG + Intronic
1145993105 17:29090964-29090986 GCTGGAGCCCACAGGCACACTGG - Intronic
1146635682 17:34502665-34502687 CCTTGAACTCACAGAGAAGCTGG - Intergenic
1147251017 17:39152306-39152328 CCTGGAGGCCCCAGAGAGGCAGG - Intronic
1147349721 17:39831604-39831626 TCTTGGGCCCACACAGAAGCAGG - Intronic
1147865557 17:43549787-43549809 TCAGGAGCCATCAGAGAAGCAGG + Intronic
1150335332 17:64326586-64326608 TCTGGGGCCCACAGAAAGGCTGG - Intronic
1151700960 17:75742401-75742423 GCTGAAGCTTACAGAGAAGCAGG + Exonic
1152490785 17:80631822-80631844 GCTGCAGCCTCCAGAGTAGCTGG - Intronic
1152640829 17:81448515-81448537 TCTGGGGCCCACAGGGAAGACGG - Intronic
1152668717 17:81588254-81588276 ACTGGAGCCCCCAAAGGAGCGGG + Intronic
1154100348 18:11467234-11467256 GTTTGAGCTCACAGAGATGCAGG + Intergenic
1154177019 18:12092470-12092492 AGTGGAGGCCACAGAGTAGCAGG - Intergenic
1154204073 18:12322184-12322206 GCTTCAGCCCCCCGAGAAGCTGG - Intronic
1155003356 18:21706801-21706823 GCAGGAGCCCACAGTGGGGCGGG - Intronic
1156459605 18:37314338-37314360 GCCGCAGCCCCCAGAGTAGCTGG - Intronic
1156486262 18:37467551-37467573 GGTGGAGCCCACAGGGGAGCAGG + Intronic
1156737353 18:40276470-40276492 GCTGGAGCTCAAAGACAAGGTGG + Intergenic
1158585244 18:58727416-58727438 GCCTGAGCCCCCAGAGTAGCTGG + Intronic
1159743995 18:72209408-72209430 GCAGGAGCCCACGGCGAGGCGGG - Intergenic
1160077807 18:75694488-75694510 GGTGTGGCCCACAGAGCAGCGGG - Intergenic
1160364208 18:78310321-78310343 GCTGCATCCCACTGAGAAGAAGG + Intergenic
1160541876 18:79628419-79628441 TCTGGGGTCCACAGAGATGCTGG - Intergenic
1160860156 19:1234290-1234312 GCTGGGGCCCACAGAGCGGCCGG + Exonic
1160908821 19:1465515-1465537 GCTGGAGCACCTGGAGAAGCAGG + Exonic
1160965155 19:1744201-1744223 GCTGGTGCCCACAGGGAAACTGG + Intergenic
1160986044 19:1839409-1839431 CCAGGGGCTCACAGAGAAGCTGG + Intronic
1161089508 19:2352955-2352977 GCTGGGGCCCACGGAGATGGAGG - Exonic
1161302979 19:3551837-3551859 GCTGGAGCAGAGAGAGAAGGGGG - Intronic
1161307192 19:3574565-3574587 GCTGCAGCCAACGGAAAAGCAGG + Exonic
1161446597 19:4322385-4322407 GCTGGAGCCCAAGGAGTATCTGG + Intronic
1162199465 19:9010232-9010254 GCTGGGGCTCACTGAGGAGCTGG - Intergenic
1162804265 19:13128903-13128925 GCAGGAGGCCACAGGGCAGCTGG - Intronic
1162960112 19:14120569-14120591 GCTGGAGGCCATAGAGACCCAGG - Exonic
1163091254 19:15021826-15021848 CCTGGAGACCGCAGAAAAGCTGG + Exonic
1163243035 19:16076142-16076164 GCTGGAGCTCACGGAGAAGAAGG + Exonic
1163386712 19:17004501-17004523 ACTGGAGACCACAGAGAAGCTGG + Intronic
1163446358 19:17348809-17348831 GCTGGAGGCCCCAAGGAAGCGGG - Intergenic
1163795218 19:19334077-19334099 GCTGCATCCCACTGAGAAGCCGG - Intronic
1163841537 19:19613962-19613984 CTTGGAGCCCACTGAGAAGTAGG - Intronic
1165266960 19:34668431-34668453 ACAGGAGCCCACAGAGGAGGGGG - Intronic
1165711997 19:38018276-38018298 GCTGCAGCCTGCAGAGTAGCTGG + Intronic
1165932597 19:39369674-39369696 GCAGGAGTCCAAAGAGAAGGTGG + Exonic
1167270141 19:48501827-48501849 GGAGGAGTCAACAGAGAAGCAGG - Intronic
1167749945 19:51373357-51373379 GCTGGAGCCCCCACCCAAGCAGG - Intergenic
1167771888 19:51525837-51525859 GGTGGAGCTCTCAGAGCAGCTGG + Intronic
1202694681 1_KI270712v1_random:115374-115396 GCTGGAGCCCACATAGCTCCAGG - Intergenic
925145706 2:1581760-1581782 GATGCTTCCCACAGAGAAGCGGG + Intergenic
925228890 2:2212906-2212928 GCTGTGGCCCTCAGAGAAGATGG - Intronic
925471905 2:4172239-4172261 GCTGGAGCCCTCAGAGGAGCAGG + Intergenic
925803859 2:7629413-7629435 GCTGGAGCTCACTGAGAGGAAGG + Intergenic
925969437 2:9096398-9096420 GCTGCGGCCCGCAGAGAGGCAGG + Intergenic
926161432 2:10492793-10492815 GATGGAGCCTACAGAGCCGCAGG - Intergenic
926998327 2:18764021-18764043 GGAGGAGCTCACAGAGAAGATGG - Intergenic
927108105 2:19844914-19844936 GCTGGAGCCCAGAGAGGTGTGGG - Intergenic
931018043 2:58008942-58008964 GCTGCATCCCACAGAGAAGGAGG + Intronic
931095497 2:58935667-58935689 TTTGCAGTCCACAGAGAAGCAGG - Intergenic
931478493 2:62615727-62615749 GCTTCAGCCCCCAGAGCAGCTGG - Intergenic
932579623 2:72984900-72984922 GCTGGGGCCTGCAGAGGAGCTGG + Intronic
932614128 2:73221213-73221235 GATGGTGGCCACAGTGAAGCAGG + Exonic
934275853 2:91572420-91572442 GCTGGAGCCCACATAGCTCCAGG - Intergenic
934519453 2:95010735-95010757 GCTGGAGCCTGCAGAGCTGCAGG + Intergenic
934534292 2:95120432-95120454 GCTGGAGGCCAATGGGAAGCTGG + Intronic
934555521 2:95285166-95285188 GAAGGGGCCCACAGAGGAGCTGG + Intronic
934557240 2:95293945-95293967 GGAGGAGCCCACAGAGAAAGAGG + Intergenic
934669446 2:96200810-96200832 GGTGGAGGGCACGGAGAAGCTGG - Intronic
935151537 2:100440989-100441011 GCTGGTGCCCTCAGATAAGAAGG + Intergenic
935751571 2:106239522-106239544 GCTTGAGCCTCCAGAGTAGCTGG - Intergenic
935860826 2:107327229-107327251 GCTGGAGCCCAAAGACAAAAAGG - Intergenic
938923434 2:136016644-136016666 ACAGGAGCCCACAGAGATGAGGG - Intergenic
939724765 2:145703455-145703477 GCTTCAGCCTACAGAGTAGCTGG + Intergenic
939822632 2:146976520-146976542 GCTGGAGAACCCAGAGAAACTGG + Intergenic
940323385 2:152400316-152400338 GCCTCAGCCCACAGAGTAGCTGG - Intronic
941971708 2:171357807-171357829 GCTGCAGCCCCCTGAGTAGCTGG + Intronic
944687517 2:202130800-202130822 GCCTGAGCCCCCAGAGTAGCTGG - Intronic
945684499 2:212952814-212952836 GATGGAGCACACAGAGAAGGGGG + Intergenic
946269361 2:218577607-218577629 CCTGATGCCCACAGAGAAGATGG - Intronic
946306748 2:218860552-218860574 TCAGGAGCCCAGAGAGAAGCCGG - Intronic
948059277 2:235031590-235031612 GGTGGAGCCCACAGCAAAGGCGG - Intronic
948369959 2:237482603-237482625 GCTGGAGCCCAGAGAGCAAGCGG + Intergenic
948783371 2:240338517-240338539 GGTGGACCCCACACAGCAGCAGG - Intergenic
948909325 2:240995162-240995184 CCTGGAGCCCACAGAGAATGGGG + Intergenic
1168792813 20:591353-591375 GCTGGAGCCCAGAGAGCAAAGGG + Intergenic
1168861733 20:1050542-1050564 GCTGGTGCCCACATGGAACCTGG - Intergenic
1168955023 20:1828685-1828707 CCAGGAGCCCAGAGGGAAGCTGG + Intergenic
1169076742 20:2764734-2764756 GCTTCAGCCCCCAGAGTAGCTGG + Intergenic
1169645318 20:7803639-7803661 ACAGGAGCCCACGGAGGAGCGGG + Intergenic
1171007143 20:21477728-21477750 GCTGCAGCCTACCGAGTAGCTGG - Intergenic
1171345292 20:24461436-24461458 GGTGCAGCCCACAGAGAGGGGGG + Intergenic
1172110453 20:32541635-32541657 GTGGGGGCCCAGAGAGAAGCTGG - Intronic
1172766264 20:37352687-37352709 GCTGAAGCTCAGAGAGAGGCGGG + Intronic
1173767773 20:45629840-45629862 GCAGCAGCACACAGAGAACCAGG - Exonic
1173773801 20:45685944-45685966 GCAGCAGCACACAGAGAACCAGG + Intronic
1174060963 20:47832854-47832876 GCTGGAGGCCAAAGAGGAGCTGG - Intergenic
1174070934 20:47898516-47898538 GCTGGAGGCCAAAGAGGAGCTGG + Intergenic
1174100168 20:48121266-48121288 GCTGGAGGCCGAAGAGGAGCTGG - Intergenic
1174153126 20:48500142-48500164 GCTGGAGGCCGAAGAGGAGCTGG - Intergenic
1174457843 20:50662212-50662234 GGAGGAGCCCTCAGAGAAGAAGG + Intronic
1175076987 20:56383656-56383678 GATGGAGCCCACAGGCTAGCTGG + Intronic
1175340846 20:58228278-58228300 GCGGGAGCTCAAAGAGGAGCTGG - Exonic
1175869297 20:62200573-62200595 CCTGGAGCCCACTGCGAAGGCGG - Intronic
1176628281 21:9113784-9113806 ACTGGAGCCCACTGAGTAGCTGG - Intergenic
1177565383 21:22814847-22814869 GCTTCAGCCCCCAGAGTAGCTGG + Intergenic
1177795931 21:25778596-25778618 GCAGGAGCCCACAGAGAGAGAGG - Intergenic
1178351415 21:31874648-31874670 GCTGGAGGGCACAGAGGAGCTGG - Intronic
1178601474 21:33998541-33998563 GCTGGAAACCACAGAGAGGGAGG - Intergenic
1178835380 21:36093030-36093052 GCTGGAGTCCACAGAGAGCCTGG - Intergenic
1179614795 21:42575475-42575497 GCAGGAGCCCAGAGAAAAGGGGG - Intronic
1180599745 22:17008119-17008141 GCTGCAGCTCACAGTGAAGGTGG + Exonic
1180934130 22:19613117-19613139 GCTGGGGCACACAGAGTACCAGG + Intergenic
1181149159 22:20870360-20870382 CCTGGAGCGCACAGAGAAGATGG + Exonic
1181448591 22:23000452-23000474 GCTGTACCCCACAGAGACACAGG - Intergenic
1183292420 22:37010830-37010852 GATGGAGCCCAGAGAGAGGCAGG + Intergenic
1183484376 22:38081485-38081507 GCAGGAGCCCGCCGAGCAGCAGG + Exonic
1184869947 22:47231571-47231593 GCTGGAGACCTCAGGGGAGCAGG - Intergenic
1185049204 22:48544957-48544979 GCTGCTGCCCACTGAAAAGCAGG - Intronic
1185371408 22:50462570-50462592 CCTGGAGCCCACGGAGGACCTGG - Exonic
1203272527 22_KI270734v1_random:65399-65421 GCTGGAACCCTCAGTTAAGCGGG - Intergenic
949551758 3:5117523-5117545 GCCTGAGCCCACTGAGTAGCTGG - Intergenic
950101579 3:10360108-10360130 TCTGCAGCCCCCAGAGAAGGAGG - Exonic
950284668 3:11735241-11735263 GCTGCAGCCTCCAGAGTAGCTGG - Intergenic
950312149 3:11968054-11968076 CCTGGAGCCCACAGTTGAGCTGG + Intergenic
950798727 3:15532150-15532172 ACAGGAGCCCAAAGAGGAGCTGG - Intergenic
950880680 3:16320737-16320759 ACTGGAGGCCACAGAGGAGCTGG + Intronic
950891143 3:16405459-16405481 GCTAGAGCACTCAGAGAAACTGG + Intronic
951286004 3:20814823-20814845 TGTGGAGCACACAGAGAGGCAGG + Intergenic
952618136 3:35300585-35300607 GAGGGAGCCCACAGAAGAGCAGG + Intergenic
952730239 3:36630900-36630922 GCTGAAGTCCAGAGAGAAGATGG - Intergenic
952866739 3:37860418-37860440 GCTGGAAGCCACAGAAGAGCTGG + Intergenic
953292905 3:41684269-41684291 ACTGGTGTGCACAGAGAAGCAGG - Intronic
953470006 3:43158400-43158422 GCTGGAGGTCACAGAGGAGAAGG + Intergenic
954875798 3:53802501-53802523 GCTTGACCCCAGAGAGCAGCCGG - Intronic
956392161 3:68785394-68785416 ACAGGAGCCCACAGAGGAGCAGG + Intronic
956434226 3:69217505-69217527 GCCTCAGCCCACAGAGTAGCTGG - Intronic
961329631 3:126130937-126130959 GCAGGAGCCCCCAGAAAAGCAGG + Intronic
961441933 3:126958469-126958491 GCTGGAGAGCACAGAGCATCTGG - Intronic
962326027 3:134433011-134433033 CCTGGAGCCCTCAGGGAACCGGG + Intergenic
962968243 3:140373964-140373986 ACTGGAGCCTGCAGAGAAGATGG - Intronic
963554695 3:146772625-146772647 GCAGGAGCCCACAGAGGCGGGGG - Intergenic
963811162 3:149777713-149777735 GCTGGAGCACACACAGATGTGGG - Intronic
963831369 3:150013001-150013023 GCTAGAGACCCCAGAAAAGCTGG + Intronic
964090316 3:152868551-152868573 GCTGGAGCCCACAGAAGGGCTGG - Intergenic
966939211 3:184734904-184734926 GCTGGACCCCAGCTAGAAGCAGG - Intergenic
966954697 3:184863583-184863605 GCAGGAGCCTAGAGAGAAGGAGG + Intronic
967054980 3:185823887-185823909 GCTGGAGCCCAGACAGGAGACGG - Intronic
967138467 3:186532592-186532614 GCTTGAGCTCACAGTGAACCTGG - Intergenic
967316373 3:188154638-188154660 GCTGAGGCCCAGAGAGAAGGAGG + Intronic
967829874 3:193909714-193909736 GCTGAGGCCCACAGAGGAGTGGG - Intergenic
968235268 3:197027537-197027559 GCTGGCGCCCTCTGAGCAGCGGG + Intronic
968804404 4:2763204-2763226 ACAGGAGCCCACGGAGGAGCGGG + Intergenic
969199589 4:5592265-5592287 GCTGGCTCCCAGAGAGAAGGGGG + Intronic
969300886 4:6296256-6296278 GCTTCAGCCCAAAGAGCAGCAGG + Intronic
970194598 4:13542247-13542269 GCTGAAGCTCACCGAGACGCAGG - Exonic
970757708 4:19446162-19446184 GCTGCAGCCTACTGAGTAGCTGG - Intergenic
972314642 4:37914731-37914753 GCTGGAGTCCAGAGAGCAACGGG - Intronic
972814405 4:42628399-42628421 GCTGGAGCACAGACAGAAGGCGG + Intronic
973285430 4:48410750-48410772 GCAGGGGTCCACAGATAAGCAGG - Intronic
973636923 4:52869340-52869362 GCTGGAGGCCAGTGAGCAGCTGG - Intergenic
973693550 4:53466887-53466909 GATGGAGCCTACAGAGAAGCAGG - Intronic
976846100 4:89490294-89490316 GCAGGAGCCCACGGAGGAGCGGG - Intergenic
978339412 4:107706835-107706857 GCTGGAGTCCTCAGGGAGGCTGG + Intronic
980686945 4:136240911-136240933 GCTGGTGGCTACAGAGAAGCTGG + Intergenic
980930562 4:139178690-139178712 GCTGGAGCCCAGAAATCAGCTGG - Intergenic
982361502 4:154524020-154524042 GCTGGAGCCCAGATGGAGGCTGG + Intergenic
982582905 4:157201855-157201877 GCTAGATCTCACAGAGAAGGCGG - Intergenic
983605240 4:169575497-169575519 GCTGAAACTCACAGGGAAGCTGG - Intronic
984441878 4:179781092-179781114 GCTGGAGCCCACTGATAATGGGG - Intergenic
984712667 4:182898625-182898647 GCGGGAGCCCTCAGAGATGGAGG - Intronic
985041185 4:185893390-185893412 GCTGGAGCCCACCCACTAGCAGG + Intronic
985293980 4:188414865-188414887 GCTGCAGCCTCCAGAGTAGCTGG - Intergenic
985360955 4:189174962-189174984 TCTGGAGCCCACAGAAATGTAGG + Intergenic
1202760481 4_GL000008v2_random:105162-105184 GCTTGAGCCCCCTGAGTAGCTGG + Intergenic
985585626 5:732243-732265 CCTGGAGCCCACGGAGATGCGGG + Intronic
985599294 5:818056-818078 CCTGGAGCCCACGGAGACGCGGG + Intronic
985600061 5:823669-823691 CCTGGAGCCCACGGAGACGCGGG + Intronic
985860426 5:2466319-2466341 GCAGGAGGCCACAGAGAAGGCGG - Intergenic
986496824 5:8350863-8350885 CTTCCAGCCCACAGAGAAGCAGG + Intergenic
986621631 5:9681755-9681777 CCTGGACCACACTGAGAAGCAGG - Intronic
987182812 5:15385196-15385218 GGGGGAGCGCGCAGAGAAGCAGG + Intergenic
988540274 5:32102258-32102280 GCTGGGGCCCACCCAGGAGCAGG + Intronic
990943299 5:61225897-61225919 CCTGGAGCAGGCAGAGAAGCTGG - Intergenic
991977319 5:72196088-72196110 GCTGGAGCCCGTCGAGAAGCAGG + Exonic
992224720 5:74609220-74609242 GCTGGAGCCTACAGAGATTGGGG + Intergenic
993591192 5:89797132-89797154 GCCTGAGCCCACTGAGTAGCTGG + Intergenic
993852212 5:93024303-93024325 GCTGGAGCTCACAGAGCCGGAGG + Intergenic
994242710 5:97443872-97443894 GCTCCAGCCCAGAGAGATGCAGG + Intergenic
995478445 5:112571258-112571280 GTTTGAGCCCATAGATAAGCTGG - Intergenic
996527342 5:124492674-124492696 GGTGTGGCCCACAGAGAGGCAGG - Intergenic
998153296 5:139769457-139769479 GCTGCCCCCCACAGAGGAGCTGG - Intergenic
999101358 5:149028454-149028476 GCTGGAGTCCTCAGAGCTGCTGG + Exonic
999658927 5:153838722-153838744 GCTGAAGCCCACAGTCAGGCAGG + Intergenic
999687788 5:154117972-154117994 GCTGGAGCACAGAGAGGAGGTGG - Intronic
999749408 5:154615747-154615769 ACTGGGACCCAGAGAGAAGCAGG - Intergenic
1000334161 5:160229524-160229546 GCTGGAGGCCAGAGAGCAGAGGG - Exonic
1002789341 6:426280-426302 ACTGGAGCCCACGGAGAGGGTGG + Intergenic
1004234307 6:13860423-13860445 GCAGGAGCCAACAGCGAAGGCGG - Intergenic
1004463160 6:15857918-15857940 GCTCCAGCCCCCAGAGTAGCTGG + Intergenic
1004667727 6:17764002-17764024 AGATGAGCCCACAGAGAAGCAGG - Exonic
1004906242 6:20239297-20239319 GCAGGAGCCCACGGAGTGGCGGG - Intergenic
1005394035 6:25362918-25362940 GCTTCAGCCCCCAGAGTAGCTGG - Intronic
1005753224 6:28903038-28903060 GCACGTACCCACAGAGAAGCAGG + Exonic
1006285208 6:33087802-33087824 GCTGGAGTCTGCAGAGAGGCTGG + Intergenic
1006378743 6:33685679-33685701 GCTGGGGCCCAGCGAGTAGCGGG - Exonic
1006429469 6:33986089-33986111 GCTGGAACCGAGAGAGAGGCTGG - Intergenic
1006454447 6:34123859-34123881 GCTGGAGACCAGAGAGAGGAAGG - Intronic
1006794284 6:36722009-36722031 TCCGGTGCCCACAGAGAGGCTGG + Exonic
1007114884 6:39336345-39336367 CCTGGAGGCCACCGAGAGGCTGG - Exonic
1007186920 6:39979630-39979652 GCTCGGGTCCACAGAGAAGAAGG - Intergenic
1007592652 6:43032076-43032098 GCCTGAGCCTCCAGAGAAGCTGG - Intronic
1008173283 6:48234920-48234942 GCTGCACCCCAGAGAGATGCAGG - Intergenic
1009689706 6:67013163-67013185 GCTTCAGCCTACAGAGTAGCTGG + Intergenic
1010066319 6:71686391-71686413 ACAGGAGCCCACGGAGAAGGGGG - Intergenic
1011911521 6:92446705-92446727 GTCAGAGCCAACAGAGAAGCAGG - Intergenic
1012117288 6:95318295-95318317 ATGGGAGCCCACAGAGAAGAAGG + Intergenic
1014081577 6:117292527-117292549 GGTGGAACCCAGAGAGCAGCCGG - Intronic
1015327239 6:131937117-131937139 GCAGAATCACACAGAGAAGCTGG + Intergenic
1015706737 6:136096122-136096144 GCTGGAGCCCACTCAGCACCAGG - Intronic
1016148553 6:140706532-140706554 GCTTCAGCCTACAGAGTAGCTGG - Intergenic
1018621850 6:165736470-165736492 GCTGGGGTCCACAGTGAAGTTGG - Intronic
1018972245 6:168537783-168537805 GCTGGAGCCCACAGGGTGGATGG + Intronic
1020111703 7:5451416-5451438 TGTGGGGGCCACAGAGAAGCTGG - Intronic
1021567417 7:22028921-22028943 ACAGGAGCCCACGGAGCAGCGGG - Intergenic
1021567857 7:22032446-22032468 ACAGGAGCCCACGGAGCAGCGGG + Intergenic
1023074762 7:36471987-36472009 GCTTGAGCCTCCTGAGAAGCTGG + Intergenic
1023212932 7:37827739-37827761 GCTGGAGCCCAGGGATAAGGAGG - Intronic
1023564079 7:41506198-41506220 GTTGCAGCCCAGAGAGAGGCAGG - Intergenic
1023688330 7:42760198-42760220 GCAGGAGGGCCCAGAGAAGCTGG - Intergenic
1023722652 7:43112566-43112588 TCTGGTACCCACAGAGGAGCAGG + Intergenic
1023841087 7:44097806-44097828 GATGGGGCCCACAGACAAACAGG + Intergenic
1023843921 7:44110739-44110761 GCTGAAGCCCACGAAGAAGGTGG - Exonic
1024622528 7:51174579-51174601 ACTGGAGCCCACATAGCAGATGG - Intronic
1025003375 7:55336868-55336890 GGGGGAGCCCACAGACAGGCAGG + Intergenic
1029140629 7:98407256-98407278 GCTGCAGCCTTCAGAGTAGCTGG + Intergenic
1032016177 7:128381663-128381685 GGCGGAGACCACAGAGACGCAGG + Intergenic
1032078120 7:128845765-128845787 GCTGGAGCTCACAGAGGTGCAGG + Intronic
1032079066 7:128849675-128849697 CCAGGAGCCCTCAGAGAAGTGGG - Intronic
1032097742 7:128947823-128947845 GCTGGAGGCCACCCAGGAGCAGG + Exonic
1032407515 7:131667469-131667491 TCTAGAGCCCACAGAGAAGATGG + Intergenic
1034630151 7:152524378-152524400 CCAGGACCCCACAGGGAAGCTGG - Intergenic
1035069317 7:156129738-156129760 CCTGGAGCAGACAGAGAAGCCGG - Intergenic
1035364888 7:158342737-158342759 GCTGGAGCCCATAGAGGAATGGG + Intronic
1035476911 7:159150091-159150113 CCTGGAGTTCAGAGAGAAGCAGG + Intergenic
1036178723 8:6565112-6565134 GCTGGAGGTCACACAGAAGCAGG - Intronic
1037991039 8:23321392-23321414 ACTGGAGCGCACAGTGTAGCTGG + Intronic
1038063440 8:23937375-23937397 GTTGGAGGCCACAGAGAAGTGGG + Intergenic
1038158026 8:25009313-25009335 GCTGGAGCCTCCCGAGTAGCTGG + Intergenic
1038160645 8:25034016-25034038 GCTGGAGCACAGAGAAAAGAGGG + Intergenic
1039124318 8:34184001-34184023 TCTAGAGCTCACAGAGAAACTGG + Intergenic
1039501809 8:38023657-38023679 GCTGGAGGCCAAAGAAAAGGAGG - Intergenic
1039981434 8:42412256-42412278 ACAGGAGCCCTCAGACAAGCGGG + Intergenic
1040562421 8:48535820-48535842 ACTGGAGCCCACACAAAAGAGGG - Intergenic
1041007709 8:53511314-53511336 GTTGGAGGACACAGAGAAGAGGG + Intergenic
1041201209 8:55453068-55453090 CCTGGAGCCCACCGAGGATCAGG - Intronic
1042213502 8:66405093-66405115 GCAGGAGTCCAGAGAGGAGCCGG - Intergenic
1042387776 8:68197420-68197442 GCAGGAGGCAAAAGAGAAGCAGG - Intronic
1044080664 8:87878900-87878922 GCTGCAGCCTCCAGAGTAGCTGG + Intergenic
1044518989 8:93176218-93176240 GCTGGAGGCCACCAAGGAGCTGG + Intergenic
1044918092 8:97137485-97137507 TCTGGACCCCACAGAGTATCAGG - Intronic
1046653665 8:116869766-116869788 GCTGAAAGACACAGAGAAGCTGG + Intronic
1047429145 8:124775777-124775799 TCCTGAGCTCACAGAGAAGCAGG + Intergenic
1047529261 8:125660397-125660419 TCTGGAGGCCTCAGAGAAGGAGG - Intergenic
1048200669 8:132371554-132371576 GCTGGTCCCCACAGAAGAGCAGG + Intronic
1048985349 8:139731997-139732019 GCTGGAGCCCACGAAGGAGACGG + Exonic
1049298118 8:141854692-141854714 GCTACAGCCCCCAGAGGAGCAGG - Intergenic
1049802235 8:144523197-144523219 GCTGGAGCTCACAGCCAACCTGG - Exonic
1050308634 9:4330746-4330768 GTGGGAGCCCACTGAGAAGAGGG + Intronic
1050455221 9:5828302-5828324 GCTGAAGGCAACTGAGAAGCAGG + Intronic
1051573072 9:18582732-18582754 GCTTCAGCCTCCAGAGAAGCTGG - Intronic
1051622066 9:19061047-19061069 GCTGCAGCCTACCGAGTAGCTGG - Intronic
1053042940 9:34890271-34890293 GCTGGAAATCACAGAGAAGGGGG - Intergenic
1055884459 9:81044169-81044191 GTCGGAGCCCACAGTGCAGCTGG + Intergenic
1056727003 9:89127946-89127968 GGTGGAGCCCTCAGAGGAACAGG - Intronic
1057219337 9:93247647-93247669 GCTGCAGCCCAAGGAGCAGCAGG + Exonic
1057592202 9:96382337-96382359 GCTGCAGCCTCCAGAGAAGCTGG - Intronic
1057687931 9:97252907-97252929 GCTGCAGCCTCCAGAGTAGCGGG - Intergenic
1058038001 9:100273931-100273953 GCTAGAGCCCAGAGAGAAAATGG + Intronic
1060568338 9:124614154-124614176 GCTGGAGTTCACAAAGAAGAGGG + Intronic
1060754945 9:126205926-126205948 GCTGAGTCCCACAGAGAAGCTGG + Intergenic
1060849797 9:126865205-126865227 TCTGGAGACCCCAGAGATGCGGG - Intronic
1061124067 9:128662692-128662714 GCTTCAGCCTACAGAGTAGCTGG + Intergenic
1061505980 9:131032154-131032176 CCTGCCGCCCACAGAGAAGTCGG - Exonic
1061919941 9:133777226-133777248 GCTGGAGCCCAGAGAGAAGATGG - Intronic
1062107311 9:134762776-134762798 GCTGAGGCCCACACAGGAGCAGG - Intronic
1062174070 9:135151251-135151273 GCTGGAGCTCACAGTAAGGCAGG + Intergenic
1062288706 9:135785179-135785201 GCTGCAGTCCACACAGCAGCAGG + Intronic
1203751127 Un_GL000218v1:81464-81486 ACTGGAGCCCACTGAGTAGCTGG - Intergenic
1203482859 Un_GL000224v1:22894-22916 ACTGGAGCCCACTGAGTAGCTGG + Intergenic
1185982839 X:4798677-4798699 GGGGGAGCACACAGACAAGCAGG + Intergenic
1186472559 X:9832775-9832797 GCAGGGGCCATCAGAGAAGCGGG - Intronic
1187526126 X:20056740-20056762 CCTGGAGCGCACACAGCAGCTGG - Exonic
1189233268 X:39468913-39468935 TCTGCAGCCCCCGGAGAAGCAGG + Intergenic
1189292416 X:39895655-39895677 GGTGGAGCCCAAAGAGAAGGAGG + Intergenic
1189305668 X:39984895-39984917 GCGGGAGGCCACAGAGAAGCAGG + Intergenic
1192051175 X:67725290-67725312 GCTGGAGCCCTTAGACAAACTGG + Exonic
1194025565 X:88746452-88746474 ACAGGAGCCCACAGAGGAGGGGG + Intergenic
1194138598 X:90179130-90179152 GCTCGAGCTCTCAGAGCAGCTGG - Intergenic
1195379621 X:104257878-104257900 TATGGAGCCCAAAGAGAAGAAGG - Intergenic
1195469842 X:105219470-105219492 CATGGAGACCACAGAGAAGCTGG - Exonic
1196227892 X:113188375-113188397 GCTCCACCCCACAGAGATGCAGG + Intergenic
1196764975 X:119235390-119235412 GCTGGAGCCCAGACAAAGGCGGG - Intergenic
1198366665 X:135946601-135946623 GCCGCAGCCCCCTGAGAAGCGGG - Intergenic
1198834244 X:140784516-140784538 GCTGGAAGACACAGAGATGCTGG - Exonic
1199978138 X:152906151-152906173 GCTGGAACCCTCAGAGAAGATGG - Intergenic
1200142896 X:153910588-153910610 GCTGGAGGCCACAGCGGAGAGGG - Exonic
1200163039 X:154019003-154019025 GGTGGAGGCCACAGGGAAGCAGG + Exonic
1200885261 Y:8261219-8261241 GCCTCAGCCTACAGAGAAGCTGG - Intergenic
1200928875 Y:8679128-8679150 CATGGATCCCACAGAGAAGATGG + Intergenic
1201164782 Y:11199068-11199090 ACTTGAGCCCACTGAGTAGCTGG - Intergenic