ID: 1104005702

View in Genome Browser
Species Human (GRCh38)
Location 12:124890713-124890735
Sequence CTGTAGACACAAATTGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104005700_1104005702 -2 Left 1104005700 12:124890692-124890714 CCCTCATCAATAACTGGCACACT No data
Right 1104005702 12:124890713-124890735 CTGTAGACACAAATTGCAGATGG No data
1104005691_1104005702 26 Left 1104005691 12:124890664-124890686 CCCCCACACTGTCCCACCTTCAG No data
Right 1104005702 12:124890713-124890735 CTGTAGACACAAATTGCAGATGG No data
1104005699_1104005702 3 Left 1104005699 12:124890687-124890709 CCTCACCCTCATCAATAACTGGC No data
Right 1104005702 12:124890713-124890735 CTGTAGACACAAATTGCAGATGG No data
1104005696_1104005702 13 Left 1104005696 12:124890677-124890699 CCACCTTCAGCCTCACCCTCATC No data
Right 1104005702 12:124890713-124890735 CTGTAGACACAAATTGCAGATGG No data
1104005692_1104005702 25 Left 1104005692 12:124890665-124890687 CCCCACACTGTCCCACCTTCAGC No data
Right 1104005702 12:124890713-124890735 CTGTAGACACAAATTGCAGATGG No data
1104005697_1104005702 10 Left 1104005697 12:124890680-124890702 CCTTCAGCCTCACCCTCATCAAT No data
Right 1104005702 12:124890713-124890735 CTGTAGACACAAATTGCAGATGG No data
1104005695_1104005702 14 Left 1104005695 12:124890676-124890698 CCCACCTTCAGCCTCACCCTCAT No data
Right 1104005702 12:124890713-124890735 CTGTAGACACAAATTGCAGATGG No data
1104005693_1104005702 24 Left 1104005693 12:124890666-124890688 CCCACACTGTCCCACCTTCAGCC No data
Right 1104005702 12:124890713-124890735 CTGTAGACACAAATTGCAGATGG No data
1104005701_1104005702 -3 Left 1104005701 12:124890693-124890715 CCTCATCAATAACTGGCACACTG No data
Right 1104005702 12:124890713-124890735 CTGTAGACACAAATTGCAGATGG No data
1104005694_1104005702 23 Left 1104005694 12:124890667-124890689 CCACACTGTCCCACCTTCAGCCT No data
Right 1104005702 12:124890713-124890735 CTGTAGACACAAATTGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104005702 Original CRISPR CTGTAGACACAAATTGCAGA TGG Intergenic
No off target data available for this crispr