ID: 1104017424

View in Genome Browser
Species Human (GRCh38)
Location 12:124970421-124970443
Sequence GCCTGGTGCCTTTTTTCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 5, 3: 35, 4: 310}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104017424_1104017425 -7 Left 1104017424 12:124970421-124970443 CCAAAAGAAAAAAGGCACCAGGC 0: 1
1: 0
2: 5
3: 35
4: 310
Right 1104017425 12:124970437-124970459 ACCAGGCAGACGCCCGCCTCAGG 0: 1
1: 0
2: 3
3: 20
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104017424 Original CRISPR GCCTGGTGCCTTTTTTCTTT TGG (reversed) Intronic
900228796 1:1545508-1545530 GCCTGGAGCTTCCTTTCTTTGGG - Intronic
901312763 1:8282255-8282277 TCCAGTTCCCTTTTTTCTTTTGG - Intergenic
901644304 1:10708521-10708543 GCCTGGTGCCTTCTTCCTATCGG + Intronic
904809605 1:33154797-33154819 GCCTGGCCACTTTTTTTTTTTGG - Intronic
907346834 1:53788896-53788918 GCCTGGGTTCTTTTTTTTTTTGG - Intronic
907370711 1:54001532-54001554 GGCTGGTCCCTTTCTTCTCTGGG + Intergenic
907761618 1:57367358-57367380 GCTAGGTGCCTTTTTTGTCTGGG + Intronic
909060453 1:70873236-70873258 GCTATGTGCCTTCTTTCTTTAGG + Intronic
910032784 1:82750665-82750687 GCCTGATGCCTGATTTCTTTTGG + Intergenic
910096384 1:83526851-83526873 TCCTGGTACTTTTTATCTTTTGG - Intergenic
910454467 1:87382547-87382569 TCCCGTTTCCTTTTTTCTTTTGG + Intergenic
911770732 1:101738886-101738908 ACCTGGTGATTTTTTTTTTTTGG + Intergenic
913139675 1:115928417-115928439 GTCTGAAGCCTTATTTCTTTTGG - Intergenic
913676506 1:121146034-121146056 GCCTGGTGCATTTAATCTTTGGG + Intergenic
914021075 1:143868248-143868270 GCCTACAGCCTTTTTTCTCTTGG - Intergenic
914028402 1:143933984-143934006 GCCTGGTGCATTTAATCTTTGGG + Intergenic
914659566 1:149776175-149776197 GCCTACAGCCTTTTTTCTCTTGG - Intergenic
916797401 1:168179493-168179515 GGCTGTTGCCTGTTTTCTTAGGG + Intronic
917295026 1:173509699-173509721 GCCTGGTTCCTTTTTGTTTCAGG - Exonic
917316027 1:173726331-173726353 TTCTGCTGCCTTTTTTTTTTTGG - Intronic
917583815 1:176404956-176404978 CCCTGGTGCCTTAGTTCTTCTGG + Intergenic
917784982 1:178445217-178445239 GCCTTGTACCTTTTCTTTTTAGG - Intronic
918405368 1:184207073-184207095 GCATGCTGCCATTTTCCTTTTGG + Intergenic
920463872 1:206164875-206164897 GCCTGGTGCATTTAATCTTTGGG + Intergenic
920682849 1:208085684-208085706 GGCTGTTGCCTCTTTTCTCTGGG + Intronic
920748359 1:208650550-208650572 GCCTGGTGCCTTTTTCATAGGGG - Intergenic
921460351 1:215418435-215418457 GCCTGATGCTCTTTTTTTTTTGG - Intergenic
922912884 1:229232276-229232298 CTCTGATGGCTTTTTTCTTTAGG + Intergenic
924628873 1:245718424-245718446 GGCTAGTGCCTTTTTACTATGGG - Intergenic
924660089 1:246007814-246007836 CCCTACTGCCTTTTTTTTTTTGG - Intronic
1064453970 10:15469527-15469549 GCTTGGTGTCTTATTTTTTTTGG + Intergenic
1065007960 10:21396876-21396898 GCATGGTGCCTTTTTCTTATAGG - Intergenic
1065737575 10:28768240-28768262 GCCTGGAGTCTTGTTTGTTTTGG - Intergenic
1066653413 10:37680015-37680037 GGCGGGGGCCTTTCTTCTTTAGG - Intergenic
1068434178 10:56969499-56969521 GGCTGATGCTTTTTTTCTTGTGG - Intergenic
1069397750 10:68008362-68008384 GCCTGGGGTCTTTTATCTTCAGG + Intronic
1072438483 10:95434377-95434399 GCCTTGCCCCTCTTTTCTTTAGG - Intronic
1072688654 10:97554882-97554904 GCCTGGTCTCTTTCTTCTGTGGG + Intronic
1074440553 10:113474062-113474084 GACTAGAGACTTTTTTCTTTTGG + Intergenic
1076264237 10:129097133-129097155 TCCTGGTGCATTTTTTGCTTGGG - Intergenic
1076640103 10:131909628-131909650 GCCAGCTGCCTGTTTTCTGTAGG - Intronic
1077701193 11:4443839-4443861 GCCTGTTTCCTTTTTCTTTTGGG + Intergenic
1079080350 11:17409532-17409554 TCTTTGGGCCTTTTTTCTTTGGG + Intronic
1079499291 11:21084613-21084635 CCCTGGTGCCTCTATTCTCTTGG - Intronic
1079807401 11:24950693-24950715 AACTGGTGCTTTTTTTCTTTGGG - Intronic
1079876008 11:25858173-25858195 CCCTGCTTTCTTTTTTCTTTTGG + Intergenic
1079976108 11:27093545-27093567 GCCTGGTGTCTTTGGGCTTTTGG - Intronic
1080183368 11:29450055-29450077 GCCTGATGCCTTTGTCCTTAAGG - Intergenic
1082567259 11:54695745-54695767 GCCTCCGGCCTTTGTTCTTTTGG + Intergenic
1083839525 11:65296113-65296135 CCCTGTGGCCTTGTTTCTTTGGG + Intronic
1084081047 11:66825173-66825195 GCCTGGGGCCTTTTTTATAAAGG - Intronic
1084081097 11:66825494-66825516 CTCTGGGGCCTTTTTTTTTTTGG - Intronic
1084162118 11:67355593-67355615 GCCTATTGCCTTTTCTCCTTGGG + Intronic
1084401501 11:68946503-68946525 GCCTGGAGCCTTTTTTCCTGTGG + Intergenic
1084422680 11:69068192-69068214 GGCTGGTGCCTTTCATCTTGCGG + Intronic
1084806011 11:71579395-71579417 TCCTGGTGCCGTTTGTCTATTGG - Intergenic
1085234509 11:75003336-75003358 GGCTGGTCCCTTTTTCCCTTAGG - Intronic
1087690894 11:101319792-101319814 CCCTGGTGCCTTATTTCATTTGG + Intergenic
1087965707 11:104411555-104411577 TCATGGTGACTTGTTTCTTTAGG - Intergenic
1088894705 11:114069082-114069104 GCCTGGTTCCTTTTTGTTTTTGG + Intronic
1088972731 11:114787876-114787898 GCCTGGGACCTCTTTTCTTTGGG + Intergenic
1089281614 11:117378867-117378889 GTCTGCTGCCTTTTTTCTTATGG + Intronic
1091015948 11:132050813-132050835 GGCTGGTGTCTCTTCTCTTTTGG + Intronic
1091147644 11:133293691-133293713 GCCTTGATCCTTTCTTCTTTGGG - Intronic
1092162396 12:6323022-6323044 GCAGGCTGCCTTTTTTCCTTCGG + Intronic
1093176608 12:15919819-15919841 AACTGGTGTCTTTGTTCTTTTGG + Intronic
1093571651 12:20672402-20672424 GCCTCCAGCCTTTGTTCTTTTGG - Intronic
1094047122 12:26179320-26179342 GGCTGGTGCTTTTATACTTTGGG + Intronic
1094490997 12:30960529-30960551 GTCTGCTGCCTTATTTCTCTCGG + Intronic
1094655729 12:32418254-32418276 CCCTGGTGCCTTAGTTCTTTGGG + Intronic
1095411828 12:41932962-41932984 GCCTGGTTCCTTTGTGCTTTAGG + Intergenic
1096548027 12:52354640-52354662 GTATGGTTCCTTCTTTCTTTTGG + Intergenic
1096676692 12:53230149-53230171 CCCAGGTGCCTTGGTTCTTTGGG + Intronic
1097799620 12:63899336-63899358 ACCTGGTTCCTTTTTTTTTTTGG - Intronic
1098150256 12:67539221-67539243 GCCTTGTGCCTTTTCACTGTGGG + Intergenic
1098344784 12:69490603-69490625 GCCAGATGGTTTTTTTCTTTTGG + Intronic
1098956206 12:76692503-76692525 GCCTGCAGCTTTTTTTCTCTTGG - Intergenic
1100425387 12:94480031-94480053 GCGTGATGCCTTCTTACTTTTGG - Intergenic
1102989816 12:117306941-117306963 GCCTGTTTCCTTTTTGTTTTAGG + Intronic
1104017424 12:124970421-124970443 GCCTGGTGCCTTTTTTCTTTTGG - Intronic
1105284607 13:18994010-18994032 GCCTTCTGCCTTCTTCCTTTTGG - Intergenic
1106528944 13:30569434-30569456 GCCTAGTTCCTTTTTCATTTTGG + Intronic
1106811972 13:33367684-33367706 GCCTGATGCCATCTTACTTTGGG - Intergenic
1108043168 13:46358094-46358116 GCCTGGGGTATCTTTTCTTTAGG - Intronic
1108176527 13:47798332-47798354 GTCTGCAGCCTTTTGTCTTTTGG - Intergenic
1109316439 13:60754929-60754951 GCTTGCTGCCTTTTCTCTGTGGG + Intergenic
1109383184 13:61592409-61592431 TACTGGTGCATTGTTTCTTTTGG - Intergenic
1109806291 13:67448498-67448520 GCCTGTGGGCTTTTTTTTTTTGG + Intergenic
1111449283 13:88392235-88392257 ACCTGGTGCCTAATTTTTTTTGG - Intergenic
1113878308 13:113608211-113608233 GCACAGTGCCTTTTTTCTGTTGG - Intronic
1114158941 14:20140873-20140895 GTTTGGTGCTTTTTTTTTTTCGG + Intergenic
1115443106 14:33458765-33458787 GCCTAGTATCCTTTTTCTTTTGG - Intronic
1117203167 14:53413117-53413139 GCCTGGGGACTGTTTTTTTTTGG + Intergenic
1118024163 14:61751741-61751763 ACTTGGTGCCGTTTTTATTTTGG + Intergenic
1118331520 14:64819239-64819261 GCCAGATGGCTTGTTTCTTTAGG + Intronic
1118561083 14:67083464-67083486 GCATAGTGGCTTTTTTCTTCTGG - Intronic
1118605739 14:67502031-67502053 GTCTGTTGCCTTTTTTCTTTAGG - Intronic
1120027369 14:79601338-79601360 GCCTGTTGCCTTGTTTCTGATGG + Intronic
1120288272 14:82533491-82533513 TCCTGATTCCTTTTTTCTCTAGG + Intergenic
1121767148 14:96497757-96497779 ACCTAGTGCCTGTTTTCTTGTGG - Intergenic
1124862722 15:33458747-33458769 GCCTGGTTTCTTTTTTCTCAAGG - Intronic
1124871707 15:33550023-33550045 GCCTGGTGCGTTTTCCCTTAAGG + Intronic
1125106259 15:35975074-35975096 GCTGGGTTACTTTTTTCTTTAGG - Intergenic
1127022297 15:54761345-54761367 TACTGGTGCCTTATTTCATTCGG - Intergenic
1127106663 15:55623605-55623627 GCCTGGGGCCTGTTTTTGTTTGG - Intronic
1129069747 15:72940783-72940805 CCCTGGGGCCTTCTTGCTTTGGG + Intergenic
1130065761 15:80603888-80603910 GCCTGGCATCTTTTTTGTTTTGG + Intergenic
1131825386 15:96318208-96318230 TCCTTCTGCCTTTTTGCTTTTGG - Intergenic
1132032161 15:98447079-98447101 TCCTGGTGCCTCTCTTCTTAAGG + Intronic
1135195908 16:20394430-20394452 GCCTGGTTTCTTTTTCCTCTTGG + Intronic
1135552604 16:23409611-23409633 GGCTGATGCCTTTATTCCTTAGG - Intronic
1136164690 16:28445555-28445577 GTCTGCTTCCTTTTTTTTTTTGG + Intergenic
1136198276 16:28669426-28669448 GTCTGCTTCCTTTTTTTTTTTGG - Intergenic
1136214622 16:28783602-28783624 GTCTGCTTCCTTTTTTTTTTTGG - Intergenic
1136259343 16:29063447-29063469 GTCTGCTTCCTTTTTTTTTTTGG - Intergenic
1138941014 16:61789847-61789869 GCCTAGTGCCATCTTGCTTTGGG - Intronic
1140041145 16:71409080-71409102 GGCTGATGCCTTTTGGCTTTAGG - Intergenic
1140526295 16:75625694-75625716 ACCTGGTGCCATATTTCTTTGGG + Intergenic
1141384250 16:83604597-83604619 GCCTGGGGGCTTTTTTTTCTAGG + Intronic
1142580198 17:937249-937271 GCTGGGTGCATTTTTTCTTAAGG + Intronic
1142788429 17:2243920-2243942 GCCTGGTGCCTCTTTAGTATAGG - Intronic
1146426183 17:32741526-32741548 GCCTGATGCCTTTATTTGTTGGG + Intronic
1148023769 17:44570947-44570969 GCCTGGTCCATTTTTTAATTGGG + Intergenic
1148874186 17:50676866-50676888 TCCTGTTGGCTTTTTTTTTTTGG + Intronic
1148913593 17:50956500-50956522 GCCTGGCCCCTTCTTTCATTTGG + Intergenic
1149466008 17:56879682-56879704 GCCTGGCCTATTTTTTCTTTAGG + Intergenic
1151352323 17:73539130-73539152 GCCTGGTTCCTCTTCTCTTTGGG - Intronic
1153404736 18:4724394-4724416 GCCTGGTGCTTTTTGTGTTTTGG - Intergenic
1154128361 18:11714257-11714279 GACTTGTGTCTTTTTTCCTTGGG - Intronic
1154307063 18:13238442-13238464 ACCTGATGCCTTCTTTATTTGGG + Intronic
1155797811 18:30061972-30061994 GCCTAGTGCTTTCTTTCTTTGGG - Intergenic
1155802604 18:30127730-30127752 GCCTGCTCCCATTTTCCTTTGGG + Intergenic
1158084894 18:53639556-53639578 GCCTCGTGTTTTTTTTCTTTAGG - Intergenic
1158263388 18:55633875-55633897 GTTTTGTGCCTTTTTTGTTTTGG - Intronic
1159860363 18:73641377-73641399 GGCTGTTGCCATTTTTCTATTGG + Intergenic
1161512152 19:4677791-4677813 GCCTGGTTACTTTTTCCTCTTGG + Intronic
1164163143 19:22643873-22643895 TCCTAGAGCCTCTTTTCTTTGGG + Intronic
1165493162 19:36137030-36137052 CCCTGCTGCCTTTTTTTTTCTGG - Intergenic
1166162336 19:40964094-40964116 ACATTGTGCCTTTTTTTTTTTGG - Intergenic
1168001017 19:53446064-53446086 GCCCTGTGCCTTTCTTCTTCAGG + Intronic
925319768 2:2953646-2953668 TTCTGGGGTCTTTTTTCTTTTGG - Intergenic
926307812 2:11651849-11651871 TCCAGGTGATTTTTTTCTTTGGG - Intergenic
926855417 2:17251168-17251190 GCCTCGTGGCTTTTATCATTTGG + Intergenic
927482461 2:23465199-23465221 TCCTGGTGGCTTTGTTCTCTGGG - Intronic
928538239 2:32260647-32260669 CCCAGGTGGCTTTTTTCTATGGG - Intronic
929091991 2:38227317-38227339 GCATGGTGCATTCTTTTTTTTGG - Intergenic
930646907 2:53920260-53920282 GTCTTTTGCCTTTTATCTTTTGG - Exonic
931345523 2:61441642-61441664 GCCTGGTTAATTTTTTTTTTTGG - Intronic
931423385 2:62148784-62148806 GCCTGGCCCTGTTTTTCTTTTGG + Intergenic
933188497 2:79305744-79305766 GCCAAGTGCCTTGTTTCTTAAGG - Intronic
935745934 2:106190348-106190370 ACCTAGTGACTTTGTTCTTTGGG - Intronic
937119151 2:119430181-119430203 GCCTGGTGCCTCTCTGCTCTGGG - Intronic
937440573 2:121912051-121912073 TCCTGGTTCCTTTAATCTTTGGG + Intergenic
938159684 2:128973942-128973964 CCCAGGTGCCTTTTATCTTGGGG - Intergenic
940032112 2:149274476-149274498 ACCTGGTGTCTTTGATCTTTAGG + Intergenic
940478572 2:154198377-154198399 GCTTGGTGACTTTTTTATTGTGG + Intronic
940847081 2:158653051-158653073 GGCTGTTGCTTTTTTGCTTTTGG + Intronic
941055357 2:160781769-160781791 GCCTTGTGTATGTTTTCTTTAGG - Intergenic
941144068 2:161821278-161821300 GGCTGATACCTTTATTCTTTAGG + Intronic
942176592 2:173340540-173340562 GCCTAGGAGCTTTTTTCTTTTGG - Intergenic
942394167 2:175528655-175528677 ACTTGGAGGCTTTTTTCTTTTGG + Intergenic
942411373 2:175712636-175712658 GCCTGGTGCTATGCTTCTTTTGG - Intergenic
942592366 2:177559701-177559723 GGCTGATGACATTTTTCTTTTGG - Intergenic
942981926 2:182093355-182093377 GCCTGGAGCCTTTTTCCTGGAGG - Intronic
943815835 2:192253174-192253196 CCCTTGGGCCTTTTTTTTTTTGG - Intergenic
943996809 2:194778351-194778373 ACCTAGTGCTTTTTTTTTTTTGG + Intergenic
944555887 2:200887692-200887714 GCCTAATTCTTTTTTTCTTTTGG - Intronic
945951627 2:216044399-216044421 ACCTCGTGCCTTTTATGTTTTGG + Intronic
946450769 2:219777157-219777179 GGCTGTGGCCTTTTTGCTTTTGG + Intergenic
946767942 2:223057472-223057494 GCATGCTGGCTTTTCTCTTTGGG + Intronic
946990549 2:225324635-225324657 GCCTGAGGCCTTATTTCATTGGG + Intergenic
948385207 2:237576555-237576577 AGCTGGGGCCTTTTCTCTTTGGG + Intronic
1169150275 20:3284013-3284035 GCCTGGGGCCTTCTCTCTTGAGG - Intronic
1170122626 20:12927019-12927041 GCATGGTGCCTCTGTTCTCTGGG + Intergenic
1171972162 20:31571167-31571189 GCCTGGTGCCATTTTTCCATGGG - Exonic
1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG + Intronic
1172316991 20:33963474-33963496 GCCTGGTTCCTGTTTTCGTAAGG + Intergenic
1172358607 20:34296740-34296762 TCCTGGTGATTTTTATCTTTAGG + Intronic
1173971677 20:47157793-47157815 ACCTGGTGCCTTTTTTGGTGGGG - Intronic
1174388290 20:50199971-50199993 CCCCAGTGCCTTTTGTCTTTCGG - Intergenic
1174702217 20:52620506-52620528 GGCTGGCTCCTTTTATCTTTTGG + Intergenic
1175733662 20:61371022-61371044 GCCTGGGGGATTTTTTATTTGGG + Intronic
1177221720 21:18202410-18202432 TCCTGGTGCCTCTTTTCATAAGG - Intronic
1178703048 21:34850289-34850311 GCCTGCTGCCTGTGTCCTTTGGG - Intronic
1179250936 21:39670725-39670747 GCCTGTTTTTTTTTTTCTTTTGG - Exonic
1182930038 22:34164757-34164779 GCTTGGTGCCTGTGTTCTTTTGG + Intergenic
1183867853 22:40718390-40718412 GCCTGGGGGCTTCTTTTTTTAGG - Intergenic
1184215346 22:43063266-43063288 GCCTGCTGCCTTCTTTCTCCAGG + Intronic
949643552 3:6067334-6067356 GCCTACAGCCTTTTTTCTCTCGG + Intergenic
950767957 3:15287843-15287865 GCCTGGCCCCTCTTGTCTTTCGG - Intronic
954190335 3:48955368-48955390 CCCTGGATCCATTTTTCTTTTGG + Intronic
954534645 3:51350331-51350353 GCCTGGAGCCTGAGTTCTTTCGG + Exonic
955274206 3:57532338-57532360 TCCTGGTGCCTTATTTAGTTTGG + Intronic
955605946 3:60703817-60703839 GCCTGGTGCCTTTTTTCTAGTGG + Intronic
956462655 3:69486705-69486727 GCCTTGAGCCTTCTTGCTTTGGG - Intronic
957575553 3:82002771-82002793 GCCTGATCTCTTTGTTCTTTAGG + Intergenic
958501909 3:94921868-94921890 GCTATGTGCCTTTTCTCTTTGGG + Intergenic
958634311 3:96723491-96723513 ACCTGTCGCCTTTTTGCTTTCGG + Intergenic
959640045 3:108622467-108622489 AACTGGTGCCTTTTTTGGTTTGG + Intronic
959964020 3:112333471-112333493 GCCTGGTGCATCTTTTTTTCAGG - Intronic
960825759 3:121782483-121782505 GCCTGCTGCCTGTTTTCATAGGG + Intronic
960971902 3:123145812-123145834 GCCTGCTCCCTCTTTTCTCTGGG + Intronic
961618950 3:128207996-128208018 GCCTGTTTCTTTTTTTCCTTTGG + Intronic
961708515 3:128808493-128808515 GACTGGTAACTTTTTTCCTTAGG + Intronic
962135686 3:132729524-132729546 GTCTGGTGCTTTTTGCCTTTTGG - Intergenic
962417467 3:135196286-135196308 GCCTAGGGCCTGTTTTCATTTGG + Intronic
965865354 3:173198963-173198985 GCTTGTTGCCTCTTTTTTTTTGG - Intergenic
966272779 3:178128432-178128454 GCCATGTGCAATTTTTCTTTTGG - Intergenic
966332746 3:178833350-178833372 GTTTGGTGCCTTTTTTCCCTGGG - Intronic
971269189 4:25123030-25123052 CACTGGTGCATTTTTCCTTTTGG - Exonic
973301958 4:48595129-48595151 GTCTGGTGGCTGTTTTATTTTGG + Intronic
975559396 4:75695144-75695166 GTCTGATGCCTTTTTTGTTTAGG - Intronic
975711126 4:77160513-77160535 CCCTGCTGCCTTTTTTTTTGGGG + Intronic
976530658 4:86148843-86148865 GCCTGATGTCTTCTGTCTTTTGG - Intronic
978197192 4:105985122-105985144 GCCTGGTGCTGGTTTTCATTTGG + Intronic
978945477 4:114490737-114490759 GGCTGGTCACTTCTTTCTTTTGG + Intergenic
980978116 4:139630615-139630637 GACTGATGACTCTTTTCTTTGGG + Intergenic
981182759 4:141765064-141765086 GCCTAGTACCTTGTTTTTTTCGG + Intergenic
981739527 4:147987559-147987581 GCTTGGTGCCTGTCTTCTCTGGG + Intronic
982068207 4:151673031-151673053 GCCAGGTGCCCTTTCCCTTTGGG - Intronic
982293358 4:153802167-153802189 GCCAGTTGCCTCTTTTGTTTTGG - Intergenic
983055978 4:163099450-163099472 GGCTGTTTTCTTTTTTCTTTTGG - Intergenic
983244834 4:165275966-165275988 GCCTGGCTCTTTTTTTTTTTTGG - Intronic
983550714 4:169014752-169014774 ACCTGGTGCCTGTTTTCGTTGGG + Intergenic
984055407 4:174922947-174922969 GTTTCGTGTCTTTTTTCTTTTGG - Intronic
984163667 4:176283552-176283574 GCTTGCTGCCTTTTTTATATAGG - Intergenic
984232598 4:177117001-177117023 GCCTCATTCCTTCTTTCTTTAGG - Intergenic
984697593 4:182794939-182794961 TCCTGTTGTCTTTTTTTTTTGGG + Intronic
986316194 5:6588787-6588809 GCCTAGTGCCTCTTTTCTTGGGG + Intergenic
986497180 5:8356145-8356167 GCCAGGAGCCTCTTTTCCTTAGG - Intergenic
988739541 5:34056670-34056692 GCCTGGCTAATTTTTTCTTTTGG + Intronic
988944119 5:36178008-36178030 GCCTGGTCCATCTTTCCTTTGGG + Intronic
989640655 5:43579369-43579391 CCTTTCTGCCTTTTTTCTTTGGG - Intergenic
989971913 5:50535259-50535281 GCCTGTAGATTTTTTTCTTTAGG + Intergenic
990239020 5:53798497-53798519 GCCCGGCGCCTGTTTTCTTAAGG + Intergenic
991675546 5:69087011-69087033 GCCTGGTACATTTTTCTTTTAGG - Intergenic
994505564 5:100639350-100639372 GCCAGGTGCCTGGTTTCTTCAGG - Intergenic
994553924 5:101272528-101272550 GCCTTGTTCCTGTTTTGTTTAGG - Intergenic
995827899 5:116321679-116321701 GCCTGGGTCCTTTTTTGTTAGGG + Intronic
996317554 5:122177620-122177642 GCCTGGTGACTTTATCTTTTTGG - Intronic
998035246 5:138909632-138909654 CCCAGGTCTCTTTTTTCTTTTGG + Intronic
998261115 5:140632587-140632609 GCATGGTGCCGGTTATCTTTAGG + Exonic
999161355 5:149502501-149502523 GCCTGGCGCTTTTTTTTTTTGGG + Intronic
999455010 5:151707906-151707928 GGCTGGTGCCTTTTGTCCCTTGG - Intergenic
1002767984 6:259311-259333 CACTGGTGCCTCTTTTGTTTTGG + Intergenic
1002880908 6:1251584-1251606 GCCTCCTGCCCTGTTTCTTTGGG + Intergenic
1004111718 6:12724888-12724910 GCCTAGTGACTTTTGTCATTTGG - Intronic
1004354868 6:14922053-14922075 CCCTGGTGCCTTTTCTCAGTCGG + Intergenic
1006367233 6:33622680-33622702 GCGTGGTGCCTTCTTTCTGATGG + Intronic
1006875518 6:37292059-37292081 GCCTGATGCTTTGTTTCCTTAGG + Intronic
1006931923 6:37693862-37693884 GCCAGGTGGCTTTGTTCTTTGGG - Intronic
1006976476 6:38106994-38107016 GTCTGGTGAATTTTTTCCTTAGG + Intronic
1006979736 6:38137561-38137583 TCTTGGTGCTTTTATTCTTTAGG + Intronic
1007022612 6:38537256-38537278 GTCTGATGCCTTTGTTCATTTGG - Intronic
1008237706 6:49070136-49070158 GACTCATGCCTTTGTTCTTTTGG - Intergenic
1008880921 6:56379220-56379242 CCCTGGTGCCTTATTGCATTTGG - Intronic
1009428163 6:63537536-63537558 GCCAGTTGGCTTTTTTCTCTGGG - Intronic
1011546905 6:88491462-88491484 GGCTTCTGCCTTTCTTCTTTGGG - Intergenic
1015129663 6:129795090-129795112 GCCTGGGGATTTTTTTTTTTTGG + Intergenic
1015975025 6:138781394-138781416 GGCTGGTGCCTCTATTCTTTTGG + Intronic
1016411754 6:143790574-143790596 GCCTTTTGCCCATTTTCTTTTGG + Intronic
1016463134 6:144299524-144299546 ACCTGGTGCATTTCTTATTTTGG + Intronic
1017266862 6:152456580-152456602 GTCTGCTGCCTTTTTTTATTAGG - Intronic
1019268631 7:133713-133735 ACCTGGAGCCCTTTTTCTTGAGG + Intergenic
1019696846 7:2450965-2450987 CCCTTGTGGGTTTTTTCTTTGGG + Intergenic
1021863130 7:24927202-24927224 CCCTGCTGGCTTCTTTCTTTTGG - Intronic
1023846558 7:44123989-44124011 GCCTTGGGCCTTCTTTCTGTTGG - Intronic
1023988631 7:45113816-45113838 CCCTTGTAACTTTTTTCTTTAGG + Intergenic
1024119884 7:46225963-46225985 CACTGGTGCCTTGTTTCTCTGGG + Intergenic
1024568897 7:50708389-50708411 CCCTGCTGCCTTTTGTGTTTTGG - Intronic
1025161914 7:56668633-56668655 GCCTGGTACCTTTTTCCAGTTGG - Intergenic
1025921769 7:65920007-65920029 CCCTGGTGTTTTTTTTCTTGTGG + Intronic
1026277492 7:68892806-68892828 GAATGTTGCCTGTTTTCTTTTGG - Intergenic
1027560154 7:79719205-79719227 GCCTGTGGCCTCTTTTGTTTTGG - Intergenic
1029002005 7:97164224-97164246 GCCTGGCCTCTTTTTTTTTTTGG + Intronic
1029908690 7:104120540-104120562 GTGTGATGCCTTTGTTCTTTTGG + Intergenic
1030299543 7:107961423-107961445 GACTGCTGACTTTTTTCCTTTGG - Intronic
1030432947 7:109475410-109475432 GTCTCTTGCCTCTTTTCTTTCGG - Intergenic
1031442161 7:121807954-121807976 GCCTGGTGCCATGTTTCTCTTGG + Intergenic
1032267110 7:130377445-130377467 GCCTGGTGGCTTCTTTCTCATGG + Intergenic
1032534553 7:132651488-132651510 GCCTTTTGCTCTTTTTCTTTTGG - Intronic
1033193411 7:139304883-139304905 CCCTTATGCCTTATTTCTTTGGG - Exonic
1035475108 7:159137790-159137812 GCCTGGTCACTTTTTTCTTTTGG - Intronic
1037295798 8:17398190-17398212 TCCTGGTGCCTTGGTTCATTTGG - Intronic
1037725720 8:21481071-21481093 GCCTGGTGCCTTTCCTCCTGAGG + Intergenic
1039032202 8:33322648-33322670 GCCTGTTGTCTTTGTCCTTTTGG - Intergenic
1039875217 8:41578735-41578757 GCATGCTCCCATTTTTCTTTAGG + Intronic
1040064724 8:43136589-43136611 GCCTGGTTCCTTTTTTTTTGTGG + Intergenic
1041422508 8:57683862-57683884 TCCTCCTCCCTTTTTTCTTTGGG - Intergenic
1042615292 8:70642450-70642472 ACCTAGTCCCTTTTTCCTTTTGG + Intronic
1045994482 8:108346458-108346480 ACCTGGTGAATTTTTGCTTTGGG - Intronic
1046667203 8:117017509-117017531 GGCTGGTGCCTTGCTTCTATTGG - Intronic
1046966399 8:120171642-120171664 GCTTGCTGTCTTTTATCTTTGGG + Intronic
1047019803 8:120762811-120762833 GCCTAGTATTTTTTTTCTTTCGG - Intronic
1047224729 8:122946650-122946672 GCCTGATGTCTTTTTTCTGCAGG + Intronic
1047497439 8:125418666-125418688 GCCTGGCCACTTTTTTTTTTAGG + Intergenic
1049650578 8:143766235-143766257 TGCTGCTGCCTTTTTTCTTACGG + Intergenic
1049983088 9:922678-922700 AAATGGTGCCTTATTTCTTTTGG + Intronic
1050202931 9:3167385-3167407 GTCCTTTGCCTTTTTTCTTTTGG + Intergenic
1050993313 9:12180430-12180452 GCCAGCTGTATTTTTTCTTTTGG - Intergenic
1051002389 9:12299990-12300012 GCCTGTTTCCTCTTTTCTCTGGG + Intergenic
1052279068 9:26712452-26712474 TCCTGGTGCCTTATTTCTTTGGG + Intergenic
1053575515 9:39355384-39355406 ACCTGGTTCCTTTTATCTGTTGG - Intergenic
1053840021 9:42183323-42183345 ACCTGGTTCCTTTTATCTGTTGG - Intergenic
1054097075 9:60914071-60914093 ACCTGGTTCCTTTTATCTGTTGG - Intergenic
1054118482 9:61189700-61189722 ACCTGGTTCCTTTTATCTGTTGG - Intergenic
1054589274 9:66992864-66992886 ACCTGGTTCCTTTTATCTGTTGG + Intergenic
1054797753 9:69318292-69318314 GTCAGGTGCCTTTTTTCTTTGGG - Intergenic
1055239874 9:74170627-74170649 GCCTAGTGGCTTTTTTATTTGGG + Intergenic
1055397100 9:75887954-75887976 GCCTGGAGATTTTTTTCTTGGGG - Intergenic
1055987270 9:82063983-82064005 ACCTGGTTCCTTTTATCTGTTGG + Intergenic
1056338986 9:85604623-85604645 CCCTGGTGCCTTTGTTCATTTGG - Intronic
1056583641 9:87914216-87914238 ACCTGGTTCCTTTTATCTATTGG - Intergenic
1056584133 9:87917685-87917707 ACCTGGTTCCTTTTATCTATTGG - Intergenic
1056612735 9:88135240-88135262 ACCTGGTTCCTTTTATCTATTGG + Intergenic
1056613233 9:88138730-88138752 ACCTGGTTCCTTTTATCTGTTGG + Intergenic
1056663122 9:88559193-88559215 GCTTGGTGCCTTTTCTCTGTTGG + Intronic
1056972340 9:91216768-91216790 GCCTGGGGCCTTCACTCTTTTGG + Intronic
1057079831 9:92164955-92164977 GCCTGATGCCTTTTATCTTCAGG - Intergenic
1057159907 9:92882297-92882319 ACCTGGTTCCTTTTATCTGTTGG - Intergenic
1058738453 9:107918867-107918889 GCCTGCTGCCTTTATTGTTCTGG + Intergenic
1059235695 9:112759023-112759045 ATCTGGTGCCTTTTTTTTGTGGG + Intronic
1059502511 9:114767015-114767037 GCCTGTTTCCTTATTTCTATAGG + Intergenic
1059600624 9:115773967-115773989 GGATGGTGCCTTTTCACTTTCGG - Intergenic
1061111728 9:128577107-128577129 AACTGGTGCCTTTGTTCTGTAGG + Exonic
1186573301 X:10738472-10738494 GTCTGGGGTCTTTTTTCTCTAGG + Intronic
1187544985 X:20241517-20241539 GCCTGTTTTTTTTTTTCTTTAGG - Intronic
1187877024 X:23812812-23812834 GCCTGGTGACTATTTACTCTTGG - Intergenic
1188019168 X:25138181-25138203 ACCTGTAGCCTTTTCTCTTTTGG + Intergenic
1189565824 X:42240103-42240125 GCCTGGTAACCTTTTTCTGTTGG - Intergenic
1191197321 X:57738093-57738115 CTCTGGTGCCTTATTTCATTTGG - Intergenic
1191258518 X:58290274-58290296 GCCTCGTCACTTTTTTCCTTGGG - Intergenic
1191640884 X:63429031-63429053 GCCGGGTGCCTTTTTAAATTTGG + Intergenic
1191827060 X:65376912-65376934 TCCTGGTGCCTTATTTAGTTTGG - Intronic
1192342661 X:70277178-70277200 GCCTGATGCCTGTTTTCCTATGG - Intronic
1192506112 X:71684813-71684835 GCCTGGAGCCTTTAATCCTTGGG + Intergenic
1192520585 X:71796735-71796757 GCCTGGAGCCTTTAATCCTTGGG - Intergenic
1193729321 X:85083129-85083151 GTCTGGTGCCCTTTATCTTCTGG + Intronic
1193971687 X:88063079-88063101 GCCGGCTGGCTATTTTCTTTGGG + Intergenic
1194110181 X:89824268-89824290 GCCTGGTGCCCTATTACTGTGGG - Intergenic
1194500156 X:94672613-94672635 GGCTTGTACCTTTTTTGTTTTGG - Intergenic
1195199911 X:102538928-102538950 CCCTGGTGCCTTATTTAGTTTGG + Intergenic
1195317675 X:103694692-103694714 GCCTGGTATCTTTTTTCCCTTGG - Intergenic
1196155695 X:112426954-112426976 GCCTGGTGCCTTCTGTTTTTTGG - Intergenic
1197675955 X:129330074-129330096 GCCTATTGCCTGATTTCTTTGGG - Intergenic
1199316208 X:146380496-146380518 CCCTGGTGCCTTATTTCATTCGG - Intergenic
1200407885 Y:2832242-2832264 CCTTGCTGCCTTTTTTTTTTTGG + Intergenic
1200462838 Y:3479009-3479031 GCCTGGTGCCCTATTACTGTGGG - Intergenic
1200905739 Y:8480342-8480364 GCATCGTGCCCTTTTTCTCTGGG + Intergenic
1201350258 Y:13032209-13032231 GCTTGGTAATTTTTTTCTTTTGG - Intergenic
1202580135 Y:26371815-26371837 GCCTGATTTCTTTTTTTTTTTGG - Intergenic