ID: 1104021699

View in Genome Browser
Species Human (GRCh38)
Location 12:124996413-124996435
Sequence GCTACTCAGGAGGCTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 701844
Summary {0: 77881, 1: 176222, 2: 210480, 3: 146546, 4: 90715}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104021699_1104021706 0 Left 1104021699 12:124996413-124996435 CCTGCCTCAGCCTCCTGAGTAGC 0: 77881
1: 176222
2: 210480
3: 146546
4: 90715
Right 1104021706 12:124996436-124996458 CGGGATTACAAGTGAGTAGCCGG 0: 1
1: 0
2: 1
3: 6
4: 57
1104021699_1104021709 28 Left 1104021699 12:124996413-124996435 CCTGCCTCAGCCTCCTGAGTAGC 0: 77881
1: 176222
2: 210480
3: 146546
4: 90715
Right 1104021709 12:124996464-124996486 CAAGTGAGCACCACCACATCCGG 0: 2
1: 28
2: 478
3: 3815
4: 15197
1104021699_1104021707 1 Left 1104021699 12:124996413-124996435 CCTGCCTCAGCCTCCTGAGTAGC 0: 77881
1: 176222
2: 210480
3: 146546
4: 90715
Right 1104021707 12:124996437-124996459 GGGATTACAAGTGAGTAGCCGGG 0: 1
1: 0
2: 3
3: 13
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104021699 Original CRISPR GCTACTCAGGAGGCTGAGGC AGG (reversed) Intronic
Too many off-targets to display for this crispr