ID: 1104021701

View in Genome Browser
Species Human (GRCh38)
Location 12:124996417-124996439
Sequence CCCGGCTACTCAGGAGGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 696021
Summary {0: 701, 1: 95820, 2: 202114, 3: 238699, 4: 158687}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104021701_1104021706 -4 Left 1104021701 12:124996417-124996439 CCTCAGCCTCCTGAGTAGCCGGG 0: 701
1: 95820
2: 202114
3: 238699
4: 158687
Right 1104021706 12:124996436-124996458 CGGGATTACAAGTGAGTAGCCGG 0: 1
1: 0
2: 1
3: 6
4: 57
1104021701_1104021707 -3 Left 1104021701 12:124996417-124996439 CCTCAGCCTCCTGAGTAGCCGGG 0: 701
1: 95820
2: 202114
3: 238699
4: 158687
Right 1104021707 12:124996437-124996459 GGGATTACAAGTGAGTAGCCGGG 0: 1
1: 0
2: 3
3: 13
4: 141
1104021701_1104021709 24 Left 1104021701 12:124996417-124996439 CCTCAGCCTCCTGAGTAGCCGGG 0: 701
1: 95820
2: 202114
3: 238699
4: 158687
Right 1104021709 12:124996464-124996486 CAAGTGAGCACCACCACATCCGG 0: 2
1: 28
2: 478
3: 3815
4: 15197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104021701 Original CRISPR CCCGGCTACTCAGGAGGCTG AGG (reversed) Intronic
Too many off-targets to display for this crispr