ID: 1104021703

View in Genome Browser
Species Human (GRCh38)
Location 12:124996423-124996445
Sequence TGTAATCCCGGCTACTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 632421
Summary {0: 406, 1: 55626, 2: 143238, 3: 230507, 4: 202644}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104021703_1104021707 -9 Left 1104021703 12:124996423-124996445 CCTCCTGAGTAGCCGGGATTACA 0: 406
1: 55626
2: 143238
3: 230507
4: 202644
Right 1104021707 12:124996437-124996459 GGGATTACAAGTGAGTAGCCGGG 0: 1
1: 0
2: 3
3: 13
4: 141
1104021703_1104021709 18 Left 1104021703 12:124996423-124996445 CCTCCTGAGTAGCCGGGATTACA 0: 406
1: 55626
2: 143238
3: 230507
4: 202644
Right 1104021709 12:124996464-124996486 CAAGTGAGCACCACCACATCCGG 0: 2
1: 28
2: 478
3: 3815
4: 15197
1104021703_1104021706 -10 Left 1104021703 12:124996423-124996445 CCTCCTGAGTAGCCGGGATTACA 0: 406
1: 55626
2: 143238
3: 230507
4: 202644
Right 1104021706 12:124996436-124996458 CGGGATTACAAGTGAGTAGCCGG 0: 1
1: 0
2: 1
3: 6
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104021703 Original CRISPR TGTAATCCCGGCTACTCAGG AGG (reversed) Intronic
Too many off-targets to display for this crispr