ID: 1104021704

View in Genome Browser
Species Human (GRCh38)
Location 12:124996426-124996448
Sequence ACTTGTAATCCCGGCTACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 460311
Summary {0: 9, 1: 1358, 2: 37301, 3: 161564, 4: 260079}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104021704_1104021709 15 Left 1104021704 12:124996426-124996448 CCTGAGTAGCCGGGATTACAAGT 0: 9
1: 1358
2: 37301
3: 161564
4: 260079
Right 1104021709 12:124996464-124996486 CAAGTGAGCACCACCACATCCGG 0: 2
1: 28
2: 478
3: 3815
4: 15197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104021704 Original CRISPR ACTTGTAATCCCGGCTACTC AGG (reversed) Intronic
Too many off-targets to display for this crispr