ID: 1104021705

View in Genome Browser
Species Human (GRCh38)
Location 12:124996435-124996457
Sequence CGGCTACTCACTTGTAATCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 44}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104021705_1104021713 26 Left 1104021705 12:124996435-124996457 CCGGGATTACAAGTGAGTAGCCG 0: 1
1: 0
2: 0
3: 1
4: 44
Right 1104021713 12:124996484-124996506 CGGCTAATTTTTTATGTTTTTGG 0: 8
1: 149
2: 1108
3: 2590
4: 2807
1104021705_1104021709 6 Left 1104021705 12:124996435-124996457 CCGGGATTACAAGTGAGTAGCCG 0: 1
1: 0
2: 0
3: 1
4: 44
Right 1104021709 12:124996464-124996486 CAAGTGAGCACCACCACATCCGG 0: 2
1: 28
2: 478
3: 3815
4: 15197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104021705 Original CRISPR CGGCTACTCACTTGTAATCC CGG (reversed) Intronic
906253897 1:44332736-44332758 TGGCTCCTCACTAGTATTCCCGG - Intronic
910895682 1:92066912-92066934 CGTCTAGTCACTTTTAAACCAGG + Intergenic
916399021 1:164425588-164425610 GGGTTACTGACTTATAATCCTGG - Intergenic
917972651 1:180218889-180218911 CATCTCCTCACTTGTATTCCTGG + Intergenic
919313168 1:195937604-195937626 CGACTACTTATTTGTACTCCAGG - Intergenic
924081396 1:240401859-240401881 GGTTTACTCACTTGTAATTCTGG - Intronic
1064033406 10:11897494-11897516 CGGCTGGTCACTTGTAATCTTGG - Intergenic
1083429344 11:62605854-62605876 GGGCTTCTCCCCTGTAATCCAGG - Exonic
1084920804 11:72468323-72468345 CGGCTACTCACTTGTTTTATTGG - Intergenic
1088144140 11:106653639-106653661 GTGCTACTCACTAGTAATCATGG - Intergenic
1104021705 12:124996435-124996457 CGGCTACTCACTTGTAATCCCGG - Intronic
1104021708 12:124996455-124996477 GTGGTGCTCACTTGTAATCCCGG - Intronic
1116336902 14:43667759-43667781 GTGGTACACACTTGTAATCCTGG + Intergenic
1121249144 14:92486677-92486699 CGGATACACACTTGGGATCCCGG + Exonic
1135718707 16:24795584-24795606 AGGTTCCTCACTTTTAATCCTGG + Intronic
1135795570 16:25438778-25438800 CGGATTCTCACTTGTCGTCCAGG + Intergenic
1138465211 16:57185513-57185535 CTGCTACTCACTTGAAACCTGGG + Intronic
1142864856 17:2784656-2784678 CGCCTACTCTCATGTAGTCCAGG + Intronic
1144201972 17:12949719-12949741 GGGGTACTCACTTGGAAGCCTGG - Exonic
1148278988 17:46332474-46332496 CAGCTACTCACCTGGAATACTGG + Intronic
1148301203 17:46550336-46550358 CAGCTACTCACCTGGAATACTGG + Intronic
1159115355 18:64107206-64107228 AGGTTAGTCACTTCTAATCCAGG - Intergenic
933615702 2:84480456-84480478 CAGCTCCTCACTTGTAAACAGGG + Intergenic
940420816 2:153477951-153477973 CTGCTACTTACTTGGAATGCGGG - Exonic
947039725 2:225903263-225903285 TGGCTCATGACTTGTAATCCTGG + Intergenic
1172578925 20:36031393-36031415 CAGCTACTCACTCCTCATCCTGG - Intergenic
955440878 3:58953767-58953789 CAGCTCTTCACTTGTAATACAGG + Intronic
988712052 5:33788564-33788586 CGCCAACTCACTTGAATTCCTGG - Intronic
998116723 5:139543460-139543482 CGCCTACTGACGTGCAATCCAGG - Intronic
999807244 5:155093653-155093675 CAGCTACTCCCTTGTTATTCTGG - Intergenic
1007839940 6:44707847-44707869 CAGCTACACACTTGTATCCCAGG + Intergenic
1010524654 6:76885831-76885853 CTGCTACTCAGTTGTCACCCAGG - Intergenic
1023684594 7:42721408-42721430 CGGCTCCTCTCTTGTTCTCCAGG - Intergenic
1023741142 7:43281768-43281790 AGGCTAGTCTCTTGTATTCCTGG + Intronic
1024966349 7:55025402-55025424 AGGCTTCTCACTTGGAAGCCTGG + Intronic
1027437373 7:78178291-78178313 CGGCTAGTCACTATTATTCCAGG - Intronic
1038543085 8:28405036-28405058 CGGTTCCTCATTTGTAAACCTGG + Intronic
1041366932 8:57116348-57116370 CAGATACTCCCTTGTATTCCAGG - Intergenic
1049355182 8:142184136-142184158 CCTCTACTCACCTGTAATGCTGG + Intergenic
1052293678 9:26873214-26873236 CAGCTGCTCACTTGTCACCCTGG - Intronic
1059116964 9:111608492-111608514 AAGCTACTCACCTGTAATACTGG - Intergenic
1059517629 9:114910468-114910490 GGGCTTCTGACTTCTAATCCAGG + Intronic
1061178132 9:129009442-129009464 CGGCTACTCACATGGCACCCTGG + Exonic
1192748635 X:73964887-73964909 TGGCAACTCTCTTGAAATCCAGG + Intergenic
1195066400 X:101242033-101242055 CAGCAACTCAGTTGTAGTCCAGG - Intronic
1195789993 X:108573643-108573665 TGGATACTTACTTGTATTCCAGG - Exonic