ID: 1104021708

View in Genome Browser
Species Human (GRCh38)
Location 12:124996455-124996477
Sequence GTGGTGCTCACTTGTAATCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3690
Summary {0: 1, 1: 14, 2: 117, 3: 647, 4: 2911}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104021708_1104021713 6 Left 1104021708 12:124996455-124996477 CCGGGATTACAAGTGAGCACCAC 0: 1
1: 14
2: 117
3: 647
4: 2911
Right 1104021713 12:124996484-124996506 CGGCTAATTTTTTATGTTTTTGG 0: 8
1: 149
2: 1108
3: 2590
4: 2807
1104021708_1104021714 17 Left 1104021708 12:124996455-124996477 CCGGGATTACAAGTGAGCACCAC 0: 1
1: 14
2: 117
3: 647
4: 2911
Right 1104021714 12:124996495-124996517 TTATGTTTTTGGTAGAGATGAGG 0: 16
1: 715
2: 14209
3: 123197
4: 214751

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104021708 Original CRISPR GTGGTGCTCACTTGTAATCC CGG (reversed) Intronic
Too many off-targets to display for this crispr