ID: 1104021709

View in Genome Browser
Species Human (GRCh38)
Location 12:124996464-124996486
Sequence CAAGTGAGCACCACCACATC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 19520
Summary {0: 2, 1: 28, 2: 478, 3: 3815, 4: 15197}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104021705_1104021709 6 Left 1104021705 12:124996435-124996457 CCGGGATTACAAGTGAGTAGCCG 0: 1
1: 0
2: 0
3: 1
4: 44
Right 1104021709 12:124996464-124996486 CAAGTGAGCACCACCACATCCGG 0: 2
1: 28
2: 478
3: 3815
4: 15197
1104021701_1104021709 24 Left 1104021701 12:124996417-124996439 CCTCAGCCTCCTGAGTAGCCGGG 0: 701
1: 95820
2: 202114
3: 238699
4: 158687
Right 1104021709 12:124996464-124996486 CAAGTGAGCACCACCACATCCGG 0: 2
1: 28
2: 478
3: 3815
4: 15197
1104021699_1104021709 28 Left 1104021699 12:124996413-124996435 CCTGCCTCAGCCTCCTGAGTAGC 0: 77881
1: 176222
2: 210480
3: 146546
4: 90715
Right 1104021709 12:124996464-124996486 CAAGTGAGCACCACCACATCCGG 0: 2
1: 28
2: 478
3: 3815
4: 15197
1104021703_1104021709 18 Left 1104021703 12:124996423-124996445 CCTCCTGAGTAGCCGGGATTACA 0: 406
1: 55626
2: 143238
3: 230507
4: 202644
Right 1104021709 12:124996464-124996486 CAAGTGAGCACCACCACATCCGG 0: 2
1: 28
2: 478
3: 3815
4: 15197
1104021704_1104021709 15 Left 1104021704 12:124996426-124996448 CCTGAGTAGCCGGGATTACAAGT 0: 9
1: 1358
2: 37301
3: 161564
4: 260079
Right 1104021709 12:124996464-124996486 CAAGTGAGCACCACCACATCCGG 0: 2
1: 28
2: 478
3: 3815
4: 15197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104021709 Original CRISPR CAAGTGAGCACCACCACATC CGG Intronic
Too many off-targets to display for this crispr