ID: 1104021713

View in Genome Browser
Species Human (GRCh38)
Location 12:124996484-124996506
Sequence CGGCTAATTTTTTATGTTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6662
Summary {0: 8, 1: 149, 2: 1108, 3: 2590, 4: 2807}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104021708_1104021713 6 Left 1104021708 12:124996455-124996477 CCGGGATTACAAGTGAGCACCAC 0: 1
1: 14
2: 117
3: 647
4: 2911
Right 1104021713 12:124996484-124996506 CGGCTAATTTTTTATGTTTTTGG 0: 8
1: 149
2: 1108
3: 2590
4: 2807
1104021705_1104021713 26 Left 1104021705 12:124996435-124996457 CCGGGATTACAAGTGAGTAGCCG 0: 1
1: 0
2: 0
3: 1
4: 44
Right 1104021713 12:124996484-124996506 CGGCTAATTTTTTATGTTTTTGG 0: 8
1: 149
2: 1108
3: 2590
4: 2807

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104021713 Original CRISPR CGGCTAATTTTTTATGTTTT TGG Intronic
Too many off-targets to display for this crispr