ID: 1104024751

View in Genome Browser
Species Human (GRCh38)
Location 12:125017682-125017704
Sequence GCACATGTCCAGGAGTTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 195}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104024748_1104024751 1 Left 1104024748 12:125017658-125017680 CCATTCTAGATCTGCTGGCACAG 0: 1
1: 0
2: 0
3: 14
4: 137
Right 1104024751 12:125017682-125017704 GCACATGTCCAGGAGTTGGAAGG 0: 1
1: 0
2: 0
3: 16
4: 195
1104024747_1104024751 2 Left 1104024747 12:125017657-125017679 CCCATTCTAGATCTGCTGGCACA 0: 1
1: 0
2: 1
3: 8
4: 126
Right 1104024751 12:125017682-125017704 GCACATGTCCAGGAGTTGGAAGG 0: 1
1: 0
2: 0
3: 16
4: 195
1104024746_1104024751 3 Left 1104024746 12:125017656-125017678 CCCCATTCTAGATCTGCTGGCAC 0: 1
1: 0
2: 2
3: 25
4: 241
Right 1104024751 12:125017682-125017704 GCACATGTCCAGGAGTTGGAAGG 0: 1
1: 0
2: 0
3: 16
4: 195
1104024744_1104024751 10 Left 1104024744 12:125017649-125017671 CCTTTGTCCCCATTCTAGATCTG 0: 1
1: 0
2: 2
3: 15
4: 185
Right 1104024751 12:125017682-125017704 GCACATGTCCAGGAGTTGGAAGG 0: 1
1: 0
2: 0
3: 16
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104024751 Original CRISPR GCACATGTCCAGGAGTTGGA AGG Intronic
901418916 1:9137109-9137131 GAACATGCCCAGGGGTTGCAGGG - Intergenic
905093891 1:35452296-35452318 GCCCCTGTCCAGGAGCTGGAGGG - Intronic
905836620 1:41129291-41129313 GAAAATGTCCTGGAGATGGATGG - Intronic
906111515 1:43326216-43326238 TCTCATGTCCATGAATTGGAAGG + Intergenic
915066762 1:153231408-153231430 GCAGGTGTCCAGGTGTGGGAAGG + Intergenic
915500879 1:156316429-156316451 TCACATGGCCATGAGTTGGAGGG - Intronic
915703246 1:157818139-157818161 ATACATGTCCAGTAGTGGGATGG - Intronic
916408378 1:164520358-164520380 TCCTGTGTCCAGGAGTTGGAAGG + Intergenic
920041741 1:203102384-203102406 GCACATGTGGAGGAGGGGGAAGG - Intronic
920045685 1:203130690-203130712 GCAGATGTCCAGCTGTAGGAAGG + Intronic
921148514 1:212381651-212381673 GCACATGCCCAGGCCTGGGAAGG - Intronic
921284991 1:213601526-213601548 ACACTTGGCCTGGAGTTGGAAGG + Intergenic
922324435 1:224515010-224515032 GCACATGGCCATGACTAGGAAGG + Intronic
1063406745 10:5803198-5803220 GCTTAAGCCCAGGAGTTGGATGG + Intronic
1063644374 10:7864611-7864633 GTAAATGTCCAGGAGTAGAATGG + Intronic
1063813953 10:9749388-9749410 GCACATGTCAAGAAGATGCAAGG + Intergenic
1064295657 10:14076887-14076909 ACACAAGTCAGGGAGTTGGAGGG + Intronic
1066026511 10:31363917-31363939 GCACAGGTGCAGGAGCTGCAGGG + Intronic
1068158465 10:53232393-53232415 GCACAATTCCAAGAGTTGGTGGG + Intergenic
1073152132 10:101319303-101319325 GGATATATCCAGGAGTTGGCAGG - Intergenic
1074002895 10:109390144-109390166 TCAGAAGTCCAGGAGCTGGAAGG - Intergenic
1074382827 10:112994177-112994199 GAAAATGTCCTGGAGTTAGAGGG - Intronic
1074908629 10:117887081-117887103 GCACAAGTCCAGGCTCTGGAGGG - Intergenic
1076187095 10:128458495-128458517 ACACATGTCCAGGACTTGGGGGG + Intergenic
1077111403 11:863760-863782 GCATGTGTCCAGGAGCTGGGGGG - Intronic
1077899677 11:6478550-6478572 ACAGAGGTCCAGAAGTTGGAGGG - Intronic
1080534403 11:33207619-33207641 AGACATTTCCAGGAGATGGAGGG - Intergenic
1080566585 11:33515254-33515276 GAACAGGTCCAGGAGCTGTAGGG - Intergenic
1080680406 11:34470338-34470360 GCACACATCCAGGAGCTAGAAGG - Intronic
1081196444 11:40167107-40167129 GCAAATGTCCAGGAGTGATAAGG - Intronic
1082601848 11:55168035-55168057 GTATATGTCCAGTAGTGGGATGG + Intergenic
1084673056 11:70618946-70618968 GCAGATGGCCAGGAGATGGACGG + Intronic
1086326190 11:85702402-85702424 GCTTGAGTCCAGGAGTTGGATGG - Intronic
1090567636 11:128012717-128012739 GTACATGTGCAGGAGGTGCAGGG - Intergenic
1092136048 12:6147993-6148015 GCACTGGGCCAGGAGTTGGAGGG - Intergenic
1094259033 12:28470569-28470591 GTATATATCCAGGAGTGGGATGG - Intronic
1096692119 12:53327802-53327824 GTACATGTCAAGGAGTGAGATGG + Exonic
1096849318 12:54425599-54425621 ACAGATGTCCAGCAGTTGGGAGG + Intergenic
1097032987 12:56103037-56103059 GCACATGCACAGGAATTGGGAGG - Exonic
1101010495 12:100444423-100444445 GAACATTTCCATGAGCTGGAAGG - Intergenic
1102566217 12:113799046-113799068 GGACATGTCCAGGAGTGGGTGGG - Intergenic
1103880504 12:124162567-124162589 CCAGATGTCTAGGAGTTGGCTGG - Intronic
1104024751 12:125017682-125017704 GCACATGTCCAGGAGTTGGAAGG + Intronic
1104517756 12:129443526-129443548 CAACAAGTCCAGGAGTGGGAGGG - Intronic
1107382767 13:39875302-39875324 GCACATCTCTGGAAGTTGGATGG - Intergenic
1110801042 13:79695196-79695218 GCATATATCCAGAAGTGGGATGG + Intergenic
1111444411 13:88327562-88327584 GTAAATATCCAGGAGTTGAATGG + Intergenic
1112579927 13:100669791-100669813 GCACCTGTCCAGGATGTGGTGGG - Intronic
1116129736 14:40839687-40839709 GCAGAAGTGGAGGAGTTGGAAGG - Intergenic
1116832163 14:49731760-49731782 GCTCAAGCCCAGGAGTTGGACGG - Intronic
1117411056 14:55451523-55451545 GCATATGTGCAGGATTTGGCTGG + Intronic
1202887865 14_KI270722v1_random:125253-125275 GTATATGTCCAGTAATTGGACGG - Intergenic
1124141957 15:27084968-27084990 GGACATGTACAGTAGTTGAAGGG + Intronic
1125288041 15:38115315-38115337 ACAAATGTCCAGGATGTGGAAGG - Intergenic
1126675084 15:51154017-51154039 TCACATGTCCATCAGTGGGAGGG + Intergenic
1128324520 15:66715530-66715552 AGGCCTGTCCAGGAGTTGGAAGG - Intronic
1128657664 15:69474382-69474404 CCACTTTTCCAGGAGCTGGAGGG - Intergenic
1130438322 15:83925172-83925194 GCCCATCTCCAGGATGTGGAGGG - Intronic
1134451351 16:14365651-14365673 GCTCAAGCCCAGGAGTTTGAGGG + Intergenic
1136549123 16:30972942-30972964 GCACATCTGCAGGAGGAGGAAGG + Intronic
1138045529 16:53720160-53720182 GCACATCACTAGTAGTTGGAAGG + Intronic
1138715785 16:59020665-59020687 GCAGTTGTCCAGTAGTCGGAAGG + Intergenic
1139596000 16:67958666-67958688 GCCCAAGCCAAGGAGTTGGACGG - Intronic
1140357218 16:74316686-74316708 GTCCATGTCCAGGAGTTTGCAGG + Intergenic
1141648021 16:85377824-85377846 CCACATGTGCAGGAGCTGGGGGG + Intergenic
1143265122 17:5630799-5630821 CAACATTTCCAGGAGCTGGAGGG + Intergenic
1143843667 17:9755494-9755516 GCACATATCCTGGACTTGGCAGG - Intergenic
1144835543 17:18154850-18154872 GCACATGTCTGGGAGATGGTGGG - Intronic
1145863609 17:28226840-28226862 GCAGATGAGCAGGAGGTGGAAGG - Intergenic
1148480100 17:47954399-47954421 CCACAAGGACAGGAGTTGGAAGG + Intronic
1151436507 17:74100833-74100855 GCAGAGGTCCAGGACATGGATGG + Intergenic
1152809052 17:82372445-82372467 GCACATTTCCAGGCCCTGGAAGG + Intergenic
1153484151 18:5578768-5578790 TCACAATTCCAGGTGTTGGAAGG + Intronic
1157936039 18:51874160-51874182 GCATATATCCTGGTGTTGGAGGG - Intergenic
1160056153 18:75482789-75482811 TCACATGGCCAGGAGGTGGGGGG + Intergenic
1161628348 19:5339544-5339566 GGAAATGTCCAGGATTTGTAGGG + Intronic
1161975277 19:7605046-7605068 GCAGATGTGCAGGAGTTTGCTGG - Intronic
1162467198 19:10849349-10849371 GCAAAGGTCCAGGGGATGGAAGG - Intronic
1163224618 19:15949345-15949367 GCCCATGACCAGGAGAAGGAAGG - Exonic
1166025648 19:40081766-40081788 GCACATGTCCAGGACAATGATGG + Intronic
1166947320 19:46405034-46405056 GGACATGACCAGGTGCTGGAGGG + Intergenic
1168429617 19:56267937-56267959 GCACACAGCCAGGAGGTGGAGGG + Intronic
1168467646 19:56617021-56617043 GTGCATGTACAGGCGTTGGAGGG + Intronic
1202663266 1_KI270708v1_random:92091-92113 GTATATGTCCAGTAATTGGACGG - Intergenic
927894397 2:26772075-26772097 CCACATCTCCAGGAGCTGGTGGG + Intronic
931447438 2:62338499-62338521 GCCCAGATCCAGGGGTTGGAAGG + Intergenic
933305553 2:80593592-80593614 GAACATGTTCTGGAGATGGAGGG - Intronic
933850369 2:86361685-86361707 CCAAATGTCCAGGAGTGGCAGGG + Intergenic
936156842 2:110052454-110052476 GCAGATGTCCAGTGGATGGATGG + Intergenic
936187852 2:110318990-110319012 GCAGATGTCCAGTGGATGGATGG - Intergenic
937076992 2:119114258-119114280 ACACAAGTCCAGGAGAGGGATGG + Intergenic
938366226 2:130736678-130736700 GCACATGGCCAGGAGCTGGCAGG - Intergenic
938653967 2:133411969-133411991 GCAGATGAACAGGAGTTAGAGGG - Intronic
939239688 2:139541866-139541888 GCTAGTGTCCAGCAGTTGGAAGG + Intergenic
939652909 2:144786154-144786176 GCACATCTCCTGGAGTTTGCTGG - Intergenic
940650258 2:156435246-156435268 GAAAATATCCAGGAGATGGACGG - Intergenic
941307393 2:163887990-163888012 GCACATGTTCAAGAGATGTAAGG - Intergenic
941568026 2:167132704-167132726 GCAAATGTCCTGGACTGGGAGGG - Intronic
941680783 2:168396515-168396537 GCACATGTTCTGGAGGAGGAAGG - Intergenic
948025036 2:234770092-234770114 GAAAATGTGCAGGAGTTGGGAGG + Intergenic
1170391873 20:15884113-15884135 TCACATGCCCAGGGGATGGATGG + Intronic
1176159275 20:63640395-63640417 CCACAGATCCAGGTGTTGGAAGG - Exonic
1180070291 21:45432432-45432454 GCACAGGGCCTGGAGTGGGATGG + Intronic
1180330008 22:11468975-11468997 GTATATGTCCAGTAATTGGACGG - Intergenic
1181778779 22:25178343-25178365 CCACAGATCCAGGTGTTGGAAGG - Intronic
1182413996 22:30209417-30209439 GCACATGCCGAGGAGTCAGAGGG + Intergenic
1184192208 22:42902356-42902378 GCACATGTCCACCAGGGGGAGGG - Intronic
1185212231 22:49576829-49576851 GCACATCTCCAGGACTCGGGGGG + Intronic
950028540 3:9836742-9836764 GCTTGAGTCCAGGAGTTGGAGGG + Intronic
950211601 3:11127290-11127312 GCAGAGGTCCAGGAGTGAGATGG + Intergenic
950433297 3:12964026-12964048 CCACAGGGCCAGGACTTGGAGGG + Intronic
951337999 3:21447572-21447594 GCACATGGCCAGCAGAAGGAAGG - Intronic
951410142 3:22353451-22353473 GCACATCTCCTGTACTTGGAGGG - Intronic
953299953 3:41763596-41763618 CCAAATGTCCAGGAGTAGAATGG - Intronic
954684727 3:52364353-52364375 GCACATGGCCAGGGGCAGGAGGG - Intronic
954692686 3:52404108-52404130 GCAAAAGGCCAGGAGTGGGATGG - Intronic
954800235 3:53183089-53183111 GCACAGGCCCAGGAGGGGGAAGG - Intronic
955393112 3:58535550-58535572 GGAGATGGCCAGGAGTTGGATGG + Intronic
958001813 3:87760706-87760728 AGAGATGTCCAGGAGTTAGAAGG + Intergenic
962082909 3:132159377-132159399 TCACATGTCTATGAGTTGGCTGG - Intronic
962110758 3:132444119-132444141 TCTCATGTGCAGGAGGTGGATGG - Intronic
963637471 3:147816889-147816911 GCATTTGGCCAGGATTTGGATGG + Intergenic
963662344 3:148142613-148142635 GTACATGTCAAGGATTTTGAGGG + Intergenic
966043129 3:175516809-175516831 GTAGATGTCCAGGTTTTGGAGGG - Intronic
966180704 3:177185926-177185948 GCTTAAGCCCAGGAGTTGGAGGG + Intronic
968135344 3:196216430-196216452 GCACCTGTCCAAGAGGTGGGAGG + Intronic
975838093 4:78445363-78445385 GCACAAGACCAGGAATTGGAAGG - Intronic
976274229 4:83259938-83259960 GTACATTTCCAGGGATTGGAGGG - Intergenic
977308137 4:95351146-95351168 GCTAATGTCCAGGAGTGGGGAGG - Intronic
982575468 4:157103661-157103683 GCCCATGTTCATGGGTTGGAAGG - Intronic
985484402 5:140507-140529 GGACAGGTCCAGGAGCTGCAGGG + Exonic
985520142 5:370409-370431 TCTCCCGTCCAGGAGTTGGATGG - Intronic
985908613 5:2862186-2862208 GCACTGGGACAGGAGTTGGATGG - Intergenic
987615355 5:20266902-20266924 GAACATGTTTAGGAGTTGGAAGG + Intronic
991046083 5:62224186-62224208 GCAGATGTTGAGGAGTTGGATGG + Intergenic
991523078 5:67522717-67522739 GTTCATGTCCTGGAGTTGTAAGG + Intergenic
992759695 5:79940335-79940357 GCGTATGTCCAGGAGTTGTGAGG - Intergenic
992982606 5:82192016-82192038 GCATTTGTGCAGGATTTGGAAGG + Intronic
995640417 5:114250525-114250547 AGACATTTCCAGTAGTTGGATGG + Intergenic
996946424 5:129075082-129075104 ACATATGTCCAGTACTTGGAAGG - Intergenic
997078052 5:130704563-130704585 GTATATGTCCAGTAGTGGGATGG - Intergenic
997910696 5:137870228-137870250 GCTTGTGCCCAGGAGTTGGAGGG + Intronic
998067167 5:139169061-139169083 GCATGAGCCCAGGAGTTGGATGG + Intronic
998613377 5:143713309-143713331 GCAGATGACCAGAAGGTGGAGGG - Intergenic
999123259 5:149226561-149226583 GCCCACGTCAAGGAGTGGGAAGG + Intronic
999794024 5:154971006-154971028 TCACATGTTTAGGAGTTGGCTGG - Intergenic
1000941821 5:167371264-167371286 GCACAGGTCAAGGAGGTGCAAGG - Intronic
1001096267 5:168777911-168777933 GTACATGGACAAGAGTTGGAGGG + Intronic
1001921706 5:175605776-175605798 GCTCAGGTCCACGATTTGGAGGG - Intergenic
1004535109 6:16492827-16492849 GCATATATCCAGGAGTTTGTAGG - Intronic
1004840660 6:19580495-19580517 GCAGAGGTGGAGGAGTTGGAAGG - Intergenic
1005818346 6:29575857-29575879 GCACATTTTCAGGATTTGGCAGG - Intronic
1009472415 6:64043998-64044020 CCCCAGGTCCAGGAGTTGCAGGG - Intronic
1014030116 6:116691334-116691356 GCACAAGCCCAGGAATTGGAGGG - Intronic
1014618687 6:123637817-123637839 ACACCTGTCTAGGAGTGGGAAGG - Intergenic
1016378606 6:143450193-143450215 GAACATGTCCAGCAGAAGGAAGG - Intronic
1018004940 6:159613005-159613027 TCACATGGCCAGGAGATGGGGGG + Intergenic
1018085720 6:160299907-160299929 ACAGATTTCCAGGAGTGGGATGG + Intergenic
1018166983 6:161107482-161107504 GCACATGTCCAGGAGTGTGTGGG - Intronic
1020230440 7:6314340-6314362 GAAAATGTCCTGGAGATGGATGG - Intergenic
1021486416 7:21173211-21173233 GCACATGTCAAGGACCTGTAGGG - Intergenic
1023342945 7:39241486-39241508 GCACATGGCCTGAACTTGGATGG + Intronic
1023858873 7:44204660-44204682 GCACACGCACAGAAGTTGGAGGG - Intronic
1023919788 7:44619130-44619152 GCACAGGTCAAGGTGTAGGATGG - Intronic
1024039515 7:45540946-45540968 GCACATACCCAGGAGTGGAATGG - Intergenic
1030072328 7:105708744-105708766 GCATATGTCCAAGAAATGGAAGG + Intronic
1030090882 7:105857465-105857487 CCAGTTGTCCAGGAGGTGGAAGG - Intronic
1032305847 7:130732612-130732634 GGAAATGTCCAGGACTGGGATGG - Exonic
1034303036 7:150032894-150032916 GCAAATGTCCAGAGGTGGGAAGG + Intergenic
1034803012 7:154064375-154064397 GCAAATGTCCAGAGGTGGGAAGG - Intronic
1035075666 7:156175705-156175727 GCTCTAGTCCAGGAATTGGATGG + Intergenic
1038400522 8:27280811-27280833 GCACATGGAAACGAGTTGGAGGG - Intergenic
1041430446 8:57776037-57776059 GCCCATGGGCAGGAGCTGGAAGG - Intergenic
1043196044 8:77292898-77292920 GCATATATCCATGAGTTGAAGGG - Intergenic
1045109190 8:98923733-98923755 ACACATTTCCATGACTTGGAGGG - Intronic
1045394025 8:101742822-101742844 GGGCCTGTCCAGGGGTTGGATGG - Intronic
1045910898 8:107408572-107408594 GTACTTCTCAAGGAGTTGGATGG - Intronic
1048455252 8:134571946-134571968 ACACATTTCCAGGAGCGGGATGG - Intronic
1049255232 8:141610221-141610243 CCACATGGCCAGGAGATGGCAGG - Intergenic
1049793404 8:144483937-144483959 GCACATTCCTAGAAGTTGGAAGG - Intronic
1051124043 9:13783795-13783817 GTACATGTTGAGGAGTTGGAGGG - Intergenic
1051851894 9:21519007-21519029 TCACATGGCCAGAAGGTGGAAGG - Intergenic
1052558402 9:30050521-30050543 GCCAAAGTCCAGGAGTTGAAAGG + Intergenic
1052721877 9:32181649-32181671 TAACATTTCCAGGAGTGGGAAGG + Intergenic
1052827604 9:33188261-33188283 GCACAGGTCCTGGAATTGGGAGG + Intergenic
1053436949 9:38082076-38082098 GCCCAGGTCCAGGAGCTGGGTGG - Intergenic
1054154353 9:61629633-61629655 GTCCTTGTCCAGGAGGTGGAGGG + Intergenic
1055462894 9:76536154-76536176 ACACATGTGCATGAGTTGCATGG + Intergenic
1055783180 9:79842604-79842626 GCACATGTGCAGCAGTGGGTTGG + Intergenic
1056852484 9:90096232-90096254 GCACCTATCCAGGGCTTGGAGGG - Intergenic
1059947356 9:119424125-119424147 GAACAGGTGGAGGAGTTGGAAGG + Intergenic
1060349645 9:122848017-122848039 GCACATTTCCAGGGGCGGGAGGG - Exonic
1060521055 9:124294318-124294340 GCACAAGCCCAGGGGCTGGAAGG - Intronic
1060763532 9:126275902-126275924 GCTCTTGGCCAGCAGTTGGAAGG - Intergenic
1061243494 9:129388206-129388228 ATAAATGTCCAGGAGTAGGATGG + Intergenic
1187508500 X:19896804-19896826 GCAAATGTTCTGGAGATGGATGG + Intergenic
1189249563 X:39589706-39589728 TCACATGTCCAGACGTTGGCTGG + Intergenic
1189259905 X:39670859-39670881 GCAGATGCCCAGGAGTTAGGTGG - Intergenic
1190413053 X:50156120-50156142 GCAGATGAGCAGGAGGTGGAAGG - Intergenic
1190750776 X:53359655-53359677 GCACCTCTCCAGGATTTGGCAGG - Intergenic
1190801870 X:53796604-53796626 GCACCTCTCCAGGATTTGGCAGG - Intergenic
1191958733 X:66675606-66675628 GCCCTAGTCCAGGAGTTGTAGGG - Intergenic
1192587457 X:72330289-72330311 TCACATGTCCAGTAATTGGCTGG - Intronic
1195158899 X:102152316-102152338 GCACATACACAGGAGTTGTAGGG - Intergenic
1196603758 X:117631710-117631732 TCACATGTCTGTGAGTTGGATGG - Intergenic
1197953497 X:131922536-131922558 GCATATGCCCAGCAGTGGGATGG - Intergenic
1198311032 X:135425832-135425854 TCCCATGGCCAGGAGTTGGCAGG + Intergenic
1199434961 X:147802785-147802807 GCTCAAGTCCTGGAGTTGGAAGG - Intergenic
1199878714 X:151955657-151955679 GCACATGGCTGGGAGTTGGCTGG - Intronic
1200046642 X:153406487-153406509 GCAAAGGTCCTGGAGCTGGAAGG + Intergenic
1200840500 Y:7776634-7776656 GTACAGCTCCAGGAGTTGGGTGG + Intergenic
1202076807 Y:21044405-21044427 GCACTTGTCAAGGACTGGGAAGG - Intergenic