ID: 1104031254

View in Genome Browser
Species Human (GRCh38)
Location 12:125066788-125066810
Sequence GGAGTCCCTGCGCCAGCGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 124}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104031254_1104031264 27 Left 1104031254 12:125066788-125066810 CCCTCCGCTGGCGCAGGGACTCC 0: 1
1: 0
2: 1
3: 5
4: 124
Right 1104031264 12:125066838-125066860 CTTGCTCAGGCTCACAGGGATGG 0: 1
1: 0
2: 4
3: 41
4: 319
1104031254_1104031261 14 Left 1104031254 12:125066788-125066810 CCCTCCGCTGGCGCAGGGACTCC 0: 1
1: 0
2: 1
3: 5
4: 124
Right 1104031261 12:125066825-125066847 TGGCGTCACTGTTCTTGCTCAGG 0: 1
1: 0
2: 2
3: 5
4: 93
1104031254_1104031262 22 Left 1104031254 12:125066788-125066810 CCCTCCGCTGGCGCAGGGACTCC 0: 1
1: 0
2: 1
3: 5
4: 124
Right 1104031262 12:125066833-125066855 CTGTTCTTGCTCAGGCTCACAGG 0: 1
1: 0
2: 2
3: 11
4: 216
1104031254_1104031257 -9 Left 1104031254 12:125066788-125066810 CCCTCCGCTGGCGCAGGGACTCC 0: 1
1: 0
2: 1
3: 5
4: 124
Right 1104031257 12:125066802-125066824 AGGGACTCCCTTGTTTCTGTTGG 0: 1
1: 0
2: 0
3: 8
4: 160
1104031254_1104031258 -6 Left 1104031254 12:125066788-125066810 CCCTCCGCTGGCGCAGGGACTCC 0: 1
1: 0
2: 1
3: 5
4: 124
Right 1104031258 12:125066805-125066827 GACTCCCTTGTTTCTGTTGGTGG 0: 1
1: 0
2: 1
3: 12
4: 145
1104031254_1104031263 23 Left 1104031254 12:125066788-125066810 CCCTCCGCTGGCGCAGGGACTCC 0: 1
1: 0
2: 1
3: 5
4: 124
Right 1104031263 12:125066834-125066856 TGTTCTTGCTCAGGCTCACAGGG 0: 1
1: 0
2: 0
3: 16
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104031254 Original CRISPR GGAGTCCCTGCGCCAGCGGA GGG (reversed) Intronic