ID: 1104031934

View in Genome Browser
Species Human (GRCh38)
Location 12:125071092-125071114
Sequence GTGAGTGAGCTCTTGGGGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 223}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104031934_1104031941 -2 Left 1104031934 12:125071092-125071114 CCCGTCCCCAAGAGCTCACTCAC 0: 1
1: 0
2: 2
3: 23
4: 223
Right 1104031941 12:125071113-125071135 ACATGGCGGTAAGTTAGTGCTGG 0: 1
1: 0
2: 1
3: 6
4: 44
1104031934_1104031944 12 Left 1104031934 12:125071092-125071114 CCCGTCCCCAAGAGCTCACTCAC 0: 1
1: 0
2: 2
3: 23
4: 223
Right 1104031944 12:125071127-125071149 TAGTGCTGGTGGTGGCAGCAAGG 0: 1
1: 1
2: 5
3: 67
4: 444
1104031934_1104031945 21 Left 1104031934 12:125071092-125071114 CCCGTCCCCAAGAGCTCACTCAC 0: 1
1: 0
2: 2
3: 23
4: 223
Right 1104031945 12:125071136-125071158 TGGTGGCAGCAAGGTAGTGCAGG 0: 1
1: 0
2: 3
3: 21
4: 204
1104031934_1104031942 1 Left 1104031934 12:125071092-125071114 CCCGTCCCCAAGAGCTCACTCAC 0: 1
1: 0
2: 2
3: 23
4: 223
Right 1104031942 12:125071116-125071138 TGGCGGTAAGTTAGTGCTGGTGG 0: 1
1: 0
2: 0
3: 1
4: 72
1104031934_1104031943 4 Left 1104031934 12:125071092-125071114 CCCGTCCCCAAGAGCTCACTCAC 0: 1
1: 0
2: 2
3: 23
4: 223
Right 1104031943 12:125071119-125071141 CGGTAAGTTAGTGCTGGTGGTGG 0: 1
1: 0
2: 0
3: 7
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104031934 Original CRISPR GTGAGTGAGCTCTTGGGGAC GGG (reversed) Intronic
900119807 1:1043733-1043755 GTGAGTGAGGCCCTGGGGCCGGG + Intronic
900334099 1:2152759-2152781 GTGTGTGAGCTTTTGGTGTCTGG + Intronic
900869552 1:5292311-5292333 CTGAGTGACCACATGGGGACGGG + Intergenic
901167154 1:7229171-7229193 CTGAGAGAGCTCTAGGGGACAGG + Intronic
902594892 1:17502632-17502654 ATGACTGGGCCCTTGGGGACTGG + Intergenic
903858332 1:26350587-26350609 GTGAGTGAGCACTTAGGGTTGGG - Intronic
904013318 1:27402656-27402678 GTGAGTGGGCACATGAGGACCGG - Intergenic
905036808 1:34923976-34923998 TTGATTGTGCTCTTGGGGATGGG + Intronic
906200732 1:43958596-43958618 GTGAGTGAGCTCTGGGGGCCAGG + Intronic
907205790 1:52769823-52769845 GTGAATGAGCAGTTGAGGACAGG - Intronic
907386438 1:54128628-54128650 GACAGTGAGCTCCTGGGGGCAGG + Intergenic
907461697 1:54609152-54609174 GTATGTGAGTCCTTGGGGACAGG - Intronic
907519865 1:55016035-55016057 GTGAGTGAGTGACTGGGGACTGG + Intergenic
908300431 1:62756813-62756835 TTGAATGAGATCATGGGGACTGG + Intergenic
909125132 1:71658165-71658187 GAGAGTGAGCTCCTTGGGGCAGG + Intronic
910174269 1:84412403-84412425 GTGAATGAGCTCCTGGTGAAAGG - Exonic
910178696 1:84458462-84458484 GTCTGTGAGCTTTTAGGGACAGG + Intergenic
910344850 1:86224871-86224893 GGCAGTGAGCCCCTGGGGACAGG + Intergenic
910813569 1:91264136-91264158 GTGAATGAGCTCCTGGTCACTGG + Intronic
910897325 1:92082498-92082520 TTGAGTGAGCTCTTAGGGATTGG + Intronic
910951508 1:92653377-92653399 GGTGGTGAGCTCTTGGGCACAGG - Intronic
912415374 1:109504846-109504868 GTGATGGAGCTCCTGAGGACTGG - Exonic
913228027 1:116717699-116717721 GTGGGTGAACTCTAGGGGTCTGG - Intergenic
915318880 1:155045083-155045105 GTGAGTGCCCTCTTGTGGAGAGG - Intronic
915527455 1:156484850-156484872 CTGGGTGAGTCCTTGGGGACTGG + Intronic
916124491 1:161557198-161557220 GTCAGTGACCTCTTAGGAACTGG - Intergenic
916134383 1:161638548-161638570 GTCAGTGACCTCTTAGGAACTGG - Intronic
916249581 1:162724014-162724036 GTCAGTGAGTTCTTAGGGTCAGG + Intronic
919480259 1:198079448-198079470 GTAAATGAGCTATTGGGGAGGGG + Intergenic
920665631 1:207960716-207960738 ATGAGTGGACTCTTGGGGAGAGG + Intergenic
924887009 1:248229558-248229580 GTCAGAGAGCTCCTGCGGACTGG - Intergenic
1063121175 10:3106541-3106563 GGAAGAGAGCTCTTTGGGACTGG - Intronic
1064005748 10:11697554-11697576 GTGAGTGATCACTTGAGGTCAGG - Intergenic
1064481060 10:15741275-15741297 GTGTGTGAGCTCTTTGAGACTGG + Intergenic
1065142970 10:22737739-22737761 GTGAGTCAGCTCTTTGGGCTGGG + Intergenic
1069904497 10:71724415-71724437 GGGACTGAGCTACTGGGGACGGG - Intronic
1071475166 10:86019416-86019438 GGGAGAGGGCTCCTGGGGACTGG + Intronic
1071525815 10:86357580-86357602 GTGTGTGTGCTCTTGAGTACAGG + Intronic
1073586710 10:104717445-104717467 GTGGGTGAGCTCTAGGTGTCCGG - Intronic
1073832562 10:107402727-107402749 GTGAGTGAGCTTGTAGGGATGGG - Intergenic
1074183664 10:111083584-111083606 GTGAGTGAGCAGTGGGGGAGAGG + Intergenic
1074443728 10:113500783-113500805 GGGAGTGAGGCCTTGGGGAGAGG - Intergenic
1075718624 10:124571946-124571968 GTGAGTGAGGGGTTGGGGAAGGG + Intronic
1076522014 10:131087172-131087194 GTCACTGTGCTCTTGGGCACAGG - Intergenic
1077304025 11:1859919-1859941 CTGAGAGAGCCCATGGGGACAGG - Intronic
1078010287 11:7568275-7568297 CTGAGTGACCTCATGGGTACTGG + Intronic
1078413699 11:11148285-11148307 GTGAGTGAGCTCTGGAGCCCTGG - Intergenic
1080767363 11:35309254-35309276 GTAAGTGAGCTCCTTGGGGCAGG + Intronic
1081846024 11:46241046-46241068 GTGACTGAGATCTAGAGGACAGG - Intergenic
1083183893 11:61006621-61006643 GAGAGTGAGCTCTGGGAGCCAGG + Exonic
1083234233 11:61341645-61341667 CTGGGGGAGCTCCTGGGGACTGG + Intronic
1085777592 11:79380453-79380475 CTGAGTCAGGTCTTGGGAACAGG + Intronic
1085879477 11:80448916-80448938 CTGAGTGAGCTCTTGGGTGGAGG - Intergenic
1088861479 11:113804177-113804199 GTGAATGACCTCTTTAGGACTGG + Intronic
1089566111 11:119372684-119372706 GTGAGTTTACCCTTGGGGACCGG - Intronic
1090620083 11:128552894-128552916 GTCAGTGAGCTCTTAGAGACAGG + Intronic
1090802816 11:130184091-130184113 ATGAGTGGTTTCTTGGGGACAGG + Intronic
1091615719 12:2050177-2050199 GTGGGTGAGCTGGTGGGGGCAGG - Intronic
1098257604 12:68633263-68633285 GTGAGGGCGCTCTGGGGAACGGG - Intronic
1101759775 12:107649047-107649069 GGTAGTGAGCTCTTGGTCACTGG + Intronic
1103044370 12:117723134-117723156 GTGAGTGATCTCTTTGTGAATGG - Intronic
1103964995 12:124632953-124632975 GTGTGTGAGCTCTCGGGGTATGG - Intergenic
1104031934 12:125071092-125071114 GTGAGTGAGCTCTTGGGGACGGG - Intronic
1104589073 12:130069961-130069983 GTCAGTGACCACTTGGGAACTGG + Intergenic
1106582904 13:31032904-31032926 CTGAGTCAGATCTTGGGGACTGG - Intergenic
1107480071 13:40778999-40779021 GAGAGCCAGCTTTTGGGGACTGG + Intergenic
1108225333 13:48283798-48283820 GTGAGTGAGCTATGGAGAACTGG + Intergenic
1112212149 13:97388524-97388546 GTGTGTGTGCTTGTGGGGACTGG - Intronic
1113403747 13:110019264-110019286 TTGGGTGAGTGCTTGGGGACAGG - Intergenic
1113548742 13:111175552-111175574 GTGAGTGAGCTTTTGGGGGAAGG + Intronic
1114516020 14:23301069-23301091 GTGAGTGGGCTCTGGGAGAAAGG - Intronic
1114805133 14:25826574-25826596 GGGAGAGAGTTCTTGGGGAAGGG - Intergenic
1115120709 14:29933362-29933384 GTGAATGAGCTCTGGGGAAAAGG + Intronic
1117757300 14:58989117-58989139 GGGAGAAAGCTCTTGGGGAGAGG + Intergenic
1119182341 14:72613651-72613673 GTGAGTGGGTTCCTGGGAACAGG - Intergenic
1121139366 14:91527610-91527632 GTGAGTCAGGTATTGGGGAAGGG + Intergenic
1121269915 14:92631204-92631226 GTCAGTGAGCACTTGGGGCCCGG + Intronic
1121273061 14:92650812-92650834 ATGACTGAGCCCCTGGGGACTGG + Intronic
1121594275 14:95147726-95147748 GTGGGGGAGGTCTTGAGGACTGG - Intronic
1122134418 14:99624656-99624678 GTGAGTTTGTTCTTGGGGCCGGG + Intergenic
1123192502 14:106584802-106584824 GTGACTGAGCTCATGAGGAGTGG + Intergenic
1124196964 15:27639658-27639680 GGGACTGAGCTCCTGGGGAAAGG + Intergenic
1124247588 15:28084376-28084398 GGGAGTGAGGTCTTGGAGAAGGG - Intronic
1125449998 15:39798304-39798326 GTCAGTGACCTCTTGAGAACTGG + Intergenic
1125583773 15:40806140-40806162 GTGAGTGAGCTTTTGAGAAGAGG - Intronic
1129024686 15:72559497-72559519 GTGGGTGATCACTTGGGGTCAGG - Intronic
1130613941 15:85386350-85386372 GTGAGTGAGATCTTGTTCACTGG + Intronic
1131854725 15:96581495-96581517 GTGAGCGAGGGCTTGGGGACCGG + Intergenic
1132830514 16:1925787-1925809 GTGAGTGTGCACGTGGGCACAGG + Intergenic
1132973462 16:2700264-2700286 TGGAGTGAGCTGTGGGGGACGGG - Intronic
1133801680 16:9090614-9090636 GGGAGTGTGCTTTTCGGGACAGG + Intergenic
1133807848 16:9138860-9138882 ATGAGTGAGCTGGTGGGGCCCGG + Intergenic
1135099811 16:19595632-19595654 GTGAGTGAGCTGTCTGGGTCTGG - Intronic
1136609847 16:31359616-31359638 GAGAGTGAGCTCTTGTGGCCAGG + Intronic
1138098372 16:54231535-54231557 AAGAGTGAGCTCTGGGAGACAGG + Intergenic
1139269791 16:65671373-65671395 GTCTTTGAGCCCTTGGGGACAGG + Intergenic
1139544271 16:67642321-67642343 GTGTGTGAGCACATGGGGGCAGG - Intergenic
1139878081 16:70162645-70162667 GTGAGGGAGGATTTGGGGACGGG + Intergenic
1139883963 16:70195792-70195814 GTGGGTGAGCACTAGGGTACTGG + Intergenic
1140368553 16:74399704-74399726 GTGGGTGAGCACTAGGGTACTGG - Intergenic
1140710012 16:77668919-77668941 GTGAGTGAGCTTTTTTGGTCAGG + Intergenic
1141350253 16:83288220-83288242 GTGAGTTAGCTATTGGGGCTGGG - Intronic
1142064991 16:88057235-88057257 CTGGGTGAGCTCTTGGCGGCTGG - Intronic
1142199229 16:88753255-88753277 GCGGGTGAGCTCTGGGGGGCTGG - Intronic
1142283513 16:89161303-89161325 CTGAGTGACCTGTTGGGGGCAGG - Intergenic
1146016978 17:29241559-29241581 GGGAGTGAGGTCATGGGGCCAGG - Intergenic
1146467158 17:33095396-33095418 CTGAGAGATCTCTTGGGGACAGG + Intronic
1149431811 17:56600224-56600246 GTGAGTGAGCAATTTGGGAAGGG + Intergenic
1149434104 17:56618772-56618794 GAGAGCCAGCTCTTGGGGACAGG + Intergenic
1150279043 17:63918327-63918349 GTTTGTAAGCTCTTGGGGAATGG - Exonic
1151398101 17:73838450-73838472 GTGAGGGAGCTGATGGAGACAGG - Intergenic
1151526398 17:74671823-74671845 ATGCGTGAGCTCTTGGGGAAGGG + Intronic
1151983498 17:77528037-77528059 GTGTGAGCGCTCTTGGGGGCTGG + Intergenic
1155251075 18:23953772-23953794 GTTATTAAGCTTTTGGGGACCGG + Intronic
1155458016 18:26041882-26041904 GTAATTGAGCTCTTTGGGATTGG - Intronic
1158371740 18:56814025-56814047 GGGACTAAGCTCCTGGGGACAGG - Intronic
1160576326 18:79856266-79856288 GTGTGTGTGCTCGCGGGGACTGG + Intergenic
1160789945 19:918690-918712 GAGAGGGCGCACTTGGGGACGGG + Intronic
1160790130 19:919272-919294 GTGAGGGAGCCCTTGGGGGGCGG - Intronic
1162320841 19:9969977-9969999 GTGAGTGGGGTCTGGGTGACTGG + Intronic
1162791368 19:13064712-13064734 GAGCGTGAGCTCCTGGGGAGGGG + Intronic
1164884288 19:31764342-31764364 GTGAGTGAGTTCTCTGAGACTGG + Intergenic
1165977064 19:39685419-39685441 GTGAGTGAACACCTGGGGGCTGG + Intergenic
1167482208 19:49740008-49740030 GAGGGTGAGATCTTGGGGAAAGG - Intronic
1167534220 19:50039298-50039320 GTGAGTAGGCCCCTGGGGACAGG - Intronic
925028151 2:625593-625615 GTGAGTGAGCTCCTGAGGAGAGG - Intergenic
925277751 2:2662454-2662476 GTGTGTGTGCTGGTGGGGACTGG - Intergenic
934900548 2:98156407-98156429 GTGCGTGGGCTACTGGGGACTGG - Intronic
935077663 2:99761410-99761432 GTGTGTGGGTTCTTGGAGACTGG - Intronic
935627853 2:105185807-105185829 GTGCCTGAGCTCTGGTGGACAGG + Intergenic
936012550 2:108934231-108934253 GTGAGTGGGGTCTGGGGGAGGGG + Intronic
937238423 2:120444563-120444585 GTGAGTGAGCTTTTGGGATGAGG + Intergenic
942594635 2:177581169-177581191 GAGTGTGAGGTCTTGGGGACAGG + Intergenic
943076080 2:183196739-183196761 GAGAGTGAGGACTTGGGGAGTGG - Intergenic
947708054 2:232292549-232292571 GTGGGTGAGCTCTAGGAGCCTGG - Intronic
948223797 2:236293387-236293409 GAGAGAGAGCCCCTGGGGACAGG - Intergenic
948694488 2:239726320-239726342 GGGAGGGTGCTCTTGGAGACGGG + Intergenic
1168848033 20:958703-958725 GTGGGTGCTCTCTTGGGGTCGGG + Exonic
1169242695 20:3998056-3998078 ATAAATGAGCTGTTGGGGACAGG - Intronic
1169859087 20:10132758-10132780 GTGAGGGAGCTGTTCGGGGCAGG + Intergenic
1170384210 20:15798277-15798299 GTGATTGGGTGCTTGGGGACTGG + Intronic
1171071025 20:22068608-22068630 GTGACTTATCTCTTGAGGACAGG - Intergenic
1172301684 20:33854956-33854978 GGGAGTGAGCACAGGGGGACAGG - Intergenic
1174102485 20:48138208-48138230 GTGAGTGTGATCTGGGGGAGGGG + Intergenic
1174495182 20:50935700-50935722 GTTAGTGAGCTCTTAGGGTAGGG - Intronic
1178261675 21:31105755-31105777 TTGGGAGAGCTCTTGGGGATAGG + Intergenic
1178894128 21:36544573-36544595 GTGAGTGTGCTCTGGAGGAGGGG - Intronic
1179654997 21:42839381-42839403 GAGAGGCAGCTCTTGGGGGCAGG - Intergenic
1180078254 21:45473982-45474004 GTGAGTGACATCTGGGGCACGGG + Intronic
1181463418 22:23098365-23098387 GTGAGTGAGCTCCTCGGGGCAGG + Intronic
1183091925 22:35528143-35528165 ATGGGGGAGCTGTTGGGGACAGG - Intergenic
1183347141 22:37314089-37314111 GGGACTGAGCTCGTGGGGTCCGG - Exonic
1183616854 22:38950861-38950883 GTGAGTGAGCCCCAGGGGACAGG + Intergenic
1183663651 22:39235333-39235355 CTGAGTGAGCTCTGGGGCACGGG + Intronic
1183769631 22:39912881-39912903 GGCAGTGAGCTCTAGAGGACAGG + Intronic
1183803269 22:40186142-40186164 GAGAATGAGACCTTGGGGACGGG + Intronic
1184060827 22:42079955-42079977 GTGAGTGTCCTCCTGGAGACGGG + Intronic
1184100310 22:42338490-42338512 CTGAGCGAGCTCTTCGGGATTGG - Intronic
1185266113 22:49905119-49905141 CTGAGTGAACTCTCTGGGACAGG + Intronic
949550250 3:5106655-5106677 GTGGGTGATCGCTTGAGGACAGG - Intergenic
952305115 3:32138514-32138536 GTGAGTGAAACCTTGTGGACAGG + Intronic
952820137 3:37479553-37479575 GTGAGGGGGCTCTTGGGGCCTGG - Intronic
952846149 3:37689570-37689592 GAGAGGGAGCTCCTGGGGCCGGG + Intronic
953016455 3:39081537-39081559 GAGAGGGTTCTCTTGGGGACTGG + Intronic
953096910 3:39786670-39786692 GTGATTAGGCTCTTGAGGACAGG + Intergenic
954805572 3:53218092-53218114 GAGAGTGAGCTGTGGGGGGCTGG - Intergenic
955223527 3:57042595-57042617 AACAGTCAGCTCTTGGGGACAGG - Intronic
960212301 3:114984788-114984810 GTGAGAGTGCTCTTGGGAACAGG - Intronic
961008967 3:123423616-123423638 GTCAGGGAGCTCTTGAGGGCAGG - Intronic
961037776 3:123654630-123654652 GGAAGAGAGCTCTTGGAGACAGG - Intronic
961570182 3:127792096-127792118 GTGAGTGGCCTCTGGGGGCCGGG - Intronic
961663382 3:128482022-128482044 TTGACTGAGCTGGTGGGGACTGG - Intronic
963835896 3:150057460-150057482 GGGAGTGTGCTCCTGGGGCCTGG + Intergenic
969705112 4:8787508-8787530 GTGGGGCAGCTCTTGGGGGCAGG - Intergenic
970625587 4:17875352-17875374 GAAAGTGAGATCTTGGGGTCTGG - Intronic
970643092 4:18089315-18089337 GTGAATGAGCTCTCGAGGTCAGG - Intergenic
972741107 4:41886894-41886916 TTGAAGGAGCTCTTGGGGTCAGG + Intergenic
979931132 4:126632153-126632175 GTGCATGAGCTCTTCGGAACAGG + Intergenic
982069424 4:151682605-151682627 CTGAATGAGCTCTGAGGGACTGG - Intronic
983302664 4:165947199-165947221 TTGTGTGAGCTGGTGGGGACAGG + Intronic
984641932 4:182176073-182176095 GTGAGTTAGGTCTTGTGGACAGG + Intronic
985992500 5:3575021-3575043 GTCAGTGAGCACATGTGGACAGG - Intergenic
986157271 5:5188815-5188837 GTGAGTGCGCAGTTGGGGAGGGG + Intronic
988044744 5:25936163-25936185 GTGAGTGATCTCTTTAGGGCTGG - Intergenic
989532146 5:42520397-42520419 GTCAGAGATCTCATGGGGACAGG + Intronic
991538591 5:67701268-67701290 GTTAGTTAGCTCTGGGTGACAGG + Intergenic
993025449 5:82640397-82640419 GTGATGGTGCTCTTGGGGGCTGG + Intergenic
995018835 5:107344471-107344493 GTGAGTGTGCAACTGGGGACTGG - Intergenic
995648796 5:114344218-114344240 GTGAGGGAAGTCTTGGTGACTGG - Intergenic
995787247 5:115842449-115842471 CGGGGTGGGCTCTTGGGGACTGG - Intronic
997611211 5:135217062-135217084 GTGAGTAAGCTCAAGGGGTCTGG + Intronic
998377956 5:141703417-141703439 GAGAGGGAGCTCTGGGGGAGCGG + Intergenic
1000118745 5:158177026-158177048 GTGTGTGTGTTCTGGGGGACTGG + Intergenic
1000347278 5:160324978-160325000 GTGTGTGTGCTCATGGGAACTGG + Intronic
1001857383 5:175024905-175024927 GCCAGTGAGCTTTTGGGGATGGG + Intergenic
1002762932 6:215830-215852 ATGGGTTAGCTCTTGGGGAGGGG - Intergenic
1003331205 6:5130167-5130189 GTGAGTGAGGTCTTGGGCCTGGG + Intronic
1003398127 6:5770539-5770561 GTGAGAGACATGTTGGGGACAGG + Intronic
1004274388 6:14222613-14222635 GTGAGTGAGCTTGTGGAGAGGGG + Intergenic
1005811411 6:29518988-29519010 ACAAGTGAACTCTTGGGGACAGG - Intergenic
1005936870 6:30529727-30529749 GAGAGTGAGCTCGTGGTGAGAGG + Intergenic
1006572850 6:35019600-35019622 GTGAGATAGCTCTGGGGGAGGGG + Intronic
1006912913 6:37575773-37575795 AGGAGTGAGGTTTTGGGGACAGG + Intergenic
1007999796 6:46348503-46348525 GGGAGGAAGCTCTTGGGGAATGG - Intronic
1011589736 6:88960714-88960736 GAGAGAGAGCTCTTGGAGACAGG - Intronic
1012623648 6:101379353-101379375 GTGTGTGTGTTGTTGGGGACAGG - Intergenic
1014318500 6:119896396-119896418 GTGCATGAGCACTTGAGGACAGG - Intergenic
1018194870 6:161346717-161346739 GTGGGTGAGCTCTGGGTGCCAGG - Intergenic
1018696531 6:166395775-166395797 GTGAGGTCGCTCTTGTGGACAGG + Intergenic
1019326030 7:438699-438721 GAGAGGGAGCTCCTGGGGTCAGG - Intergenic
1020004838 7:4777001-4777023 GTGAGTGAGGTCTTGAAGGCAGG + Intronic
1022666873 7:32419459-32419481 GAGAGTGAGCCCTTGGGGTATGG + Intergenic
1026095005 7:67340095-67340117 CTCAATGAGCTCTAGGGGACGGG - Intergenic
1032094776 7:128932561-128932583 GAGAGGGAGCACTTGGGGGCTGG - Intergenic
1033083964 7:138325147-138325169 ATGAGTGAGCTCTTGGCAAGAGG + Intergenic
1034386106 7:150742539-150742561 GTGAAAGAGGTCTTTGGGACAGG + Exonic
1036022538 8:4862108-4862130 GTGAGTCAGCTCTAAGGGTCTGG + Intronic
1037960448 8:23093465-23093487 GTGATTGAGGTTTTGGGGAGAGG - Intronic
1038354194 8:26811561-26811583 CTGAGTGGGCTCTAGTGGACTGG - Intronic
1045275500 8:100700901-100700923 CAGAATGAGATCTTGGGGACGGG - Intronic
1047917217 8:129595001-129595023 GGGAGTGAACTCATAGGGACTGG - Intergenic
1049361614 8:142214759-142214781 GGGCGGGAGCTCTTGGGGCCTGG - Intronic
1049839428 8:144761581-144761603 GTGAGTGAGTTCTTGAGAGCTGG + Intergenic
1050607304 9:7315053-7315075 GACAGGGAGCTCTTGGGGTCTGG + Intergenic
1052750065 9:32481229-32481251 CTAAGTGAGCTCTTGAGGACAGG + Intronic
1053072480 9:35109457-35109479 GTGTGTGAGCACTGGGGGAGGGG - Exonic
1053163875 9:35831063-35831085 ATCAGTGAGCTCTGGGGGCCTGG + Intronic
1055185887 9:73453451-73453473 GTGAGTGATCACTTGAGGTCAGG - Intergenic
1056197834 9:84245715-84245737 GTGAGGGATCTCTTGAGGTCAGG + Intergenic
1057097426 9:92325088-92325110 GTCTGTCAGCTCTTGGGGAAGGG - Exonic
1057242460 9:93423506-93423528 GGAAGGGAGCTCCTGGGGACAGG + Intergenic
1057242469 9:93423538-93423560 ATGGGGGAGCTCCTGGGGACAGG + Intergenic
1058049919 9:100395235-100395257 GTGAGTGCCCTCTTGGGGTGAGG + Intergenic
1059030767 9:110693444-110693466 GGGAGGGAGCTCTTGGGGGAGGG - Intronic
1061107278 9:128541126-128541148 GTCAGAAAGCCCTTGGGGACAGG - Exonic
1062102625 9:134736407-134736429 GGGAGTGGGCTCTTGATGACAGG - Intronic
1062207895 9:135347269-135347291 GTGGCTGAGATCTTGGGGATGGG - Intergenic
1185520406 X:734449-734471 GAGATTGAGCTCATGGGGGCCGG - Intergenic
1191205948 X:57834469-57834491 TTGACTCAGATCTTGGGGACTGG - Intergenic
1192737543 X:73863477-73863499 GAGTGTGAGGTCATGGGGACTGG - Intergenic
1193445639 X:81598294-81598316 ATGAGTGGGTTCTGGGGGACAGG - Intergenic
1196539704 X:116893236-116893258 GTGAGTGAGCTCTTGGCACTTGG - Intergenic
1199324021 X:146476339-146476361 CTGAAGGAGCTGTTGGGGACAGG + Intergenic
1199803341 X:151272710-151272732 ATGAGTGAGTTCTTGAGGACTGG - Intergenic
1199853156 X:151739480-151739502 GACAGTGAGCTCTTGGGGACTGG + Intronic
1200059221 X:153476874-153476896 GTCAGTGAGCTCTTGGGCGGGGG + Intronic
1200073187 X:153538906-153538928 GCGAGGGAGCTCCTGGGGAATGG + Intronic
1200144711 X:153920651-153920673 TTGAGGGAGCTCTTGCGGAGGGG + Exonic
1201312065 Y:12606176-12606198 GTGACTCAGATCATGGGGACTGG - Intergenic