ID: 1104031934

View in Genome Browser
Species Human (GRCh38)
Location 12:125071092-125071114
Sequence GTGAGTGAGCTCTTGGGGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 223}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104031934_1104031945 21 Left 1104031934 12:125071092-125071114 CCCGTCCCCAAGAGCTCACTCAC 0: 1
1: 0
2: 2
3: 23
4: 223
Right 1104031945 12:125071136-125071158 TGGTGGCAGCAAGGTAGTGCAGG 0: 1
1: 0
2: 3
3: 21
4: 204
1104031934_1104031943 4 Left 1104031934 12:125071092-125071114 CCCGTCCCCAAGAGCTCACTCAC 0: 1
1: 0
2: 2
3: 23
4: 223
Right 1104031943 12:125071119-125071141 CGGTAAGTTAGTGCTGGTGGTGG 0: 1
1: 0
2: 0
3: 7
4: 95
1104031934_1104031941 -2 Left 1104031934 12:125071092-125071114 CCCGTCCCCAAGAGCTCACTCAC 0: 1
1: 0
2: 2
3: 23
4: 223
Right 1104031941 12:125071113-125071135 ACATGGCGGTAAGTTAGTGCTGG 0: 1
1: 0
2: 1
3: 6
4: 44
1104031934_1104031944 12 Left 1104031934 12:125071092-125071114 CCCGTCCCCAAGAGCTCACTCAC 0: 1
1: 0
2: 2
3: 23
4: 223
Right 1104031944 12:125071127-125071149 TAGTGCTGGTGGTGGCAGCAAGG 0: 1
1: 1
2: 5
3: 67
4: 444
1104031934_1104031942 1 Left 1104031934 12:125071092-125071114 CCCGTCCCCAAGAGCTCACTCAC 0: 1
1: 0
2: 2
3: 23
4: 223
Right 1104031942 12:125071116-125071138 TGGCGGTAAGTTAGTGCTGGTGG 0: 1
1: 0
2: 0
3: 1
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104031934 Original CRISPR GTGAGTGAGCTCTTGGGGAC GGG (reversed) Intronic