ID: 1104033942

View in Genome Browser
Species Human (GRCh38)
Location 12:125085413-125085435
Sequence ATGAAACAGACGTGGATGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104033942_1104033946 19 Left 1104033942 12:125085413-125085435 CCTTGCATCCACGTCTGTTTCAT 0: 1
1: 0
2: 0
3: 11
4: 172
Right 1104033946 12:125085455-125085477 TTGCATCCACGTGTGTTTCGTGG 0: 1
1: 0
2: 6
3: 6
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104033942 Original CRISPR ATGAAACAGACGTGGATGCA AGG (reversed) Intronic
905459995 1:38116290-38116312 CTGAAACAGACGTCAGTGCATGG + Intergenic
905891260 1:41519905-41519927 AGGACAGAGACGTGGATGAATGG + Intronic
907134628 1:52128192-52128214 AGGACACAGACTTGGAGGCAGGG - Intergenic
911152780 1:94611106-94611128 AAGAAAAAGAAGTGGATGCTGGG - Intergenic
911529799 1:99031094-99031116 CAGAAACAGACCTGGATGGAAGG + Intergenic
913162758 1:116159962-116159984 ATGAAAAAGACTTGGTTACAAGG - Intergenic
914426384 1:147580967-147580989 ATCAAACACACCTGGATGCAAGG - Intronic
921388593 1:214596535-214596557 ATGAAATAGACATGCATACAGGG + Intergenic
921914404 1:220590981-220591003 AAGAAAAAGACGTGTAGGCAGGG - Intronic
1062767830 10:79263-79285 ACGAAACAGAAGTTGATACAAGG - Intergenic
1063137230 10:3228522-3228544 ATGACACACATGTGGATTCACGG - Intergenic
1063973695 10:11398525-11398547 ATGAAGCAGAGCTGGATCCAGGG - Intergenic
1067708606 10:48629561-48629583 ATGATAGACACGTGGATGAATGG - Intronic
1067851448 10:49757274-49757296 ATGAAGCAGAAGAGGATGTATGG + Intronic
1068405534 10:56583934-56583956 ATGACACAGAGATGGATGTATGG + Intergenic
1071152377 10:82650630-82650652 CTTAAACTGATGTGGATGCATGG - Intronic
1078263033 11:9729430-9729452 AAGAAACAGGAGTGGATTCAAGG + Exonic
1079238867 11:18708305-18708327 AGGAGACAGAGGTGGAGGCATGG + Intronic
1080621828 11:33993146-33993168 AGGACACAGACGTGCATGGAGGG - Intergenic
1084168460 11:67388505-67388527 ACAAAACAGACATGGATGCTGGG + Intronic
1084904570 11:72335677-72335699 ATGAGACAGACTTTAATGCAGGG - Intronic
1085575404 11:77598605-77598627 AGGAAACAGGCATGGAGGCATGG - Intronic
1089537016 11:119167163-119167185 ATCAACCAGACGTGGTGGCATGG - Intronic
1090363932 11:126190882-126190904 AGGAAACAGGCCTGGACGCACGG - Intergenic
1091121128 11:133058530-133058552 ATAAAACAGAAGTGGACACAGGG - Intronic
1091133062 11:133162770-133162792 AGGAAACAACCGTGTATGCATGG - Intronic
1092302798 12:7268174-7268196 AGGAAAGAGATGTGGAAGCAAGG - Intergenic
1093210134 12:16298070-16298092 ATGACACAAAAGTGGAGGCAAGG - Intergenic
1095279727 12:40336021-40336043 ATGAGACAGAGGTAGAAGCAGGG - Intronic
1098654865 12:73015120-73015142 AGCAAACACACGTGTATGCATGG - Intergenic
1102198924 12:111044163-111044185 AAGAAACAGACTTGAAGGCAGGG - Intronic
1104033942 12:125085413-125085435 ATGAAACAGACGTGGATGCAAGG - Intronic
1104414473 12:128586778-128586800 ATGAGCCAGACGTGGCTTCAGGG - Intronic
1110159232 13:72355510-72355532 CTGAAACAGACGTGGGTGCCAGG + Intergenic
1113530544 13:111021586-111021608 ACAAAACAGACGTGGCTGAAAGG - Intergenic
1113971639 13:114195736-114195758 ATTAAAGTGAGGTGGATGCAGGG + Intergenic
1114145491 14:19972007-19972029 ATAAGACAGAAGTGGATTCAGGG - Intergenic
1114539433 14:23443670-23443692 ATTAGACAGACGTGCCTGCATGG + Intergenic
1114803510 14:25806592-25806614 AAGAAACAGACGTGCATAAAGGG - Intergenic
1115282121 14:31675910-31675932 ATGAAACAGAAGGGGACCCAAGG - Intronic
1119536363 14:75405916-75405938 ATGAATAAAACATGGATGCACGG - Intergenic
1125786351 15:42321857-42321879 ATGTAAAAGCAGTGGATGCAGGG + Exonic
1127666699 15:61154684-61154706 ATGAAACATACCAGAATGCAGGG - Intronic
1127773246 15:62246937-62246959 ATGCCAGAGAGGTGGATGCATGG - Intergenic
1127774561 15:62254949-62254971 ATGCCAGAGAGGTGGATGCATGG - Intergenic
1129394379 15:75236114-75236136 AGGAAACAGCGGAGGATGCAAGG - Intergenic
1130865346 15:87929123-87929145 ATGAAAAAGACATGTAAGCAAGG + Intronic
1132158486 15:99514307-99514329 ATGAAAGAGAAGGGGGTGCATGG - Intergenic
1136614981 16:31393192-31393214 ATGGAACAGAAGTGGGGGCAGGG - Intergenic
1137546837 16:49410624-49410646 AGGAAGCAGACCTGGAGGCAAGG + Intergenic
1139116474 16:63960463-63960485 ATGAATCAGAGCTGGTTGCATGG + Intergenic
1140847104 16:78901421-78901443 ATGAAACAGAAGTGGTTGTGGGG - Intronic
1142991908 17:3736995-3737017 AGGAAACAGTAGTGGATGCCTGG + Intronic
1143890455 17:10098428-10098450 ATGAACCTAACGAGGATGCAGGG + Intronic
1144457520 17:15431166-15431188 CAGAAACAGACCTGGATGTAGGG + Intergenic
1146667443 17:34714635-34714657 ATGAAAAAGGGGTGGAAGCAAGG - Intergenic
1148457312 17:47818049-47818071 CATAGACAGACGTGGATGCAGGG - Intronic
1149396097 17:56245705-56245727 AAGAAACAGAAGTGGAAGCTAGG + Intronic
1151300434 17:73220729-73220751 ATAAAACAGAAGTGGCTGCCGGG - Intronic
1152960656 18:78600-78622 ATGAAACAGAAGTTGATACAAGG - Intergenic
1153347342 18:4041744-4041766 AGGAAACAGATGTGGTTGTATGG - Intronic
1153522704 18:5967449-5967471 GGGAAACAGAGGTGGCTGCATGG - Intronic
1153863462 18:9237907-9237929 ATTAAATAAACGGGGATGCAGGG - Intronic
1154167926 18:12029807-12029829 ATGAAACAGCTCTGGATGCATGG - Intronic
1155140538 18:23040324-23040346 AAGAAACAGATGTGGAAGCTGGG + Intergenic
1156240502 18:35249171-35249193 ATAAAACAGACAGGGATTCAGGG + Exonic
1158211910 18:55060498-55060520 ATGCAAAAGACATGAATGCAGGG - Intergenic
1160717730 19:583972-583994 ACGGAACAGATGTGGTTGCAGGG + Intergenic
1163183579 19:15620822-15620844 TTGCAAAAGATGTGGATGCAGGG + Intronic
1163465239 19:17464129-17464151 ATGAAACCTACCTGGATTCAAGG - Intergenic
1167494537 19:49809847-49809869 ATGTAACAGGCCTGGATGAACGG - Intronic
1168366242 19:55790356-55790378 ATGAAACACATGTAGATGAATGG + Intronic
930048607 2:47195367-47195389 AGGAAACAGACTGGGAAGCAGGG - Intergenic
930635689 2:53803164-53803186 AAGAAACATACTTGGCTGCAAGG + Intronic
932551545 2:72775039-72775061 ATGAGAAAGAGGGGGATGCAAGG + Intronic
935798419 2:106668263-106668285 ATGAAACACACGTGTATGACTGG - Intergenic
940251038 2:151676852-151676874 ATGAAATAGATGAGGATTCATGG - Intronic
941070413 2:160948446-160948468 ATGAAGCAGACTTGGTGGCAAGG + Intergenic
942149409 2:173059877-173059899 CTGAAACAGTCGTGGGTGGAGGG + Intergenic
942236972 2:173920340-173920362 ATGTAATATAGGTGGATGCATGG + Intronic
942652180 2:178180548-178180570 ATGTAACAAACCTGCATGCACGG - Intergenic
944914690 2:204346350-204346372 ATTAAACAGATGTGGAGGAAGGG - Intergenic
945485785 2:210394376-210394398 CTGAAACAGAAATGGATTCATGG - Intergenic
946023013 2:216654680-216654702 AAGAAACAGATGCTGATGCATGG + Intronic
946700657 2:222409870-222409892 ATGAAGAAAATGTGGATGCAAGG - Intergenic
946865992 2:224041110-224041132 TTGAGACAGAAATGGATGCAGGG - Intergenic
948242799 2:236452385-236452407 ATGAAAAATATGTGGATGGAGGG + Intronic
948394724 2:237636584-237636606 AAGAAACAGACCAGGATGCAGGG - Intronic
1170409160 20:16069824-16069846 ATGAAACAGAAATGGGTGAAAGG + Intergenic
1171130306 20:22646259-22646281 CTGAAACAGGGATGGATGCATGG + Intergenic
1175406880 20:58740754-58740776 ATCAGACAGACGTGGACTCAAGG + Intergenic
1175911671 20:62408008-62408030 GTGACACAGAGGTGGGTGCAAGG - Intergenic
1177169911 21:17643698-17643720 ATGAAACAGAAGTAGATGGCTGG + Intergenic
1177857214 21:26413077-26413099 ATTAAACAGAGCTGGAGGCAGGG + Intergenic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1178721758 21:35016766-35016788 ATGAAACAGCCCTGGATGGAAGG - Intronic
1179177646 21:39020851-39020873 AGGAAACAGACGTGTGTGCCGGG + Intergenic
1180219041 21:46346368-46346390 AGGAGACACACGTGGATGCTGGG + Intronic
1181875626 22:25938359-25938381 ATGAAACAGAGGTGGGTGAGGGG + Intronic
1203311092 22_KI270736v1_random:143328-143350 ATGAAATAGACTGGAATGCAAGG + Intergenic
950658720 3:14453349-14453371 ATGAGACAGACGAGGAAGCTGGG + Intronic
959480548 3:106867034-106867056 ATGAGACAGACGAGGAGGCTGGG - Intergenic
963070932 3:141304580-141304602 CTGAGACAGACGTGTGTGCAGGG - Intergenic
967179892 3:186894738-186894760 CTGAGACAGACGAGGATGAAGGG - Intergenic
969206466 4:5651013-5651035 ATGATAAACACGTGGATGGATGG + Intronic
970094740 4:12450193-12450215 AGGAAGCAGCCCTGGATGCATGG + Intergenic
970425432 4:15941217-15941239 ATGGGACAGATGTGGAGGCAAGG + Intergenic
970664942 4:18326052-18326074 ATGAAATAGACCAGGATGAATGG + Intergenic
970962548 4:21889859-21889881 ATGAATCAAACGTGGAAACACGG - Intronic
970983666 4:22130238-22130260 ATGAAACAGACGTGGAGTGTGGG - Intergenic
973295477 4:48515351-48515373 ATAAAACAGACTTAGATGGATGG - Intronic
973978071 4:56283077-56283099 ATGAGACAGAGGTGTATGCTGGG - Intronic
977098531 4:92777382-92777404 ATGAGAAAAACGTGGAGGCACGG - Intronic
978346324 4:107773897-107773919 ATGAAAAAGAGCTGGAAGCAAGG - Intergenic
978950062 4:114547396-114547418 ATAAAACAGAGGTGAATGAAAGG - Intergenic
981463379 4:145037244-145037266 ATGAAACAGAATTGTATGTATGG + Intronic
981667712 4:147248336-147248358 AGCAAACAGAAGTGGATGGAGGG - Intergenic
981728444 4:147872223-147872245 ATGAGACAGAGGTGGCTGCTGGG + Intronic
982172860 4:152678628-152678650 AAGAAACAGAGGTGGAAGAAGGG - Intronic
985046245 4:185943096-185943118 ATGAAACAGATTTGGATTAATGG + Intronic
986210724 5:5668874-5668896 ATTAAACATCCATGGATGCATGG - Intergenic
987811744 5:22845696-22845718 ATGAAACAAAGGGGGATGCTGGG + Intronic
989289479 5:39746837-39746859 AGGAAAGAGAAGTGTATGCAGGG - Intergenic
995784264 5:115811998-115812020 ATGAAGCAGTCGTGGTTACAGGG + Intronic
995910353 5:117179543-117179565 CAGAAACAGACCTTGATGCAGGG + Intergenic
997526445 5:134556002-134556024 ATGAAGGAGACGGGGAGGCAGGG - Intronic
997731212 5:136178729-136178751 ATGAATCAGCAGTGGATGTAGGG + Exonic
997827767 5:137122978-137123000 ATGAAGCAGAAGTGGCTTCAGGG + Intronic
997895038 5:137708840-137708862 AGGAAACAGACAAGAATGCAGGG + Intronic
998224841 5:140318990-140319012 ATGAAACAGATGGGCAGGCAGGG - Intergenic
999121709 5:149214792-149214814 AGGAAACAGACAGGGATGGAAGG - Intronic
999445010 5:151632308-151632330 AGGAAGGAGACATGGATGCATGG + Intergenic
999451563 5:151682128-151682150 AGGAAATAGAAGTGGAAGCAGGG - Intronic
999635763 5:153620555-153620577 AGGAAATAGACCTGGATCCAGGG + Intronic
1002777010 6:336820-336842 AAGAAACAGAAGTGGTTGGAAGG + Intronic
1007151762 6:39700440-39700462 ATGAAACTGACTTGCATGTAGGG - Intronic
1011957594 6:93042258-93042280 ATGAAAGAAACGTGGATTCGAGG + Intergenic
1012935391 6:105362739-105362761 ATGAAACAGTGGTGGACACAAGG + Intronic
1013373710 6:109493627-109493649 ATGAAAGAGACCTGGATGTGTGG + Intronic
1013845263 6:114443360-114443382 AGGCAACAGATGTGGATGCTGGG - Intergenic
1015903572 6:138092866-138092888 AGGAAACAGACGTGGAGGGAGGG + Intronic
1016409907 6:143771909-143771931 ATGGGACAGACGTGGGGGCAAGG + Intronic
1019239971 6:170657525-170657547 AGGACAAACACGTGGATGCATGG - Intergenic
1019240170 6:170658278-170658300 AGGACAAACACGTGGATGCATGG - Intergenic
1020768976 7:12363308-12363330 ATGAAAAAGACAGGGATGCATGG + Intronic
1029680803 7:102107799-102107821 ATGGAGCAGACGGGGAGGCAAGG - Intronic
1029915657 7:104207492-104207514 ATGTAACAGATGTGTTTGCAGGG - Intronic
1031383557 7:121118134-121118156 AATACACAGACGTGGATGGAAGG - Intronic
1035436186 7:158861694-158861716 ATGTGACAAACGTGGCTGCAGGG - Intronic
1038223139 8:25629746-25629768 ATGAAACATACCTGGGTACACGG - Intergenic
1039040675 8:33405151-33405173 ATGAAAGAGACATGGATGATAGG - Intronic
1039064979 8:33599808-33599830 ATGACACACACGTCGAAGCAGGG + Exonic
1041531848 8:58877797-58877819 ATGAAACAGAGGTTGTTGCTGGG - Intronic
1046438164 8:114222351-114222373 ATGAAACAGAGGTGAATGAGGGG - Intergenic
1046500356 8:115068853-115068875 ATGAAATTGTAGTGGATGCATGG + Intergenic
1046848877 8:118950928-118950950 ATGAATCAGACATTTATGCAAGG - Intronic
1047118432 8:121871942-121871964 ATGAAATAGAAGTGGGTGCAGGG - Intergenic
1047448583 8:124942158-124942180 ATGAAAAAGACATGGAGGCCAGG + Intergenic
1048656013 8:136536651-136536673 ATAAAACAAACGTAGATGAAGGG + Intergenic
1049994039 9:1017823-1017845 GGGGAACAGACGTGGATGCCAGG - Intergenic
1050646600 9:7726218-7726240 ATGAAACAATCGTGGTTGCTGGG - Intergenic
1051178454 9:14384846-14384868 ATCAAACAATCTTGGATGCAAGG - Intronic
1052134841 9:24897357-24897379 ATGATACAGAAGTGGAGACATGG + Intergenic
1053377802 9:37622769-37622791 ATTAAACAAAATTGGATGCAAGG + Intronic
1056750772 9:89349602-89349624 AAAAAACAGACGAGGATGCCTGG - Intronic
1056797149 9:89666472-89666494 ATCCAAAACACGTGGATGCAGGG + Intergenic
1058006657 9:99923361-99923383 ATGAAAAAAACCTGCATGCAAGG + Intronic
1058823491 9:108754172-108754194 ATGATACAGACTGGGATGGAAGG - Intergenic
1059174887 9:112160690-112160712 AAGAAAAAGAGATGGATGCATGG + Intronic
1062151378 9:135020932-135020954 CTGAAACACCCGTGGACGCAAGG - Intergenic
1062737441 9:138145147-138145169 ATGAAACAGAAGTTGATACAAGG + Intergenic
1203600391 Un_KI270748v1:7666-7688 AGGACAAACACGTGGATGCATGG - Intergenic
1203600608 Un_KI270748v1:8513-8535 AAGACACACACGTGGATACATGG - Intergenic
1189102606 X:38206959-38206981 ATGAAACAGCTGTGGAAGCAAGG - Intronic
1189700433 X:43713281-43713303 ATTAAGAAGACATGGATGCAGGG + Intronic
1189847269 X:45149162-45149184 TGGAAACACACCTGGATGCAGGG + Exonic
1193217963 X:78886889-78886911 ATGGAAGAGTCGTGGATGAATGG + Intergenic
1193863569 X:86701183-86701205 TTGAAACAGTCTTGGATGCCAGG - Intronic
1196456039 X:115892424-115892446 GTGAAACAGAAATGAATGCAAGG + Intergenic
1197066414 X:122238530-122238552 ATGAAACAAAAGTGGGGGCAAGG - Intergenic
1198137896 X:133772455-133772477 ATGAAAGAGACGTGATTCCAGGG - Intronic
1199514188 X:148656871-148656893 ATCATACAGAACTGGATGCAAGG - Intronic
1199589644 X:149455325-149455347 AAGAAACACACGTGGCTCCAGGG + Intergenic
1199717036 X:150514363-150514385 ATGAAACAGAGGGGGATGGGAGG + Intergenic