ID: 1104034931

View in Genome Browser
Species Human (GRCh38)
Location 12:125091591-125091613
Sequence GGCTGAATTCCCAGGGGAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 476
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 432}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104034915_1104034931 15 Left 1104034915 12:125091553-125091575 CCCCTTGCCCTGTGAGCATCCTG 0: 1
1: 0
2: 2
3: 55
4: 267
Right 1104034931 12:125091591-125091613 GGCTGAATTCCCAGGGGAGCCGG 0: 1
1: 0
2: 1
3: 42
4: 432
1104034918_1104034931 13 Left 1104034918 12:125091555-125091577 CCTTGCCCTGTGAGCATCCTGGG 0: 1
1: 0
2: 0
3: 53
4: 391
Right 1104034931 12:125091591-125091613 GGCTGAATTCCCAGGGGAGCCGG 0: 1
1: 0
2: 1
3: 42
4: 432
1104034916_1104034931 14 Left 1104034916 12:125091554-125091576 CCCTTGCCCTGTGAGCATCCTGG 0: 1
1: 0
2: 2
3: 31
4: 299
Right 1104034931 12:125091591-125091613 GGCTGAATTCCCAGGGGAGCCGG 0: 1
1: 0
2: 1
3: 42
4: 432
1104034927_1104034931 -4 Left 1104034927 12:125091572-125091594 CCTGGGCAGGGGCTGCATGGGCT 0: 1
1: 0
2: 8
3: 62
4: 466
Right 1104034931 12:125091591-125091613 GGCTGAATTCCCAGGGGAGCCGG 0: 1
1: 0
2: 1
3: 42
4: 432
1104034923_1104034931 7 Left 1104034923 12:125091561-125091583 CCTGTGAGCATCCTGGGCAGGGG 0: 1
1: 0
2: 3
3: 25
4: 260
Right 1104034931 12:125091591-125091613 GGCTGAATTCCCAGGGGAGCCGG 0: 1
1: 0
2: 1
3: 42
4: 432
1104034921_1104034931 8 Left 1104034921 12:125091560-125091582 CCCTGTGAGCATCCTGGGCAGGG 0: 1
1: 0
2: 1
3: 20
4: 232
Right 1104034931 12:125091591-125091613 GGCTGAATTCCCAGGGGAGCCGG 0: 1
1: 0
2: 1
3: 42
4: 432

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104034931 Original CRISPR GGCTGAATTCCCAGGGGAGC CGG Intronic
900029986 1:364474-364496 GGCAGAATTCCCATGTGGGCAGG - Intergenic
900050637 1:593538-593560 GGCAGAATTCCCATGTGGGCAGG - Intergenic
900242864 1:1625227-1625249 GGCTGAAGTCCCAGAGGGGAGGG + Intronic
900552308 1:3263039-3263061 GGCTGCATGCCCAGAGGAGCTGG - Intronic
900609934 1:3540356-3540378 GGCTGTCTTCCCAGTGCAGCGGG - Intronic
900935842 1:5766022-5766044 GGCTGAAATGTCAGGGGAACAGG + Intergenic
900988881 1:6088827-6088849 GGCTGAACTCCCAGAGGCCCAGG - Intronic
901150149 1:7095899-7095921 TGCGTATTTCCCAGGGGAGCAGG - Intronic
902331698 1:15734114-15734136 GGCAGGATGCCCAGGGGTGCCGG - Exonic
904293327 1:29501795-29501817 TGCTGAATTCCGAAGGGAGGTGG + Intergenic
904989382 1:34579364-34579386 GGCTGCATTCCCAGGAGATTAGG - Intergenic
905037931 1:34929647-34929669 GGCTGGATTTCCCGGGGACCGGG + Intergenic
906155007 1:43608928-43608950 GGGTAAATGCCCAGGGCAGCAGG - Intronic
906184651 1:43852135-43852157 GGCTGGCTTCCCAGAGAAGCAGG - Intronic
906271435 1:44482324-44482346 GGCTCCCTTCTCAGGGGAGCAGG + Intronic
908095201 1:60730234-60730256 GCCTGAATTCCAAAGGGAGAAGG - Intergenic
909691148 1:78409357-78409379 GGCTGGATTCCCAGGCCAGTGGG - Intronic
911625535 1:100119753-100119775 GGCTGAAGGCAAAGGGGAGCAGG - Intronic
912722747 1:112033874-112033896 GGCTGGACACCCAGGAGAGCTGG + Intergenic
913958861 1:143324144-143324166 GGCTGCACTCCTCGGGGAGCAGG + Intergenic
914053178 1:144149524-144149546 GGCTGCACTCCTCGGGGAGCAGG + Intergenic
914126019 1:144817017-144817039 GGCTGCACTCCTCGGGGAGCAGG - Intergenic
915294788 1:154912321-154912343 GGCTGAACTCCCATGGGCTCAGG + Intergenic
915632357 1:157162436-157162458 GCCTGAATTCCAAAGGGAGGAGG + Intergenic
918181438 1:182088339-182088361 GGGTGAATTCCCACGGAAGACGG + Intergenic
919434089 1:197535148-197535170 GGCTCAATTCTCAGGAGAGAAGG + Intronic
919805713 1:201379997-201380019 TGCTGGATTCACAGGGGAGGGGG + Intronic
920457025 1:206109328-206109350 GGCTGGATTCCCTGGGGGGTGGG + Intergenic
920966715 1:210707238-210707260 GGGTGCATTCCCAGGGTAGGGGG - Intronic
921665831 1:217869700-217869722 GCCTGAATTCCAAAGGGAGGAGG + Exonic
922166474 1:223119571-223119593 GCCTGAATTCCAAAGGGAGGAGG - Intronic
923107165 1:230863652-230863674 GCCTGAGCTCCCAGGGCAGCAGG + Intronic
923328788 1:232903485-232903507 GCCTGAATTCCAAAGGGAGGAGG + Intergenic
923448678 1:234096292-234096314 GGCTGCTTTCCCAGGGAGGCTGG - Intronic
924383492 1:243483466-243483488 GGCGGACTTCCCAAGGGAGGAGG - Intronic
924573192 1:245256705-245256727 GCCTGAATTCCAAGGGGAGGAGG - Intronic
1063028067 10:2202548-2202570 GCCTGAATTCCAGAGGGAGCAGG + Intergenic
1064422218 10:15200152-15200174 TGCTGAGATCCCAGGGCAGCTGG - Intergenic
1065771454 10:29082305-29082327 CACTGAAATCGCAGGGGAGCTGG + Intergenic
1065871636 10:29960905-29960927 GGCTGAAATCCAAGGGGTTCTGG - Intergenic
1066062817 10:31739237-31739259 GCCTGAATTCCAAAGGGAGAGGG + Intergenic
1066192901 10:33072049-33072071 GCCTGAATTCCAAAGGGAGGAGG - Intergenic
1066361896 10:34739484-34739506 TGCTGAAATCCCAGGAGTGCTGG + Intronic
1067721717 10:48732344-48732366 GGCTGATTTCCCAGAGCAGCAGG - Intronic
1068749119 10:60571131-60571153 GTCTGATTTCCCAAGGGAGCAGG - Intronic
1069248723 10:66243076-66243098 GCCTGAATTCCAAAGGGAGGAGG - Intronic
1069329677 10:67277563-67277585 GGCTGCATTCCCAGGAGATTAGG + Intronic
1069567413 10:69473134-69473156 GGAAGACTTCCCAGGGGAGGAGG + Intronic
1069635292 10:69921344-69921366 GGATGAAGTCCCATGGGAGTAGG - Intronic
1069885446 10:71620649-71620671 GGCTGTTTTCCCAAGGGAGCTGG + Intronic
1070232589 10:74585565-74585587 TGCTGTACTCTCAGGGGAGCAGG + Intronic
1071070117 10:81681804-81681826 GGCTGCATTCCCAGGAGGTCAGG - Intergenic
1071287321 10:84161152-84161174 GCCTGAATTCCAACGGGAGGAGG + Intergenic
1071725075 10:88190463-88190485 GGATGATTTCCCAGAGGAGGTGG + Intergenic
1071863042 10:89695540-89695562 GCCTGAATTCCAAAGGGAGGAGG - Intergenic
1073330864 10:102669165-102669187 GGCTGCATCCCCATAGGAGCTGG + Intergenic
1074314006 10:112345720-112345742 GGGAGAATTCCCAGGGGAAAGGG + Intergenic
1074502557 10:114040229-114040251 GGCTGAATTCGCTGGGAAGCAGG + Intergenic
1075741955 10:124701455-124701477 GGCTGAAGACCAAAGGGAGCTGG - Intronic
1076588677 10:131568863-131568885 GGCTGAATCCCCGGGGGGGTGGG + Intergenic
1076622012 10:131795623-131795645 AGATTAATTCCCAAGGGAGCAGG - Intergenic
1077084530 11:742338-742360 GGCTGCATTCCCAGGAGGTCAGG - Intergenic
1077098961 11:812840-812862 GGCTTTATTTGCAGGGGAGCAGG - Exonic
1077370437 11:2179343-2179365 GGCTGCGTTCACAGGGGACCTGG + Intergenic
1077715655 11:4577488-4577510 TGCTGAAGTCCGAGGGGAGTGGG + Intronic
1078065984 11:8080071-8080093 GGCTGTAGCCCCAGGGCAGCAGG + Intronic
1078096453 11:8300320-8300342 GGCTCCAATCCCATGGGAGCAGG - Intergenic
1078840283 11:15071680-15071702 GACTGCCTTCCCAGGGGAGGGGG + Intronic
1080614952 11:33937710-33937732 GGATGTATTCCCAGGGAATCTGG + Intergenic
1080825813 11:35848022-35848044 GAGTGAAATCCCAGGGAAGCAGG - Intergenic
1081530179 11:43953134-43953156 GGCTGCATTCCCAGGAGATCAGG + Intergenic
1082986645 11:59174977-59174999 GGCTGAATTCCCAGAAAAGCTGG + Intronic
1083083106 11:60113980-60114002 GCCTGAATTCCAAAGGGAGGAGG + Intergenic
1083277772 11:61606874-61606896 GTCAGAATTCCCAGAGGAGGAGG + Intergenic
1083292731 11:61698907-61698929 TGAGGAGTTCCCAGGGGAGCAGG + Intronic
1084025590 11:66446803-66446825 AGCTGCATTCCCAGGGGAGCAGG - Intronic
1084518854 11:69650767-69650789 CACTGAATTCCCCAGGGAGCTGG + Intronic
1085831030 11:79901135-79901157 GCCTGAATTCCAAAGGGAGGAGG - Intergenic
1086203828 11:84234675-84234697 GCCTGAATTCCAACGGGAGGAGG - Intronic
1086272017 11:85079341-85079363 GCCTGAATTCCAAGAGGAGGAGG + Intronic
1086577163 11:88352249-88352271 GGCAGAATTTCCAGAGGAGAGGG - Intergenic
1086821890 11:91445651-91445673 GGCTGGAGTCCCAGGGCAGTGGG - Intergenic
1086898093 11:92336400-92336422 AGCTGGATTCCCAGCGGAGGTGG + Intergenic
1087501358 11:98958684-98958706 GGCAGAAGGCCCAGGGCAGCAGG + Intergenic
1088256559 11:107908768-107908790 GGCTTTATTTGCAGGGGAGCAGG - Intronic
1088330033 11:108641892-108641914 GCCTGAATTCCAAAGGGAGGAGG - Intergenic
1088747536 11:112817047-112817069 GGCTGTGTCCCCAGGAGAGCTGG - Intergenic
1089858907 11:121571646-121571668 GGGTGAAGTGGCAGGGGAGCCGG - Intronic
1090395502 11:126415597-126415619 GGCTGCTTTGCCAGGGGAGAGGG + Intronic
1091265198 11:134265130-134265152 GGCAGAATCCCCAGTGGAACCGG + Exonic
1091360792 11:134977337-134977359 GGCTGAATTCCCTGGGGTCCTGG - Intergenic
1091386168 12:96735-96757 GCCTGAATTCCTAAGGGAGGAGG + Intronic
1092035631 12:5332275-5332297 GGGAGAATTTCCAGGGGAGCGGG + Intergenic
1092254100 12:6916876-6916898 ACCTGAACTCCCATGGGAGCAGG - Intronic
1092416140 12:8291852-8291874 GGCTGGAGTCCCAGGGGCTCTGG + Intergenic
1093525852 12:20102665-20102687 GGCTGCATGCCCTGTGGAGCTGG - Intergenic
1096411445 12:51379635-51379657 GGCTGAAGTCCCTGGTGAGCCGG - Exonic
1096614528 12:52824228-52824250 AGCTGATTGCCCAGAGGAGCCGG - Exonic
1097459766 12:59846630-59846652 GCCTGAATTCCAAAGGGAGGAGG + Intergenic
1097964239 12:65562072-65562094 GGCTGCATTCCCAGGAGGTCAGG + Intergenic
1098197490 12:68017304-68017326 GGTTGAATTCCAAGGGCAACTGG + Intergenic
1098304713 12:69090984-69091006 GGCTGCATTCACATGGGACCTGG - Intergenic
1099244094 12:80173645-80173667 GGCTGCATTCCCAGGAGGTCAGG - Intergenic
1100091547 12:90978106-90978128 GCCTGAATTCACAGGGGTTCTGG - Exonic
1100799010 12:98212013-98212035 TGCTGCAGTCCCAGGGGAGTGGG + Intergenic
1101757116 12:107629682-107629704 GGCTGCAGTCTCAGGGCAGCAGG - Intronic
1102442628 12:112975222-112975244 GCCAGAATTGCCAGGGGAGACGG + Intergenic
1102444410 12:112990825-112990847 GCCTGAATTCCAAAGGGAGGAGG + Intronic
1103181940 12:118920443-118920465 GTCTGATTTCCCAGGGGGTCTGG - Intergenic
1103407903 12:120688317-120688339 GTCAGAATTGCCAGGGCAGCTGG + Intronic
1104024088 12:125013704-125013726 GCAAGAATTGCCAGGGGAGCTGG + Intronic
1104034931 12:125091591-125091613 GGCTGAATTCCCAGGGGAGCCGG + Intronic
1104127793 12:125863908-125863930 GGCTGCATTCCCAGGAGAATAGG - Intergenic
1104355333 12:128080175-128080197 GCCTGAATTCCAAAGGGAGGAGG - Intergenic
1104416120 12:128597923-128597945 GGCAGAGGTCCCAGGGTAGCTGG + Intronic
1104492123 12:129203445-129203467 GGCTGAGTTCCCACAGAAGCAGG - Intronic
1104530469 12:129565472-129565494 GCCTGAATTCCAAAGGGAGGAGG + Intronic
1104639343 12:130457495-130457517 AGCTCAAGTCCCAGGGGAGCAGG - Intronic
1104655980 12:130574345-130574367 GGCTGAGTTCCTAGGGAAGGAGG - Intronic
1105545583 13:21348321-21348343 GGCTTGGTTCCCAGGGGAGCAGG - Intergenic
1105672641 13:22636773-22636795 GGCTGAGCTCCCATGGCAGCCGG - Intergenic
1105753571 13:23444373-23444395 GGCTGGAGACCCAGGGAAGCTGG - Intergenic
1107117409 13:36762051-36762073 GCCTGAATTCCAAAGGGAGGAGG + Intergenic
1107127913 13:36864389-36864411 GGCTGCATTCCCAGGAGGTCAGG + Intronic
1107155817 13:37166023-37166045 GCCTGAATTCCCAAGAGAGGAGG - Intergenic
1107313542 13:39106180-39106202 TGCTGAGTTCCAAGGGGAGTGGG + Intergenic
1107435822 13:40380051-40380073 GGCTCACTTCCCAGGGGAGTCGG - Intergenic
1107708691 13:43131901-43131923 GGCTGCATTCCCAGGAGATCAGG - Intergenic
1108254401 13:48596588-48596610 GGCTGAATTCCCAGGAGGTTAGG + Intergenic
1108459357 13:50649696-50649718 GGCTGCATTCCCAGGAGGTCAGG - Intronic
1109072560 13:57787591-57787613 GACTGAATTCCCAGGGGGAGAGG - Intergenic
1111911169 13:94313517-94313539 GGCTGTATACCCTGGGGAGAAGG + Intronic
1113479777 13:110612010-110612032 GCCTGAATTCCAAAGGGAGGAGG - Intergenic
1114529306 14:23385919-23385941 TGCTGCATTCCCAGGTGAGGGGG - Exonic
1114843554 14:26294104-26294126 AGGTGTATCCCCAGGGGAGCTGG - Intergenic
1114958161 14:27849213-27849235 GACTGAGTTCCCAGGGGAAGGGG + Intergenic
1115933533 14:38526048-38526070 GCCTGAATTCCAAAGGGAGGAGG + Intergenic
1116396744 14:44455672-44455694 TGCTTATTTCCCAGAGGAGCTGG - Intergenic
1117309317 14:54506353-54506375 GGCTGGAATCTCAGGGAAGCAGG + Intergenic
1118427795 14:65685984-65686006 GGCTGCATTCCCAGGAGGTCAGG - Intronic
1118505982 14:66412280-66412302 GGATTAATTCCCAGGAGAGCAGG + Intergenic
1119323295 14:73744156-73744178 AGCTGACATCCCAGGAGAGCTGG - Intronic
1120061290 14:79985938-79985960 GGCTGCATTCCCAGGAGATTAGG - Intergenic
1120970489 14:90203003-90203025 GCCTGAATTCCCAGTGGAGGAGG - Intergenic
1121634219 14:95442893-95442915 GGCGTAACTCCCAGGAGAGCAGG + Intronic
1121729090 14:96173903-96173925 CGCTGCAGGCCCAGGGGAGCTGG + Intergenic
1122276789 14:100594788-100594810 GGTTGAGATCCCAGGGGAGCTGG - Intergenic
1122353608 14:101111204-101111226 GGCAGTTTTCCCAGAGGAGCCGG + Intergenic
1122367068 14:101200617-101200639 GGCTCCATTCACAGGGCAGCAGG + Intergenic
1122462757 14:101909020-101909042 GGCTGCAGTCCCATGGCAGCTGG + Intronic
1123422751 15:20145177-20145199 GGCTGCACTCCTTGGGGAGCAGG + Intergenic
1123531975 15:21151717-21151739 GGCTGCACTCCTTGGGGAGCAGG + Intergenic
1124064242 15:26324975-26324997 GCCTGAATTCCAAAGGGAGCAGG - Intergenic
1124208751 15:27744881-27744903 GCCTGAATTCCAAAGGGAGGAGG - Intergenic
1124230639 15:27943242-27943264 GTCTGAATTCCAAAGGGAGTGGG - Intronic
1126158282 15:45585589-45585611 GCCTGAATTCCAAAGGGAGGAGG + Intergenic
1127774431 15:62254216-62254238 GGCTGAGCTCTGAGGGGAGCAGG - Intergenic
1127949714 15:63793198-63793220 GGCTGAATTCCCAGGAGGTTAGG + Intronic
1130283402 15:82536514-82536536 GGCTGAAGACCCAGGGAAGCAGG + Intergenic
1130695052 15:86122836-86122858 GCCTGAATTCCAAAGGGAGGAGG - Intergenic
1132336191 15:101050135-101050157 GGCTGAAATTGCAGGGGAGCCGG + Intronic
1132399427 15:101496404-101496426 GGCAGGATTCCCTGGGGACCAGG - Intronic
1132704768 16:1239034-1239056 GGCTGGGGTCCCAGGGGAGGTGG - Intergenic
1133328197 16:4955120-4955142 GGCTGATTCCCCAGGGGTGCTGG - Intronic
1134095914 16:11418296-11418318 GGCTGCATTCCCAGGAGGTCAGG + Intronic
1134341438 16:13350360-13350382 GGCTGGAGACCCAGGGAAGCTGG - Intergenic
1136012304 16:27371804-27371826 GGCAGATGTCCCAGGGAAGCAGG - Intergenic
1136718958 16:32304378-32304400 GGCTGCACTCCTCGGGGAGCAGG + Intergenic
1136723982 16:32342734-32342756 GGCTGCACTCCTCGGGGAGCAGG + Intergenic
1136837331 16:33510642-33510664 GGCTGCACTCCTCGGGGAGCAGG + Intergenic
1136842312 16:33548778-33548800 GGCTGCACTCCTCGGGGAGCAGG + Intergenic
1137463870 16:48690446-48690468 GGCTGGAGACCCAGGGAAGCAGG + Intergenic
1137582465 16:49641648-49641670 GGATGAATTCATAGAGGAGCTGG - Intronic
1138031603 16:53563658-53563680 GCCTGAATTCCAAAGGGAGGAGG + Intergenic
1138194863 16:55044609-55044631 GGCTGGAATCCCAGGAGAGATGG - Intergenic
1138261719 16:55628404-55628426 GCCTGAATTCCAAAGGGAGGAGG + Intergenic
1138980120 16:62257943-62257965 GGCTGCATTCCCAGGAGTTCAGG - Intergenic
1138980270 16:62259340-62259362 GGCTGCATTCCCAGGAGTTCAGG + Intergenic
1203002449 16_KI270728v1_random:175031-175053 GGCTGCACTCCTCGGGGAGCAGG - Intergenic
1203007473 16_KI270728v1_random:213393-213415 GGCTGCACTCCTCGGGGAGCAGG - Intergenic
1203123489 16_KI270728v1_random:1558347-1558369 GGCTGCACTCCTCGGGGAGCAGG - Intergenic
1203134054 16_KI270728v1_random:1711437-1711459 GGCTGCACTCCTCGGGGAGCAGG - Intergenic
1203147510 16_KI270728v1_random:1810921-1810943 GGCTGCACTCCTCGGGGAGCAGG + Intergenic
1203152477 16_KI270728v1_random:1849075-1849097 GGCTGCACTCCTCGGGGAGCAGG + Intergenic
1142501747 17:336902-336924 TGGAGAATTCCCAGGGGAGGTGG - Intronic
1143223551 17:5282022-5282044 GGCTGAGTGCCGAGCGGAGCTGG - Intergenic
1143320882 17:6068327-6068349 GTCTGGCTTCCCAGAGGAGCTGG + Intronic
1144787484 17:17840142-17840164 GGCTGGAGACCCAGGGGAGCCGG + Intergenic
1145027902 17:19482771-19482793 GCCTGAATTCCAAAGGGAGGAGG - Intergenic
1145240612 17:21239159-21239181 GGCTGAATTGCCTGTGAAGCTGG - Exonic
1145243462 17:21252886-21252908 GGCAGACTTCCCGGGAGAGCAGG - Intronic
1146541685 17:33701546-33701568 GGCTGAATTCCAAAGGGTGTTGG + Intronic
1146842568 17:36166141-36166163 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146854880 17:36254100-36254122 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG + Exonic
1146870780 17:36377992-36378014 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146882088 17:36450220-36450242 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147068610 17:37934888-37934910 GGCTGAACACCCTGCGGAGCGGG + Exonic
1147073664 17:37978616-37978638 GGCTGAACACCCTGCGGAGCGGG - Intronic
1147080132 17:38014425-38014447 GGCTGAACACCCTGCGGAGCGGG + Intronic
1147085185 17:38058154-38058176 GGCTGAACACCCTGCGGAGCGGG - Exonic
1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG + Intergenic
1147101131 17:38182120-38182142 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147720220 17:42535431-42535453 GGCTGAATTCCCAGGAGGTTAGG - Intergenic
1148951837 17:51320167-51320189 GCCTGAATTCCAAAGGGAGGAGG + Intergenic
1149143542 17:53462356-53462378 GACAGAATTCCGAGGTGAGCAGG + Intergenic
1149845730 17:60008626-60008648 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150084078 17:62265206-62265228 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150096675 17:62382019-62382041 GGCTTTATTTGCAGGGGAGCAGG - Intronic
1151025449 17:70671488-70671510 TGCTGCATTCCAAGGGGAGTGGG - Intergenic
1151134901 17:71937142-71937164 GGCTGCATTCCCAGCGGATTAGG - Intergenic
1151728415 17:75897278-75897300 GGCTGAAGGCCCAGGGGGGTGGG - Intergenic
1151865830 17:76801890-76801912 GGCTGCATTCCCAGGAGGTCAGG - Intergenic
1152949771 17:83222086-83222108 GGCAGAATTCCCATGTGGGCAGG + Intergenic
1153052217 18:909646-909668 GGCTGTATACACAGGGTAGCTGG - Exonic
1153707098 18:7757140-7757162 GGAAGAATTCACAGGGGAGAAGG - Intronic
1154415858 18:14174872-14174894 GGCTGCACTCCTCGGGGAGCAGG + Intergenic
1154494508 18:14945605-14945627 AGCTGAATTCCCTGGGGTTCTGG + Intergenic
1156133220 18:34003897-34003919 GCCTGAATTCCAAAGGGAGGAGG - Intronic
1157340260 18:46771841-46771863 GGCTGAAGTCACAGAGGAGCAGG - Intergenic
1158009771 18:52715624-52715646 GGCTGACTTCCGAGGGCTGCTGG + Intronic
1159909064 18:74126669-74126691 GACTGAAATCCCTGAGGAGCTGG + Intronic
1160200146 18:76789077-76789099 GGCTGGGTTCCCAGGTGTGCTGG - Intergenic
1160345629 18:78129505-78129527 GAATGAATTCCCAGGAGATCCGG - Intergenic
1160972545 19:1775931-1775953 GGCTGAGGTCCCTGGGGAGGGGG - Exonic
1161795727 19:6385625-6385647 GGCTGTTGTTCCAGGGGAGCAGG + Intronic
1162646795 19:12055990-12056012 GGCTGCATTCCCAGGTGATTAGG - Intergenic
1163679823 19:18674721-18674743 GGCTGAGTGCCCAGGGCAGATGG - Intergenic
1165389343 19:35529447-35529469 GGCCGAAGACCCAGGGCAGCAGG + Intergenic
1165442222 19:35835656-35835678 GGTTCCATTCTCAGGGGAGCCGG + Intronic
1166389502 19:42401342-42401364 GGATGAAGTCCGAGGGGAGGTGG + Intergenic
1167393507 19:49211848-49211870 GGCTTGATTCCTGGGGGAGCTGG + Intergenic
1167592239 19:50410294-50410316 GACTCAAGTCCCAGGGGAGAAGG - Intronic
1168074370 19:53971563-53971585 GGCTGAAATCCCTGAGGAGGGGG - Intronic
1168584222 19:57579573-57579595 GCCTGAATTCCAAGGGGAGGAGG + Intronic
1202692576 1_KI270712v1_random:101947-101969 GGCTGCACTCCTCGGGGAGCAGG + Intergenic
927853308 2:26513311-26513333 GGGTGAAGTCCCAGAGAAGCAGG + Intronic
928604509 2:32933270-32933292 GGCTGCATTCCCAGGAGACTAGG + Intergenic
929327879 2:40639649-40639671 TGCTGAACTCTCAAGGGAGCTGG + Intergenic
931275915 2:60743789-60743811 TGCTGAAGTCCGAGGGGAGTGGG + Intergenic
932890098 2:75587107-75587129 GGCTGAATTCCCTGGGAGTCAGG + Intergenic
933953828 2:87352024-87352046 GGCTGCACTCCTCGGGGAGCAGG - Intergenic
934275171 2:91568466-91568488 GGCTGCACTCCTCGGGGAGCAGG + Intergenic
934479137 2:94618831-94618853 GACTGAGTTCCCAGGGGAAGGGG - Intergenic
934568590 2:95354132-95354154 GGGAGAGTTCCCAGGGGAGATGG - Intronic
934780919 2:96969127-96969149 TGCTAAATTGCCAGGGAAGCAGG + Intronic
934881356 2:97983307-97983329 GCCTGAATTCCAAAGGGAGGAGG + Intronic
935274518 2:101464464-101464486 GACTCTATTCCCAGGGGAGGAGG + Intronic
935402448 2:102674520-102674542 GTCAGTATTCCCAGGGGACCTGG + Intronic
936111768 2:109670879-109670901 GGCTGCACTCCTTGGGGAGCAGG - Intergenic
936476374 2:112843473-112843495 TGCAGAATTCCCATGGAAGCAGG - Intergenic
936586437 2:113762547-113762569 GCCTGAATTCCAAAGGGAGGAGG + Intergenic
938287126 2:130128085-130128107 GGCTGCACTCCTTGGGGAGCAGG + Intronic
938428467 2:131210785-131210807 GGCTGCACTCCTTGGGGAGCAGG - Intronic
938469369 2:131544803-131544825 GGCTGCACTCCTTGGGGAGCAGG - Intergenic
940190712 2:151037396-151037418 GGCTGCATTCCCAGGAGAGAAGG + Intronic
940313487 2:152303839-152303861 GGCTGCATTCCCAGGAGGGTAGG + Intergenic
940993958 2:160126986-160127008 GCCTGAATTCCAAAGGGAGAAGG - Intronic
943309255 2:186306584-186306606 GCCTGAATTCCAAAGGGAGCGGG - Intergenic
946462181 2:219878497-219878519 GGCTGTATTCCCAGGAGATTAGG + Intergenic
947267470 2:228299565-228299587 GCCTGAATTCCAAATGGAGCAGG + Intergenic
947663976 2:231891498-231891520 AGCTGAAGTCCGAGGGGAGTGGG - Intergenic
948172618 2:235917229-235917251 AGCTGATTTTCCAGGGGAGGTGG + Intronic
948672488 2:239577479-239577501 GCTGGAAGTCCCAGGGGAGCAGG + Intergenic
948764096 2:240210706-240210728 GGCTGGCTCCCCAGGTGAGCCGG - Intergenic
948828234 2:240584686-240584708 GGGTGAGTTCCCATGAGAGCTGG - Intergenic
948869018 2:240789094-240789116 GGGTGACCTTCCAGGGGAGCAGG + Intronic
948993553 2:241566671-241566693 GTTTGAATTCCCAGCTGAGCTGG + Intronic
948993713 2:241567666-241567688 GTTTGAATTCCCAGCTGAGCTGG - Intronic
1168845855 20:944354-944376 GCCTGAATTCCAAAGGGAGGAGG + Intergenic
1169033533 20:2431715-2431737 GGAAGAAGTCCCAGTGGAGCTGG + Intronic
1169263142 20:4152114-4152136 GGCTGTATGCCGAGGGCAGCCGG + Intronic
1169273644 20:4218748-4218770 GGCTGCATTCCCAGGAGATCAGG + Intergenic
1169940058 20:10927309-10927331 GGCTGAAATCAGAGGTGAGCTGG - Intergenic
1170163401 20:13338460-13338482 GGCTGCATTCCCAGGAGGTCAGG - Intergenic
1172276904 20:33685029-33685051 GGCTGAATTCCAGTGGGAGAAGG - Intronic
1172982649 20:38955996-38956018 GGTTTCACTCCCAGGGGAGCGGG + Intergenic
1173460295 20:43237837-43237859 GGCAGGATTCCCAGAGGAGTGGG + Intergenic
1173842012 20:46163677-46163699 GGCTGATTTCCCAGGGGAAGGGG - Intergenic
1173963526 20:47093326-47093348 TGCTGAAGTCCGAGGGGAGTGGG + Intronic
1174122748 20:48279002-48279024 GGCTGTATTCCCAGGAGGCCAGG + Intergenic
1174259097 20:49280428-49280450 AGCTAGATGCCCAGGGGAGCTGG - Intergenic
1175058576 20:56220570-56220592 GGCTGCATTCCCAGGGGGTTAGG + Intergenic
1175209420 20:57341310-57341332 GGCTGAATTCCCAGAAGAACTGG + Intronic
1175677931 20:60962626-60962648 GACTGATTCCCCAGGGAAGCTGG - Intergenic
1175925930 20:62471319-62471341 GGCTGCAGTCTCACGGGAGCTGG + Intronic
1176008579 20:62880065-62880087 GGCTGAATGCCCCTGGGACCTGG + Exonic
1176291797 21:5049692-5049714 GGCTGTATTCCCAGGGTGTCAGG - Intergenic
1178469829 21:32882643-32882665 GGCTGCATTCCCAGGAGGTCAGG - Intergenic
1178482210 21:32989380-32989402 GGCTGAATCCACAGGTGTGCTGG - Intergenic
1178514481 21:33235256-33235278 GGCTGCATTCCCAGGGGGTTAGG - Intronic
1178719067 21:34992219-34992241 GGCAGAACTTCCAGGGAAGCAGG - Intronic
1179451140 21:41469171-41469193 GGCTGAAGCCCCAGGGTGGCGGG - Intronic
1179488892 21:41727790-41727812 GCCTGGCTTCCCAGGGGTGCAGG - Intergenic
1179609942 21:42543743-42543765 GGGAGACTTCCCCGGGGAGCCGG + Intronic
1179865459 21:44213949-44213971 GGCTGTATTCCCAGGGTGTCAGG + Intergenic
1180163698 21:46009372-46009394 GGCTGGCCTCACAGGGGAGCTGG - Intergenic
1180548905 22:16526734-16526756 GGCTGCACTCCTCGGGGAGCAGG - Intergenic
1180794407 22:18595064-18595086 GGCTGTCCTTCCAGGGGAGCAGG - Intergenic
1181026521 22:20130801-20130823 GGGTGCTTCCCCAGGGGAGCAGG + Intronic
1181227332 22:21400256-21400278 GGCTGTCCTTCCAGGGGAGCAGG + Intergenic
1181251318 22:21534583-21534605 GGCTGTCCTTCCAGGGGAGCAGG - Intergenic
1181355803 22:22295149-22295171 GGCTGCACTCCTCGGGGAGCAGG + Intergenic
1181630191 22:24147093-24147115 GACTGAATACCCAGGGCAGCTGG - Intronic
1181633240 22:24162320-24162342 GGCTGAATTCCCATGGCTGGTGG + Intronic
1182501711 22:30752944-30752966 GCCTGAATTCCAAAGGGAGGAGG + Intronic
1182678066 22:32055649-32055671 GACTGAAGTCCCAGGGGCACAGG - Intronic
1182686376 22:32123652-32123674 GGCTGCATTTCCTGGGAAGCAGG - Intergenic
1182762713 22:32735553-32735575 GGCTGGATTTGCAGGGAAGCTGG - Intronic
1183325511 22:37189386-37189408 GGCTGCATTCCCAGGAGGTCAGG - Intronic
1184338320 22:43869148-43869170 GGCTGCATTCCCAGGGGGCTAGG + Intergenic
1184556043 22:45233616-45233638 GGCTGACTCACCAGGGGACCTGG + Intronic
1184727818 22:46356712-46356734 CACTGAGCTCCCAGGGGAGCAGG - Intronic
1184978340 22:48079011-48079033 GCCTGAAGTCTCAGGGGAGCAGG + Intergenic
949364512 3:3266500-3266522 GGCTGCATTCCCAGGGGATTAGG + Intergenic
952179922 3:30906823-30906845 GGCTGCATTCCCAGGAGATCAGG - Intergenic
952503834 3:33989480-33989502 TGCTGAGTTCCCAGGGGAAGGGG - Intergenic
953080075 3:39608650-39608672 AGCTGAATTCCCATAGAAGCAGG + Intergenic
953505411 3:43481536-43481558 GCCTGAATTCCAAAGGGAGGAGG - Intronic
953534130 3:43764594-43764616 GGCTAAAATGCCAGGGGAGAGGG + Intergenic
954221102 3:49154436-49154458 GACAGCATTCCCAGGGAAGCAGG - Intergenic
954231046 3:49217950-49217972 TGCTGAAGTCCAAGGGGAGTGGG + Intronic
954626246 3:52023515-52023537 GGAGGACTTCCCAGGGGAGGAGG + Intergenic
955010638 3:55011220-55011242 GGCTGACAGCCCAGTGGAGCAGG + Intronic
955511128 3:59681304-59681326 GGCTGAAGTCAAAGGGAAGCTGG - Intergenic
957814354 3:85273842-85273864 GGATGAAATCCCAAGGGAGATGG + Intronic
957893071 3:86384657-86384679 GGCTGAATTCCCAGGAGGTTAGG - Intergenic
961057030 3:123797997-123798019 GGCAGAATTCCCTGGGAAGGTGG + Intronic
961139980 3:124547655-124547677 AGCTAAAGTCCCAGGAGAGCAGG + Intronic
961644502 3:128385386-128385408 GCCTGCATTCCCAGGGCAGCAGG - Intronic
962258936 3:133890963-133890985 GGCTGGTAGCCCAGGGGAGCAGG + Intronic
962357845 3:134710100-134710122 GGCTGAGGTCCCAGGCCAGCTGG - Intronic
962419830 3:135218201-135218223 AGCAGAATTTCCAGGGGACCAGG - Intronic
962709044 3:138070201-138070223 GGCTGATTTCCCAGGTGAGGTGG + Intronic
963301062 3:143597638-143597660 TGCTGAAGTCCGAGGGGAGTGGG - Intronic
963844384 3:150140642-150140664 TGCTGAAGTCCAAGGGGAGTGGG + Intergenic
965803029 3:172513709-172513731 GGGGGAATTCCCAGGGTAGGAGG - Intronic
966382202 3:179355330-179355352 GGCTGCATTCCCAGGAGATGAGG - Intronic
966994585 3:185267228-185267250 GCCTGAATTCCAAGGGGTGGTGG - Intronic
967223074 3:187265555-187265577 GGCTGAATTCCCAGGGCCCCAGG - Intronic
967885612 3:194331671-194331693 GGCTGAGGTCCCACGGTAGCTGG - Intergenic
968047133 3:195630823-195630845 GTCGGATTTCCCAGGGAAGCTGG + Intergenic
968307514 3:197659221-197659243 GTCGGATTTCCCAGGGAAGCTGG - Intergenic
969067385 4:4497250-4497272 GGCTGAATTCCCAGGATTACTGG + Intronic
969422489 4:7105395-7105417 GGCTGGAATCCGAGGGGATCAGG - Intergenic
969566269 4:7980238-7980260 GCCTGAATTCCGAAGGGAGGAGG - Intronic
969714988 4:8864036-8864058 AGCTGAATCCCCACTGGAGCTGG - Intronic
970145955 4:13035927-13035949 GGGTAAATTTCCAGGAGAGCTGG + Intergenic
970494239 4:16609328-16609350 TACTGAACTCCCAGGGGAGGGGG + Intronic
971344195 4:25797278-25797300 TCCTGAGTTCCCAGGGGTGCTGG - Intronic
971970407 4:33612444-33612466 GCCTGAATTCCAAAGGGAGGAGG + Intergenic
973646323 4:52954454-52954476 CTGTGAATTCCCAAGGGAGCTGG - Intronic
975484996 4:74926161-74926183 GCCTGAATTCCAAAGGGAGGAGG + Intergenic
978551160 4:109928816-109928838 GCCTGAATTCCAACGGGAGGAGG + Intronic
980740680 4:136946611-136946633 GGCTGAGGTGACAGGGGAGCTGG - Intergenic
982009545 4:151093392-151093414 ACCTGAATTCCAAGGGGAGGAGG + Intergenic
982651652 4:158094844-158094866 GGCTGCATTCCCAGGGGGTGAGG + Intergenic
984642053 4:182177433-182177455 GGCTGAAGACCAAGGGCAGCGGG - Intronic
985149673 4:186933791-186933813 GGCTGCATGCCCAGGGGCTCTGG + Intergenic
987644086 5:20647466-20647488 GGCTGAAGTCCCAGGACAGTGGG - Intergenic
988679731 5:33473183-33473205 GCCTGAATTCCAAAGGGAGGTGG - Intergenic
990340921 5:54822189-54822211 GGCTGCATTCCCAGGAGGTCAGG + Intergenic
993635047 5:90332810-90332832 AGCTGAAGACCCAGGGAAGCTGG - Intergenic
993652882 5:90543316-90543338 GTCTGAATTCCCAAGGGAGGAGG + Intronic
994042387 5:95273883-95273905 GGCTGAATGTCCAGGGAAGGGGG - Intronic
994446326 5:99879299-99879321 GGCTGAAGTCACAGGTGAGAAGG - Intergenic
995056129 5:107761084-107761106 GGAAAAATTCCCAGTGGAGCCGG - Intergenic
996998121 5:129724368-129724390 GCCTGAATTCCAAAGGGAGGAGG + Intronic
998125972 5:139622075-139622097 GCCTGAACTCCTAAGGGAGCTGG - Intronic
999666224 5:153916521-153916543 GGATGGAGTGCCAGGGGAGCGGG - Intergenic
999870152 5:155741583-155741605 GCCTGAATTCCAAAGGGAGAAGG + Intergenic
999915475 5:156254370-156254392 TGTTCAGTTCCCAGGGGAGCGGG - Intronic
1000343920 5:160298517-160298539 GACTGTAGGCCCAGGGGAGCAGG - Intronic
1001025233 5:168218643-168218665 GGCTGCATCCCCCGGAGAGCAGG + Exonic
1001077006 5:168637458-168637480 GCCTGAATTCCAAAGGGAGGAGG + Intergenic
1001339159 5:170827679-170827701 GCCTGAATCCCCAAGGGAGGAGG - Intergenic
1002744003 5:181455898-181455920 GGCAGAATTCCCATGTGGGCAGG + Intergenic
1003318781 6:5034596-5034618 GGCAGAAGGCGCAGGGGAGCCGG - Intergenic
1003406043 6:5828174-5828196 GGCTTGGTTCCCAGAGGAGCAGG + Intergenic
1004909904 6:20272926-20272948 GGCTGAATTCCCAGGAGGTTAGG - Intergenic
1005358338 6:25006890-25006912 GGCTGAAAGCCTAGAGGAGCTGG + Intronic
1005562372 6:27053940-27053962 GGTGGAATTCCCAGTGTAGCAGG - Intergenic
1006187658 6:32190042-32190064 GGGTGAACCCCCGGGGGAGCCGG - Exonic
1006502203 6:34466172-34466194 GGCCGACTTCCCGGGGGAGGAGG - Exonic
1007285174 6:40742484-40742506 GGCTGACTAGCCAGAGGAGCAGG - Intergenic
1015256766 6:131186285-131186307 GGCAGAAGGCACAGGGGAGCGGG - Intronic
1016199365 6:141388893-141388915 GCCTGAATTCCAAAGGGAGAAGG + Intergenic
1016513937 6:144872970-144872992 GGCTGCATTCCCAGGAGATTAGG - Intergenic
1016731240 6:147430633-147430655 AACTGAATTCCCAGGAAAGCTGG - Intergenic
1016949689 6:149567114-149567136 GGCTGAGTCCCCAGGGGATGCGG - Intronic
1017177207 6:151516248-151516270 GTCTGAATTCCAAAGGGAGAAGG + Intronic
1017326805 6:153150253-153150275 TGCTGAAGTCCGAGGGGAGTGGG - Intergenic
1017327205 6:153152911-153152933 TGCTGAAGTCCGAGGGGAGTGGG - Intergenic
1018642598 6:165917921-165917943 GGCTGGAATCACAGGGCAGCAGG - Intronic
1019248862 6:170729127-170729149 GGCAGAATTCCCATGTGGGCAGG + Intergenic
1019443789 7:1060550-1060572 GGCTGAATTCCCAGGAGACTGGG - Intronic
1019951344 7:4375530-4375552 GGCTGCATTCCCAGGAGGGTAGG + Intergenic
1020008476 7:4794847-4794869 GGCTGCATTCCCAGGAGGACAGG + Intergenic
1020782102 7:12530512-12530534 GCCTGAATTCCAAAGGGAGGAGG + Intergenic
1024224881 7:47318947-47318969 GGCAGAATTCCCAGAGAATCTGG + Intronic
1025115490 7:56254653-56254675 GGCAGACTGCCCAGGGGAGGTGG - Intergenic
1026247422 7:68633661-68633683 GCCTGAATTCCAAAGGGAGGAGG + Intergenic
1026562745 7:71463966-71463988 GGCTGCATTCCCAGGAGGTCAGG - Intronic
1027260551 7:76461872-76461894 GGCTGCGGTCCCAGGGGCGCGGG + Intronic
1027311928 7:76959985-76960007 GGCTGCGGTCCCAGGGGCGCGGG + Intergenic
1027620685 7:80481401-80481423 GCCTGAATTCCAAAGGGAGGAGG - Intronic
1028228268 7:88275048-88275070 GGCTGCATTCCCAGGACAGCAGG - Intergenic
1028511571 7:91630954-91630976 GGCTGAACTCTCAAGGGTGCTGG + Intergenic
1029349680 7:100004243-100004265 GGCTGCCTTCCCAGGGGCCCTGG - Intergenic
1030155967 7:106455971-106455993 GGCTGCATTCCCAGGAGATTAGG - Intergenic
1030982869 7:116207178-116207200 CTCTGAGTTCACAGGGGAGCTGG + Intergenic
1032015013 7:128373877-128373899 GGCTGAAGGCCCAGGAAAGCTGG + Intergenic
1032509332 7:132459602-132459624 GCCTGAATATCTAGGGGAGCAGG - Intronic
1034383744 7:150720804-150720826 GGCTGAAGTCCCCCAGGAGCTGG + Exonic
1034467776 7:151239878-151239900 CTCTGAAGTCCCAGGGGAGGAGG + Intronic
1035499182 8:78208-78230 GGCAGAATTCCCATGTGGGCAGG - Intronic
1036093479 8:5696141-5696163 AGCTGACTTCCCAGGGCATCAGG + Intergenic
1036221445 8:6924165-6924187 GCCTGAATTCCAATGGGAGGAGG - Intergenic
1036636659 8:10555256-10555278 GCCTGAATTCCAAAGGGAGGAGG - Intergenic
1037174750 8:15933431-15933453 GCCTGAATTCCAAAGGGAGGAGG + Intergenic
1038613724 8:29074615-29074637 GGCACCATTCCCAGGGGAGGGGG + Intronic
1039725751 8:40214469-40214491 AGCTGACTTCCCAGGGCAGCAGG - Intergenic
1039836274 8:41258794-41258816 AGCTGACTTACTAGGGGAGCAGG - Intergenic
1039861070 8:41458230-41458252 GGCTGCATTCCCAGGAGGTCAGG + Intergenic
1040734678 8:50491112-50491134 GGCTGCATCCCCAGCGGGGCAGG - Intronic
1041248977 8:55916653-55916675 GGCTCCACTCCCAGGGGAGGAGG - Intronic
1047288493 8:123508442-123508464 GGGAGACTTCCCAGGGGAGCTGG - Intronic
1047537963 8:125736679-125736701 GGCTGGAGACCCAGGAGAGCTGG - Intergenic
1048454620 8:134566649-134566671 GGCTGAGTTCCCAGAAGTGCTGG + Intronic
1048818748 8:138359761-138359783 AGCTAACTTCACAGGGGAGCTGG + Intronic
1049959848 9:727986-728008 GCCTGAATTCCAAAGGGAGGAGG - Intronic
1050182018 9:2933240-2933262 GGGTGAGTTCTCAGGGCAGCAGG - Intergenic
1050797325 9:9560676-9560698 TGCTGAAGTCCAAGGGGAGTGGG + Intronic
1051582160 9:18688727-18688749 GGCTGCATTCCCAGGAGATTAGG - Intronic
1051809263 9:21031519-21031541 GGCCGAATCCCGAGGGGAGGGGG - Intronic
1052682067 9:31706234-31706256 GGCTGGAAACCCAGGGAAGCTGG - Intergenic
1052913268 9:33903519-33903541 GCCTGAATTCCCATGGGTGGTGG - Intronic
1053678690 9:40464734-40464756 GACTGAGTTCCCAGGGGAAGGGG + Intergenic
1053928675 9:43093087-43093109 GACTGAGTTCCCAGGGGAAGGGG + Intergenic
1054285033 9:63160208-63160230 GACTGAGTTCCCAGGGGAAGGGG - Intergenic
1054291768 9:63300272-63300294 GACTGAGTTCCCAGGGGAAGGGG + Intergenic
1054389786 9:64604815-64604837 GACTGAGTTCCCAGGGGAAGGGG + Intergenic
1054505928 9:65911561-65911583 GACTGAGTTCCCAGGGGAAGGGG - Intergenic
1055866580 9:80821409-80821431 TGCTTATTTCCCTGGGGAGCAGG - Intergenic
1056095433 9:83248449-83248471 GGCTGCCTTCACTGGGGAGCTGG + Exonic
1056902089 9:90609331-90609353 GCCTGAATTCCAAGAGGAGTAGG + Intergenic
1057340750 9:94198986-94199008 GGCTGAATTGCCAGGTTACCTGG + Intergenic
1057580117 9:96280120-96280142 GCCTGAATTCCAAAGGGAGGAGG + Intronic
1058065457 9:100543962-100543984 CTTTGAATTCTCAGGGGAGCTGG + Intronic
1058581894 9:106467457-106467479 GCCTGGATTCCAAGGGGAGGGGG - Intergenic
1059950175 9:119454170-119454192 GTCTGAATTCACAGGAGATCTGG - Intergenic
1060091740 9:120748885-120748907 GGCTGATACCCCAGGGGAACAGG + Intergenic
1060168395 9:121440158-121440180 GGGAGAATTGACAGGGGAGCAGG - Intergenic
1060849351 9:126861145-126861167 GGTTGAGTTCCCTGGAGAGCCGG + Intronic
1061160415 9:128890700-128890722 TGCTGAGATCCCAGGGGAGTGGG - Intronic
1061352051 9:130073232-130073254 GGCAGAATCCTCAGTGGAGCAGG - Intronic
1061817049 9:133203798-133203820 GGCTGCATTCCCAGGGCTACAGG + Intergenic
1203609817 Un_KI270748v1:86391-86413 GGCAGAATTCCCATGTGGGCAGG + Intergenic
1185788667 X:2911783-2911805 GCCTGAATTCCAAAGGGAGGAGG - Intronic
1189176199 X:38959882-38959904 GCCTGAATTCCAAAGGGAGGAGG + Intergenic
1189309166 X:40008145-40008167 GCCTCGATTCCCAGGGGTGCGGG + Intergenic
1190280391 X:48925386-48925408 GGTTGAATTGTTAGGGGAGCGGG - Intronic
1190702020 X:52996179-52996201 GGCTGGGTTCCCAGGCCAGCAGG - Intergenic
1191612872 X:63135728-63135750 GGCTGAATTCCCAGGAGGTTAGG + Intergenic
1191623425 X:63243198-63243220 GGCTGAATTCCCAGGAGGTTAGG - Intergenic
1193022043 X:76801473-76801495 TGCTAAAGTCACAGGGGAGCTGG - Intergenic
1193164358 X:78264248-78264270 GGCTGAACTCCCAGGCGAAGAGG - Intergenic
1195436613 X:104851881-104851903 GGATTAATTCCCATGAGAGCAGG - Intronic
1196110535 X:111942079-111942101 TGGTGAATTCCCTGTGGAGCAGG - Intronic
1196161976 X:112495210-112495232 GGCTGAATTCCCAGGAGGTTAGG - Intergenic
1196343525 X:114625156-114625178 GGCAGAATACTAAGGGGAGCTGG - Intronic
1197114687 X:122818297-122818319 GACTGAGTTCCCAGGGGAAGGGG + Intergenic
1199016225 X:142819463-142819485 GGGAGAACTCCCTGGGGAGCAGG + Intergenic
1201189642 Y:11436000-11436022 GGCTGCACTCCTTGGGGAGCAGG - Intergenic
1201706870 Y:16947423-16947445 GGCTGCATTCCCTGGAGATCTGG + Intergenic
1202584002 Y:26405975-26405997 GGCTGCACTCCTCGGGGAGCAGG + Intergenic