ID: 1104037030

View in Genome Browser
Species Human (GRCh38)
Location 12:125104654-125104676
Sequence CTGCAGGCAAAGTGGTGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 340}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104037030 Original CRISPR CTGCAGGCAAAGTGGTGGCT TGG Intronic
900556769 1:3284580-3284602 CTGCAGGGAAAGGGGCGGCCAGG + Intronic
900567789 1:3342387-3342409 CTGCAGGCAGAGAGGTGACGTGG - Intronic
900972047 1:5997155-5997177 CTCCAGGCAGGATGGTGGCTGGG - Intronic
901439279 1:9267716-9267738 CTGAAGGAAAAGGGGTGGGTAGG - Exonic
901511549 1:9720372-9720394 CTGCAGGCAAAATGGCCCCTGGG - Intronic
901624719 1:10617483-10617505 CCGCAGGTACAGTGGGGGCTGGG - Intronic
902045222 1:13518930-13518952 TTGCAGTCAAGGTGTTGGCTGGG - Intergenic
902190572 1:14760125-14760147 TTTCAGGCAAAGTTGTGCCTGGG - Intronic
902615140 1:17619475-17619497 CTGCAGGGGAAGGGGTGGCTTGG + Intronic
903047314 1:20574589-20574611 CTGCAGGCACAGTGGGGCATGGG + Intergenic
903227711 1:21903247-21903269 CTGCAGGGACAGGGGTGTCTTGG - Intronic
904052171 1:27646342-27646364 CTGCAGGCAGAGGGATGGCCAGG - Intergenic
904083324 1:27885766-27885788 GTGCAGGGAAAGAGGTGGCCTGG - Intronic
904885182 1:33732352-33732374 ATGCAGTCACATTGGTGGCTAGG - Intronic
905481390 1:38264442-38264464 ATGAAGGCAAAGAGGGGGCTTGG - Intergenic
906544534 1:46611971-46611993 CTCCAGGCCAGGTGGGGGCTGGG + Intronic
907023002 1:51086987-51087009 CTACTGGGAAACTGGTGGCTTGG - Intergenic
907217819 1:52880842-52880864 CTGCAATCAAAGTGTTGGCTGGG - Intronic
907236609 1:53055057-53055079 TTGAAAACAAAGTGGTGGCTGGG + Intergenic
907384979 1:54120504-54120526 GTGCAGGCAGAGCAGTGGCTGGG + Intergenic
907490962 1:54808571-54808593 CTGCAGCCAAGGTGGGGCCTTGG + Intronic
912406755 1:109445535-109445557 TTGCAGGCAAAGTTCTGGGTAGG - Intergenic
912437151 1:109669613-109669635 CTGCAGGGAAAGGGGAGACTGGG - Intronic
914939155 1:152006880-152006902 CAGCAGGGAAAGTCGTGGCCTGG + Intergenic
915519627 1:156434366-156434388 CAGCAGTAAAAGTGGTGGCCAGG - Intergenic
915565493 1:156710549-156710571 CTGCAGGCAGGGTGGTCACTAGG + Intergenic
916127826 1:161587251-161587273 GTGGAGGCAAAGTGTGGGCTAGG - Intronic
916137743 1:161669055-161669077 GTGGAGGCAAAGTGTGGGCTAGG - Intronic
919816402 1:201443514-201443536 ATGCAGGAAAAGTGGGGGCCAGG + Intergenic
920840402 1:209549197-209549219 CAGCAGGCTAAGTGGAGGATAGG + Intergenic
921503840 1:215942042-215942064 CTGCAGTCAAGGTGTTGGCCAGG + Intronic
922497065 1:226065804-226065826 TTGCAGGTAAAATGGTGGGTGGG + Exonic
924335582 1:242983856-242983878 CTGCAGTCAAGATGTTGGCTGGG - Intergenic
1063674835 10:8131673-8131695 CCGAAGGCCAGGTGGTGGCTGGG - Intergenic
1064329368 10:14379350-14379372 CTGCGGGTAAAGTGGTGGCCAGG - Intronic
1069213474 10:65790815-65790837 CTGCAGGCAAAGAGAGAGCTTGG - Intergenic
1069943458 10:71970568-71970590 CTGCAGGGACGCTGGTGGCTGGG + Intronic
1070121075 10:73577967-73577989 CTGTGAGCAAAGTGGAGGCTTGG - Intronic
1070611080 10:77933052-77933074 CTGCAAGCACAGTGCTGTCTGGG + Intergenic
1071470832 10:85983158-85983180 CTTCAGACAAGGTGGTGGGTGGG - Intronic
1073179805 10:101576928-101576950 CTCCAGGCCAGGTGGTGACTGGG + Intronic
1073850605 10:107612978-107613000 CTGCAGGAAGAGGGGTAGCTGGG - Intergenic
1074404648 10:113170360-113170382 CTGAAATCAAAGTGGTGGCAGGG + Intergenic
1074519898 10:114209713-114209735 CTGAAGACAAAGGGGAGGCTGGG - Intronic
1076069496 10:127475566-127475588 CTGCAGTCAAGGTGTTGGCTGGG - Intergenic
1076379732 10:130016686-130016708 CTGGAGGCAACGTGGTGGACAGG + Intergenic
1077332759 11:1990584-1990606 CTGGAGGCAAAGAGGTGCCCGGG - Intergenic
1077347730 11:2071842-2071864 CAGGAGCCAAAATGGTGGCTTGG - Intergenic
1077350723 11:2091995-2092017 CTGCAGCCATGCTGGTGGCTGGG - Intergenic
1078406554 11:11074999-11075021 CTGCCCGCACAGTGGTGGTTTGG + Intergenic
1078684513 11:13516019-13516041 TTGCAGTCAAAATGTTGGCTGGG + Intergenic
1079122077 11:17693224-17693246 CTGCAGTGAAGGTGTTGGCTGGG - Intergenic
1079205673 11:18412477-18412499 CTGGGGTGAAAGTGGTGGCTGGG + Intronic
1080609710 11:33893215-33893237 CTGCAGGAAGAGTGATGGCCTGG - Intergenic
1081223459 11:40491449-40491471 TTGCAGTCAAGGTGTTGGCTAGG + Intronic
1081703843 11:45168832-45168854 CAGATGGCAAAGTGGCGGCTGGG - Intronic
1081856246 11:46305512-46305534 CTGCAGGCAAGATGGAGGCAGGG - Intronic
1082952184 11:58829289-58829311 TGGCAGGCATATTGGTGGCTTGG - Intergenic
1084083951 11:66846158-66846180 CTGCAGGGGAAGGGCTGGCTGGG + Exonic
1084208931 11:67612029-67612051 CTGCAGGCCACGTGGTGGGGAGG - Intronic
1084502734 11:69544485-69544507 AAGGAGGCAGAGTGGTGGCTGGG + Intergenic
1084651062 11:70489876-70489898 CTCCAGGCCTGGTGGTGGCTGGG + Intronic
1084657035 11:70525714-70525736 CAGGGGGCAAAGTGGTGGCTTGG - Intronic
1084954201 11:72682932-72682954 CTGCAGGTGAAGGGGAGGCTGGG - Intergenic
1085336773 11:75702491-75702513 CAGGAGGCAAAGTGGTGTGTTGG + Intergenic
1088310607 11:108456484-108456506 ATGAAGAAAAAGTGGTGGCTGGG + Intronic
1089627381 11:119760111-119760133 CTGCAGGCAACTTGGCGGCATGG + Intergenic
1090230060 11:125095941-125095963 CTGCAGCCCAAGTGGAAGCTTGG - Intergenic
1090718332 11:129450372-129450394 CTGCAGACAAGGTGGTGTATAGG + Intronic
1091309084 11:134560240-134560262 CTGCATGCAAAGTGGCAGCCAGG - Intergenic
1202815742 11_KI270721v1_random:45760-45782 CTGGAGGCAAAGAGGTGCCCGGG - Intergenic
1092575354 12:9776583-9776605 CTGCAGGTAAAGAGATGGTTTGG + Intergenic
1092611239 12:10175397-10175419 CTGCAGTCAAGGTGGCTGCTGGG - Intronic
1092796267 12:12112939-12112961 CTAAAGACAAAGTGTTGGCTGGG - Intronic
1094092448 12:26665678-26665700 CTGCAGTCAAGGTGTTTGCTGGG - Intronic
1094384269 12:29876893-29876915 CTGCAATCAATGTGTTGGCTGGG + Intergenic
1095435313 12:42180471-42180493 CTGCAGTCAGCGTTGTGGCTGGG - Intronic
1096579551 12:52575604-52575626 CTGCAGGCTTCTTGGTGGCTGGG - Intergenic
1096981049 12:55728499-55728521 CTGCGGGTAAAGAGGGGGCTGGG - Intronic
1097171067 12:57113121-57113143 CTGCAGGCAGAGTGGGCACTCGG - Intronic
1097989862 12:65823979-65824001 CTTCCTGCAAAGTGTTGGCTCGG + Intergenic
1100231649 12:92614641-92614663 TTGCAGGCAAAGCTGTGGGTTGG - Intergenic
1100295409 12:93256518-93256540 TTCCAGGCAGAGTGGTGCCTGGG + Intergenic
1101597902 12:106183484-106183506 GTGTGGGCACAGTGGTGGCTGGG + Intergenic
1102625314 12:114230781-114230803 CTGCAGTCAATGTGGCAGCTGGG + Intergenic
1102831380 12:116004276-116004298 CTGGAGGCCAAGTGCTGCCTGGG - Intronic
1103066235 12:117900034-117900056 ATACAGTCAAAGTGTTGGCTGGG - Intronic
1103409634 12:120701614-120701636 CTGCTGGCAAAGAGTTGGTTTGG - Exonic
1103947560 12:124535087-124535109 TAGCAGGCAAAGAGGTGGCCTGG - Intronic
1104037030 12:125104654-125104676 CTGCAGGCAAAGTGGTGGCTTGG + Intronic
1105787824 13:23767169-23767191 CTGCAGGCAAGTTGCTGGCAGGG - Intronic
1107260699 13:38487359-38487381 CTGCAGTCAAGGTGTTGGCCAGG + Intergenic
1108168941 13:47721599-47721621 CTGAAGGCAATGTGATGGTTAGG + Intergenic
1111954761 13:94744103-94744125 CTGAAGTCAAAGTGTTGGCAGGG - Intergenic
1113069003 13:106400549-106400571 CTGCAGGCAGAGCAGTGTCTGGG - Intergenic
1113246794 13:108405296-108405318 CTGCAACCAAGGTGTTGGCTGGG - Intergenic
1113594344 13:111520752-111520774 CTGCAGGCACAGAGGTGGACGGG - Intergenic
1114369966 14:22076007-22076029 CTACAGTCAAAGTGTTGGCAGGG + Intergenic
1115518936 14:34213455-34213477 CCGCACGCAAAGTGGTGCTTGGG - Intronic
1119154167 14:72393159-72393181 CTTCATGCATAGGGGTGGCTTGG - Intronic
1122243348 14:100383624-100383646 CTGCTGGCAGAGTGGCAGCTTGG + Intronic
1122920474 14:104877862-104877884 CTGCAGGAAAACAGGTGGCGGGG - Intronic
1122967579 14:105138505-105138527 CTGCCTGGAAAGTGGTGGCAGGG + Intergenic
1123463061 15:20492281-20492303 CTGTAGTCAAGGTGTTGGCTAGG - Intergenic
1123655000 15:22508133-22508155 CTGTAGTCAAGGTGTTGGCTAGG + Intergenic
1123875707 15:24621908-24621930 GTGCTGGCAAAGTGGTAGCAAGG + Intergenic
1123996418 15:25721007-25721029 CCCCAGGCACAGTGGTGGCGGGG + Intronic
1124273903 15:28309684-28309706 CTGTAGTCAAGGTGTTGGCTAGG - Intronic
1124308908 15:28603334-28603356 CTGTAGTCAAGGTGTTGGCTAGG + Intergenic
1124390507 15:29251441-29251463 CTGCATGCAGCGTGGTGGGTTGG - Intronic
1125011087 15:34876562-34876584 CCGTAGTCATAGTGGTGGCTTGG - Intronic
1125225495 15:37390693-37390715 CTGAAGGCAAAGGGGCAGCTAGG + Intergenic
1125315473 15:38426716-38426738 CTGCACTCTAAATGGTGGCTCGG + Intergenic
1125426840 15:39557247-39557269 GTGCATGCAAAGGGGTGGCTGGG + Intergenic
1127115377 15:55721249-55721271 CTGTAGGCAGAGTGGAGGCTGGG - Intronic
1127491844 15:59472425-59472447 CCGCAGGCAAAGTGGCTGCAAGG - Intronic
1128247068 15:66140388-66140410 CTGGAGGCAAAATGGAGGCAGGG + Intronic
1128622231 15:69160576-69160598 CTGCGGGCACGGCGGTGGCTCGG + Intronic
1129884047 15:79026398-79026420 CAGGAGGCAGAGTGGTGGCCTGG - Intronic
1130372699 15:83299537-83299559 CTGCAATCAAGGTGTTGGCTGGG + Intergenic
1132684277 16:1155788-1155810 GTGCAGGGAAGGTGTTGGCTGGG + Intronic
1133185140 16:4090567-4090589 CAGCAGGCAGAGTCCTGGCTGGG + Intronic
1133233736 16:4378325-4378347 CTGCGGCCACAGTGGTGGCCAGG + Intronic
1133678694 16:8099864-8099886 CTGAAGGCAAAGGGGTAGCAGGG - Intergenic
1133822932 16:9252947-9252969 ATCCAAGCAAAGAGGTGGCTTGG + Intergenic
1133917944 16:10125930-10125952 CTGCAGGAAAACTGGGGGCCAGG + Intronic
1134198065 16:12174343-12174365 CTGCAGTCAAAGAGGTCACTAGG - Intronic
1135432697 16:22400029-22400051 ATGGAGGCAAAGTGGGTGCTTGG - Intronic
1136401474 16:30021597-30021619 CTGCAGGAAAACGGATGGCTGGG - Intronic
1137584082 16:49653598-49653620 CTCCAGGGAAAGGGGTGGGTGGG + Intronic
1137590194 16:49688770-49688792 CAGCAGGCAGTGTGGTGGGTGGG + Intronic
1140629344 16:76832961-76832983 CTGCAGCCACTGGGGTGGCTTGG + Intergenic
1141836145 16:86540894-86540916 CTGCAGGGAAAGTCCCGGCTGGG + Intronic
1141952179 16:87346231-87346253 CTGCGGGCAAAGTGGAGTCAGGG - Intronic
1145058637 17:19718755-19718777 GTGCAGGCAGAGTGGGGGGTGGG + Intronic
1146943978 17:36861858-36861880 CTGCAGGCAGACTGGGAGCTGGG + Intergenic
1148200903 17:45749472-45749494 CAGCAGGCACCATGGTGGCTTGG + Intergenic
1148508827 17:48150626-48150648 CTGCAGACAAGGAGGTGGATGGG + Intronic
1150806238 17:68321372-68321394 CAGAAGGCAATGTGGAGGCTGGG + Intronic
1151175188 17:72282183-72282205 CTGCTGGCATAGAGGTTGCTGGG + Intergenic
1151211728 17:72549480-72549502 CTGCAGTGAAGGTGGTGGCCGGG - Intergenic
1151628796 17:75295646-75295668 CAGGTGGCAAATTGGTGGCTGGG + Intergenic
1152568750 17:81112086-81112108 CGGAAGGCAAGGTGGTGGCCAGG - Intronic
1153873014 18:9337880-9337902 TTGCAGGCAAGTTGTTGGCTGGG + Intronic
1154040272 18:10847883-10847905 GTGAAGGGAAAGTGGTAGCTTGG + Intronic
1157531505 18:48424973-48424995 CTTCAGGCAAATGGGTGCCTAGG - Intergenic
1157919157 18:51697930-51697952 CAGCTGGGAAAATGGTGGCTGGG - Intergenic
1158390364 18:57040063-57040085 CTGCAATCAAGGTGCTGGCTGGG + Intergenic
1158558366 18:58493440-58493462 CTCCAGGTACGGTGGTGGCTCGG + Intronic
1159016408 18:63104835-63104857 CTGCAGGAGAAGTGCAGGCTAGG + Intergenic
1159604107 18:70457328-70457350 CTGCAGTCAAAGTGTCAGCTTGG + Intergenic
1159727537 18:71980555-71980577 GTGCAGGCTGAGTGTTGGCTGGG - Intergenic
1159807499 18:72973971-72973993 CTGCAGGCAAAGTAATGACTGGG - Intergenic
1159968445 18:74620339-74620361 CTGCATGAAGAGTGCTGGCTGGG + Intronic
1160384187 18:78485106-78485128 CTGCAGGCAGAGTGTGGACTTGG - Intergenic
1160384206 18:78485190-78485212 CTGCAGGCAGAGTGTGGACTTGG - Intergenic
1160384254 18:78485442-78485464 CTGCAGGCAGAGTGTGGACTTGG - Intergenic
1160384263 18:78485483-78485505 CTGCAGGCAGAGTGTGGACTTGG - Intergenic
1160384289 18:78485608-78485630 CTGCAGGCAGAGTGTGGACTTGG - Intergenic
1160384485 18:78486539-78486561 CTGCAGGCGAAGTGTGGACTTGG - Intergenic
1160575319 18:79849683-79849705 CTGGAGGCAGAGCGGAGGCTGGG + Intergenic
1161092637 19:2369872-2369894 CTGCAGTCAGAGTGTTGGCTGGG + Intergenic
1161106267 19:2445434-2445456 CAGCTGCCAATGTGGTGGCTCGG + Intronic
1163840574 19:19606446-19606468 CTGCAGTCAAGGTGTTGGCTGGG - Intronic
1164907266 19:31977630-31977652 CTGCAGGAAACCTGGTGGGTGGG - Intergenic
1165073108 19:33267035-33267057 CTTCAGGCAAACTTGGGGCTCGG + Intergenic
1165742867 19:38213903-38213925 CTGCCGGCCACGTGGTTGCTGGG - Intronic
1166061870 19:40330899-40330921 CTGGAGACAATGTGGTGGCTGGG + Intronic
1166091817 19:40514262-40514284 CTGCAGGCACAGTAGGGGCAAGG - Intronic
1167084554 19:47300292-47300314 CCGCTGGCAAGCTGGTGGCTGGG + Intronic
1167495208 19:49813549-49813571 CTACAGGGAATGTGGTTGCTAGG - Intronic
1168423399 19:56219896-56219918 CTCAAGGCAATGTGGTGTCTTGG + Exonic
1168563589 19:57404038-57404060 CAGCAGGCCAAGTGATGTCTGGG + Intronic
1168588125 19:57611092-57611114 GTGCAGGGAAAGTATTGGCTTGG - Intronic
925772618 2:7298097-7298119 CTGCTGGCAAACTGGGGACTCGG + Intergenic
925849438 2:8066676-8066698 CTGCAGTGAGAGTCGTGGCTTGG - Intergenic
926087483 2:10029249-10029271 CTGCAGGGGAAGTGGTGGCTCGG + Intergenic
929501538 2:42494470-42494492 CGGCAGGAAAAGCCGTGGCTGGG - Intergenic
931645121 2:64415383-64415405 CAGCAATCAAGGTGGTGGCTGGG - Intergenic
931825031 2:65991468-65991490 GTCCAGGTAAAGTGCTGGCTCGG + Intergenic
934887869 2:98040481-98040503 CTGCAGTCAAGGTGTTGGCAGGG + Intergenic
935342812 2:102073120-102073142 CTGCATCCAAAGTGGAGCCTTGG - Intronic
935555951 2:104509656-104509678 CTGAAGGCTGAGTGGTGGGTGGG - Intergenic
936532664 2:113287679-113287701 CTGCAGGCAGGGTGGTGTGTTGG + Intergenic
937505237 2:122529306-122529328 CTGAGGGGAAAGTGGTGGCCTGG - Intergenic
937906094 2:127053553-127053575 CAGCAGGCACAGGAGTGGCTCGG + Intronic
938248306 2:129795721-129795743 CGGCAGGCCACGTGGAGGCTGGG + Intergenic
938765005 2:134455103-134455125 CTGCAGACAAACTGTTGGGTGGG - Intergenic
941378007 2:164754548-164754570 CTGCAGTCAAGGTGTAGGCTGGG - Intronic
941454380 2:165697699-165697721 CTGAAGGAAAAGTGGTCGGTGGG + Intergenic
943284848 2:185984675-185984697 CTGCAATCAAAGGGTTGGCTGGG - Intergenic
945188546 2:207164457-207164479 CTGCAGGAAAGATGGTGGGTGGG - Intronic
946411330 2:219516742-219516764 CTGCAGGCATGGTGGGGGCCAGG - Intronic
946445030 2:219731322-219731344 CTGCAGTCAAAGTGTTGGCCAGG + Intergenic
947360742 2:229343005-229343027 CAGCAGGCAAATTGATGGATAGG + Intergenic
947945679 2:234100117-234100139 CTACAGTCAAAGTGTTGGCCAGG + Intergenic
948189727 2:236048443-236048465 CTGCAGGCAAGTTGGTGGGCAGG - Intronic
1170005155 20:11660259-11660281 CTGAAGTCAAGGTGTTGGCTGGG - Intergenic
1170052154 20:12157735-12157757 CTGCAGCCAACATGGTGGTTTGG + Intergenic
1170318606 20:15069552-15069574 CTGCAAGGAAAGTGGAGCCTTGG - Intronic
1170626529 20:18034310-18034332 CTACAGGCAAGGTGGGGGCAGGG - Intronic
1170663480 20:18364716-18364738 CTGCAATCAAGGTGCTGGCTGGG + Intergenic
1172457987 20:35092707-35092729 CGGCAGCCACAGTGGCGGCTTGG - Exonic
1172835967 20:37873252-37873274 ATGAAGGCACAGTCGTGGCTTGG + Intergenic
1173280992 20:41627493-41627515 TTGCAGTCAAAATGTTGGCTGGG - Intergenic
1174063765 20:47850286-47850308 TTGCAGGCAAGCTGTTGGCTGGG + Intergenic
1175047592 20:56121919-56121941 CTGCAGTTAAGGTGTTGGCTAGG - Intergenic
1175228335 20:57458375-57458397 CTGCAGTCAAGGTGGTGGCTGGG + Intergenic
1175383623 20:58580353-58580375 CTGCAGGCTAATTGGCAGCTTGG + Intergenic
1177003253 21:15639353-15639375 CTGTAGACAGAGTGCTGGCTGGG - Intergenic
1179496721 21:41776548-41776570 CTGCACGCCAAGTGATGCCTGGG + Intergenic
1180026883 21:45169774-45169796 ATGCAGGCAAAGTGATGGCAAGG - Intronic
1181305951 22:21917380-21917402 CTGCAGGCAAAGTGGGAGTGGGG + Intergenic
1181495251 22:23283954-23283976 CTGCAGGCACAGGGAAGGCTGGG - Intronic
1181939281 22:26463065-26463087 CTGCAGGGCAAATGGTGTCTTGG - Intronic
1182053725 22:27333226-27333248 CTGCAGTCACAGTGTTGTCTGGG + Intergenic
1183135631 22:35884430-35884452 CTGCAGTCAAGGTGTTGGCTGGG + Intronic
1183647813 22:39136616-39136638 CTGCAGTCAAGGTGTTGGCTGGG - Intronic
1184243026 22:43221328-43221350 CTGCAGGCAAGGAGGTGGTGGGG + Intronic
1184301164 22:43561941-43561963 CTGCAGGAAAGGCGGGGGCTCGG + Intronic
1184854198 22:47137608-47137630 CTGCAGGGACAGTGGTGGAGAGG - Intronic
1184926319 22:47642280-47642302 CTGCTGGCACTGTGGTGGGTGGG - Intergenic
950114588 3:10442402-10442424 CTGCAGGCCACGGGGTGGCAGGG - Intronic
951092949 3:18597104-18597126 CAGCAGGCAAAGAGAGGGCTTGG + Intergenic
951532899 3:23714333-23714355 CTGCAGTGCATGTGGTGGCTTGG - Intergenic
952885795 3:38010276-38010298 CTGCGGGGAGGGTGGTGGCTAGG + Intronic
953719391 3:45342050-45342072 CTGGTGGCACACTGGTGGCTGGG + Intergenic
954743007 3:52769907-52769929 CTGCAGTGAAAGTGATGGATTGG + Intronic
954950218 3:54465858-54465880 CTGAAGGTAAGGTGCTGGCTGGG + Intronic
955081674 3:55663549-55663571 CTGCAGACGAGGTGGGGGCTGGG - Intronic
955811668 3:62797352-62797374 CTGCATGCAAAGTGCTGGGAGGG - Intronic
956675012 3:71725263-71725285 CTGCAGGCCGAGCGGCGGCTCGG + Exonic
956972523 3:74543389-74543411 CTCCAGGCAAAGTGCTAGTTTGG + Intergenic
957880487 3:86205849-86205871 CTGCAAGCAAGTTGTTGGCTGGG - Intergenic
958440466 3:94150141-94150163 CTACAGACAAAATGTTGGCTAGG - Intergenic
958822943 3:98996999-98997021 CTGGTGGCAAAGTCTTGGCTTGG + Intergenic
961025084 3:123548410-123548432 TTGCGGTCAAAGTGTTGGCTAGG - Intronic
961540468 3:127595949-127595971 CTGCAGGCAAGGTATTGGCCAGG - Intronic
962040302 3:131700348-131700370 CTCCAGGCAAAGTGGGGGATGGG + Intronic
962428575 3:135298032-135298054 CTGAAGGCAAGGTGTTGGCAGGG + Intergenic
964155630 3:153581706-153581728 CTGCAGGCAGAGTGAAGGGTAGG - Intergenic
964493255 3:157259841-157259863 CTGCAAGCAAGGCGTTGGCTGGG + Exonic
966758953 3:183398180-183398202 CTGAAGGTAAAGGGGTGGGTGGG - Intronic
967079489 3:186036271-186036293 CTGCAGTCAAGGTGTTGGCTGGG - Intergenic
967937608 3:194741464-194741486 CAGCAGGCTAAGTCGTGGCAAGG - Intergenic
968417645 4:453971-453993 CTCCAGACAAAGTGGCGGGTGGG - Intronic
968708331 4:2094442-2094464 CTGCAGTCAGGGTGTTGGCTGGG - Intronic
969204343 4:5631622-5631644 AAGCAGGGAAAATGGTGGCTTGG - Intronic
969237132 4:5873501-5873523 CTGAAGGCAAAGTGGGGGGTGGG + Intronic
969497556 4:7534779-7534801 CTGAAGGCAAGGTGTTGGCAGGG - Intronic
970004111 4:11394565-11394587 CTTCAAGCAAAGCAGTGGCTGGG - Exonic
970646259 4:18123731-18123753 CTCCAGGTAAAGAGGTGGTTTGG + Intergenic
971148685 4:24007748-24007770 CTGGAGGCAAAGGGGAGGTTGGG + Intergenic
971464268 4:26938533-26938555 CTGCAGGCTAAATGCTGGATAGG - Intronic
972269250 4:37494179-37494201 ATGCAGGTAAAGTGGTGTCATGG + Intronic
972343316 4:38171835-38171857 CTGCAGACAAAGGGATGGCAAGG + Intergenic
972461087 4:39303338-39303360 CTGCAGGGGAAGGGGTGGCAGGG - Intronic
973961859 4:56118348-56118370 CTGCATGCTAAGTGCTGGGTTGG + Intergenic
976022502 4:80646134-80646156 CTGGAGGCACTGTTGTGGCTTGG - Intronic
978192631 4:105932678-105932700 TTGAAGGCAAACTTGTGGCTTGG - Exonic
979241538 4:118451425-118451447 CTGCAGTCAAGATGTTGGCTGGG + Intergenic
979982153 4:127270410-127270432 TTGCAGTCAAAGTGTTGGCCAGG + Intergenic
980891159 4:138817292-138817314 TTGCAGTCAAAATGTTGGCTGGG - Intergenic
981265425 4:142777506-142777528 CTGCAATCAAGGTGTTGGCTGGG - Intronic
982190260 4:152847061-152847083 CTGCTGGCAAAGGGATTGCTAGG - Intronic
984019098 4:174463061-174463083 CTGCAGTCAAGGTGTTGGCTGGG + Intergenic
984051008 4:174865269-174865291 CTGAAGTCAAAGTGGTGGCAGGG - Intronic
984544805 4:181089028-181089050 CTGCAATCAAAGTGTTGGCCAGG + Intergenic
984705047 4:182841483-182841505 CTGCAGTCAAGGTGTTGGCAGGG - Intergenic
984771531 4:183440849-183440871 CTGCAGACATAGGTGTGGCTGGG - Intergenic
986818403 5:11437896-11437918 CTGCAAGCTCAGGGGTGGCTAGG + Intronic
988113714 5:26855687-26855709 GTGGAGGCAGAGTGGTGGGTGGG + Intergenic
990292201 5:54363609-54363631 CTTCAGCCAGAGTGGTAGCTTGG + Intergenic
990531009 5:56673703-56673725 CTCCAGGGATAATGGTGGCTTGG + Intergenic
991261210 5:64670362-64670384 CTGCAGGAAAAGTTGGTGCTTGG - Intergenic
991590431 5:68246258-68246280 CTGCAGGGAAGGGGATGGCTAGG - Intronic
992265360 5:75012966-75012988 CTGCACGCAGTGGGGTGGCTGGG + Intergenic
992433260 5:76730559-76730581 CTGCAGGAGAATTGGTTGCTTGG - Intronic
993264924 5:85713274-85713296 GTGAAGGCAAACTGGAGGCTAGG + Intergenic
993856537 5:93083265-93083287 CTGCAATCAAGGTGTTGGCTGGG - Intergenic
994079918 5:95697176-95697198 TTGCAGTCAAACTGTTGGCTGGG + Intronic
994083191 5:95731073-95731095 CTGCAGGCGGATTGGCGGCTGGG + Intronic
994745809 5:103676922-103676944 CTGGAGGGAGAGTGGGGGCTTGG + Intergenic
996452910 5:123647164-123647186 CTGCAATCAAAGTGTTGACTGGG + Intergenic
996758810 5:126966171-126966193 CTGGAGGCAAAGTGGGTGTTGGG + Intronic
999873309 5:155774503-155774525 CTGAAGTCAAAGTGTTGGCAGGG + Intergenic
1001980669 5:176035402-176035424 CTGGGGGCAGAGTGGTGGTTTGG - Intergenic
1002099357 5:176849755-176849777 GTGGAGGCAGAGTGGGGGCTGGG + Intronic
1002236793 5:177808663-177808685 CTGGGGGCAGAGTGGTGGTTTGG + Intergenic
1002448137 5:179302540-179302562 CTGCTGGCAAGGTGGAGGTTGGG - Intronic
1005259473 6:24042695-24042717 CTGCAGCCACTGTGGGGGCTGGG + Intergenic
1006160685 6:32039088-32039110 CTGCAGACAAGCTGGTGTCTAGG + Exonic
1006587686 6:35128147-35128169 CTGCAAGCAAAGTGTTAGCTGGG + Intronic
1006796794 6:36737260-36737282 CTGCAGCACAACTGGTGGCTGGG + Intergenic
1007608086 6:43130598-43130620 CTGCAGGCTCGGGGGTGGCTGGG - Exonic
1008735097 6:54533688-54533710 CTCCAGGCAAAGCCCTGGCTGGG + Intergenic
1008869093 6:56250597-56250619 CTGAAATCAAAGTGTTGGCTAGG - Intronic
1012327719 6:97943766-97943788 CTGCAATCAAAGTTTTGGCTAGG + Intergenic
1014535253 6:122606639-122606661 CTGAAGTCAAAGTGTTGGCAGGG - Intronic
1016271187 6:142292513-142292535 CTCCAGGCCCAGTGGTGGGTAGG + Intergenic
1017082643 6:150683913-150683935 CTGCAGCCAGGGTGGTGGCAAGG + Intronic
1017151434 6:151283977-151283999 CTGCAGGCAGATTGCTGGTTTGG + Intronic
1017377350 6:153786645-153786667 CTGAAGGGAGAGTGGTGGCCAGG + Intergenic
1017648314 6:156558876-156558898 TTAGAGGCAAAGTGGTGGCTAGG + Intergenic
1018156455 6:160989961-160989983 CTGAAGACAAAGTGGGGGCACGG + Intergenic
1018427829 6:163699446-163699468 CTGCAATCAAAGTGTTGGCAGGG + Intergenic
1019575836 7:1737236-1737258 CTGCAGGGAAAGAGGAGGCTTGG - Intronic
1020275328 7:6620928-6620950 CTGCAGGGGCAGGGGTGGCTTGG - Intronic
1022362929 7:29680159-29680181 CTGCAGTCAAAGTGTTGGCCAGG - Intergenic
1022451628 7:30521407-30521429 CTGCTGACAATGAGGTGGCTTGG - Intronic
1022698466 7:32733627-32733649 CTGCAGTCAAAGTGTTGGCCAGG + Intergenic
1023068407 7:36402835-36402857 TTGCAGGTAAAGTGGTGGTCAGG - Intronic
1023990208 7:45124245-45124267 CTGCAGGCGAGGTGAGGGCTGGG - Intergenic
1024103962 7:46062345-46062367 CTGCAGTCAAGTTGTTGGCTGGG + Intergenic
1024384234 7:48733228-48733250 CTGCAGTCAAAGTGTTGTTTGGG + Intergenic
1024971294 7:55073500-55073522 CTGCAATCAAAGTCCTGGCTAGG - Intronic
1025254522 7:57374561-57374583 CAGCAGGGAGAGTGGGGGCTTGG + Intergenic
1026980188 7:74521904-74521926 ATGCAGTCAAAATGTTGGCTGGG + Intronic
1030504017 7:110396989-110397011 CTGAAGGCAAAGTGGTTGACGGG + Intergenic
1032246862 7:130220747-130220769 CTGAATGTAAAGTGGTGGTTAGG + Intergenic
1033051071 7:138004746-138004768 CTGCAGTCAAAGTCTTGACTGGG - Intronic
1035121312 7:156570236-156570258 CTGCAGGGAAGGTGGTCACTCGG - Intergenic
1037288581 8:17326770-17326792 CTGCAGTCAAAGTGGCAGCTGGG - Intronic
1037379171 8:18265951-18265973 TTGGAAGCAAAGTGATGGCTGGG - Intergenic
1037708340 8:21334540-21334562 CTGCAATCAAGGTGTTGGCTGGG - Intergenic
1039409100 8:37337135-37337157 CTGTAGTCAAGGTGATGGCTGGG - Intergenic
1040926326 8:52687733-52687755 CTTCAGTCAAAGTGTTGGCCAGG - Intronic
1041465132 8:58150877-58150899 CTGCAGACAAGATGGCGGCTGGG + Intronic
1041653294 8:60322518-60322540 CTGTAGACAAAGTGTGGGCTTGG + Intergenic
1041952005 8:63514002-63514024 CTACAGAAAAAGTGGGGGCTTGG + Intergenic
1042976745 8:74478344-74478366 ATGCAGGCAAAGTGGCAGGTGGG + Intronic
1043814972 8:84791236-84791258 GAGCAGGCAAAGTGATGCCTGGG + Intronic
1045493488 8:102688552-102688574 CTGCAGGAGGGGTGGTGGCTCGG + Intergenic
1046645077 8:116777064-116777086 GTGTAGGCAAAGGGGTGGGTTGG + Intronic
1046707380 8:117470108-117470130 CTCCAGGTGAAGTGGTGGATGGG + Intergenic
1046848677 8:118948442-118948464 CAGCAGGCAAGTTAGTGGCTAGG + Intronic
1047188398 8:122656244-122656266 CTACAGTCAAAGTGTTGGCCAGG - Intergenic
1048981548 8:139705397-139705419 CAGCTGGCCAAGGGGTGGCTGGG + Intergenic
1049548108 8:143244032-143244054 CTTCAGGCGTGGTGGTGGCTGGG - Intergenic
1049622007 8:143602653-143602675 CTGCAGGCGCAGGGGTGGGTGGG + Exonic
1050077033 9:1876067-1876089 CTGCTGGCCAGCTGGTGGCTGGG + Intergenic
1050632720 9:7577719-7577741 CTGTAGGCAAAGTGATGGGAGGG + Intergenic
1051860581 9:21621200-21621222 CTGCATCCAAAGAGGTGTCTAGG + Intergenic
1055090809 9:72364228-72364250 CTGCAGGCGAAGGGCTGGCCGGG - Intronic
1055898574 9:81208597-81208619 CTGAAGGCAAAGCAGTGGTTAGG + Intergenic
1056898894 9:90580433-90580455 CTGCAGTCAAGGTGTTGGCCGGG + Intergenic
1058886307 9:109323739-109323761 CAGCAGGCTAGGTGCTGGCTGGG - Intergenic
1059553444 9:115253504-115253526 CTGCAATCAAAGTGTCGGCTGGG + Intronic
1060826808 9:126692344-126692366 CGGGAGGCCCAGTGGTGGCTGGG + Intronic
1062638039 9:137501662-137501684 CTGCAGGCACGGTGGTGTCAAGG - Exonic
1186036423 X:5428602-5428624 ATGCAGGCAAGCTGGTGCCTGGG + Intergenic
1186060687 X:5702985-5703007 CTCCATGCAGGGTGGTGGCTAGG - Intergenic
1186227131 X:7411698-7411720 CTGCAATCAAGGTGTTGGCTAGG + Intergenic
1186700672 X:12086822-12086844 CTGCAGCGAAGGTGGTGTCTGGG + Intergenic
1187006859 X:15240911-15240933 CTGCAATCAAGGTGTTGGCTAGG - Intronic
1189524620 X:41807162-41807184 TTACTGGAAAAGTGGTGGCTAGG - Intronic
1189716286 X:43870142-43870164 CTGGATCCAAAATGGTGGCTTGG + Intronic
1190489152 X:50963933-50963955 CAGAAGGCAAATTGGTGCCTGGG - Intergenic
1192193272 X:69010383-69010405 CTGCAATCAAGGTGTTGGCTGGG + Intergenic
1192480935 X:71485074-71485096 TTGCAGTCAAAGTGTTGGCCAGG - Intronic
1195026374 X:100881666-100881688 CAGAAGGCAAAGTGGTGGTACGG + Intergenic
1195395165 X:104402553-104402575 CTGAAGTCAAAGTTGTGGTTAGG + Intergenic
1195515351 X:105768276-105768298 CTGTAGGCAAACTGGTAGATAGG + Intergenic
1195981873 X:110587455-110587477 CTGCTGGCAAAGTGGTGTGAGGG - Intergenic
1196030047 X:111086841-111086863 CTGCAGTCAAACTGCTGGCTGGG + Intronic
1197704974 X:129628389-129628411 CTGCAGTCAAGGTGTTGGCCAGG + Intergenic
1197764575 X:130051465-130051487 CTGCAGGCAGTGAGGTGGCTTGG + Intronic
1197942113 X:131801428-131801450 CTGAAGGCACTGTGGAGGCTGGG + Intergenic
1199601296 X:149542838-149542860 CTGAAATCAAAGTGGTGGCCAGG + Intronic
1199649081 X:149936646-149936668 CTGAAATCAAAGTGGTGGCCAGG - Intronic
1201536668 Y:15056326-15056348 CTCCATGCAGGGTGGTGGCTAGG + Intergenic