ID: 1104038383

View in Genome Browser
Species Human (GRCh38)
Location 12:125114183-125114205
Sequence CCGTGGTGCCCTTGATGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 104}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104038379_1104038383 -5 Left 1104038379 12:125114165-125114187 CCTGAAGCTGGTGGGCCTCCGTG 0: 1
1: 1
2: 0
3: 12
4: 117
Right 1104038383 12:125114183-125114205 CCGTGGTGCCCTTGATGTCCTGG 0: 1
1: 0
2: 0
3: 13
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104038383 Original CRISPR CCGTGGTGCCCTTGATGTCC TGG Intronic
900175791 1:1290830-1290852 CCGTGGTACCCAGGATGGCCGGG + Intronic
900964471 1:5948212-5948234 CGGTGGTGCCCTGGAGATCCTGG - Exonic
903954740 1:27017536-27017558 CCCTGTTGCCCTGGCTGTCCAGG - Intergenic
905775744 1:40665984-40666006 CCGTGGTGCCTGTGAGGTCCTGG - Intergenic
909751375 1:79165642-79165664 GCTTGGTGGCCTTGATGTCCAGG + Intergenic
912818601 1:112849640-112849662 CCGCGGTGCCCTAGTTGCCCGGG - Intergenic
913317855 1:117567523-117567545 CCGTGGTGTCCTGGACCTCCAGG + Intergenic
916541116 1:165755469-165755491 CTGTGTTGCCCTTGAACTCCTGG - Intronic
919839342 1:201597798-201597820 CTGCTGTGCCCGTGATGTCCTGG + Intergenic
921718668 1:218446656-218446678 CCATGATGCGCTTGAAGTCCTGG - Intergenic
1064051354 10:12062410-12062432 CCGGGGTGCTCTTGAACTCCTGG + Intergenic
1064706024 10:18073472-18073494 CCTTGCTGCCCTTCTTGTCCCGG - Intergenic
1065877296 10:30008339-30008361 CCGTGCTGCCTTTGAGGTTCTGG + Intergenic
1067266581 10:44750764-44750786 TCGTGGTGCCAGAGATGTCCAGG + Intergenic
1070238607 10:74655781-74655803 CCTTGATGGGCTTGATGTCCTGG - Intronic
1072201427 10:93162824-93162846 CTGAGGTTCCCTTGATGTCTTGG + Intergenic
1076379844 10:130017440-130017462 CCGTGGTGCCCATTCTGTGCCGG + Intergenic
1076425311 10:130363305-130363327 TGGTGGTGGCCTTGATCTCCCGG + Intergenic
1076785899 10:132749824-132749846 CCGCGGTGCCGTTGTTGTCTCGG - Exonic
1080037092 11:27721411-27721433 CCATTGTGCCTTTGCTGTCCTGG + Intronic
1081750598 11:45508156-45508178 CTGTGTTGACCTTGATTTCCCGG - Intergenic
1081774237 11:45666396-45666418 CCCTGGTGCCCATGAAGGCCAGG - Intergenic
1085777080 11:79376712-79376734 CAGTGGTGCCATTCTTGTCCTGG - Intronic
1089560172 11:119339821-119339843 CCGGGGTCCCCTCGAGGTCCCGG + Exonic
1103625331 12:122214624-122214646 CTGTGTTGCCCTTGAACTCCTGG + Intronic
1104038383 12:125114183-125114205 CCGTGGTGCCCTTGATGTCCTGG + Intronic
1104042039 12:125136843-125136865 CCGGGATGCCCTTGGTTTCCAGG - Exonic
1104429474 12:128705140-128705162 CCTTGGTGTCGTAGATGTCCAGG - Exonic
1104440962 12:128792594-128792616 GCGTTGTGCCCTTGATGCCCCGG - Intergenic
1113883873 13:113647198-113647220 CCAGGCTGGCCTTGATGTCCTGG - Intergenic
1118831860 14:69440872-69440894 CCATGTTGGCCTTGATCTCCTGG + Intronic
1122325270 14:100877922-100877944 ACATGGTGCCCTTGAGCTCCTGG + Intergenic
1122611087 14:102983978-102984000 CCGTGTTGGCCTTGAGCTCCTGG - Intronic
1122724285 14:103740150-103740172 CCAAGGTGCCCATGAAGTCCTGG + Exonic
1123215723 14:106807584-106807606 CTGTGCTGCCCATGAAGTCCAGG + Intergenic
1126412728 15:48388631-48388653 CTCTGGGCCCCTTGATGTCCCGG + Intergenic
1130322533 15:82853060-82853082 CCTCGGTGCCCTTCATGTCAAGG - Intronic
1130960584 15:88656283-88656305 CTGGGGTGCCCTAGATGTGCAGG - Exonic
1131265627 15:90913577-90913599 CCCGGGTGCCCTTGATCTGCTGG + Intronic
1132506283 16:310904-310926 CCGTGGGGCACTGGTTGTCCTGG - Intronic
1132751896 16:1461478-1461500 GAGTGCTGCCCTTGCTGTCCCGG - Intronic
1133210008 16:4258222-4258244 CCTGGGTGCCCTCGATGTGCTGG + Exonic
1134676695 16:16095549-16095571 TCGTGGTGCTTTGGATGTCCTGG - Intronic
1140473957 16:75229372-75229394 TCCTGGTGCCCTGGATGCCCAGG - Exonic
1141837895 16:86554885-86554907 CCGTGGGCCCCTTGAGGTCGGGG - Intronic
1146829549 17:36056607-36056629 CCGGGCTGGTCTTGATGTCCTGG + Intergenic
1148255707 17:46129974-46129996 CCGGGCTGGTCTTGATGTCCTGG - Intronic
1151163319 17:72184008-72184030 ACCTGGTGCCCTAAATGTCCTGG + Intergenic
1151523495 17:74647853-74647875 CGGTGGTGTCCTTTATCTCCAGG - Intergenic
1151953087 17:77366012-77366034 CCCTGGGGCCCTTGGTGTCCTGG - Intronic
1152463306 17:80452379-80452401 CCGTGGGGCCACAGATGTCCTGG + Intergenic
1160542080 18:79629340-79629362 CCGAGGTGCCCTTGAAATGCCGG - Intergenic
1160578033 18:79868020-79868042 CCGTCGTCCCCATGAGGTCCAGG + Intronic
1161852216 19:6743562-6743584 CCTTGGTGGCGTTGATATCCTGG - Exonic
1162659877 19:12160606-12160628 CCGTGTTGCTCTTGTTGCCCAGG + Intergenic
1163509311 19:17725831-17725853 GCGTGGTGGCCAGGATGTCCCGG - Exonic
1166835860 19:45667601-45667623 CAGTGGTGACCCAGATGTCCTGG + Intergenic
927442862 2:23131648-23131670 CGGTTGTGCCCTTGTTGTCTGGG - Intergenic
930719549 2:54626069-54626091 CTGTGATGCGCTTGATGTCGTGG - Exonic
933555509 2:83825758-83825780 GAGTGGTGTCCTTTATGTCCTGG + Intergenic
933744646 2:85561650-85561672 CCTTAGTGCCGTTGATCTCCAGG + Intronic
947149438 2:227099661-227099683 CCTGGGTGCCCTCGATTTCCAGG + Exonic
948648619 2:239424866-239424888 CGGGGGAGCCCTTGGTGTCCAGG - Intergenic
1169146953 20:3259004-3259026 CTCTGGAGCCCTTGCTGTCCTGG - Intronic
1169475561 20:5928300-5928322 CCATGGAGCCCTTGTCGTCCTGG + Intergenic
1174177363 20:48653402-48653424 CGATGGTGCCCCTGAGGTCCTGG - Exonic
1175177393 20:57120450-57120472 CCCTGGTGGCATTGCTGTCCTGG + Intergenic
1175305988 20:57975862-57975884 CCTTGGTGCTCTGGATGGCCTGG - Intergenic
1175943367 20:62547938-62547960 CTGTGGTGGCCTTGCTGTCGGGG + Intergenic
1175945952 20:62558848-62558870 CCGTGTGGCGCTTGTTGTCCTGG + Intronic
1176040949 20:63065505-63065527 CCGTGGTGCCCCTGGGGTCAGGG + Intergenic
1178718957 21:34991411-34991433 CAGTGGGGCCCTTGATGACATGG + Intronic
1183684593 22:39354435-39354457 CCTTGGTGCCATGGATATCCAGG - Intronic
951704482 3:25529965-25529987 CTGTGTTGCCCTTCATGTCCTGG + Intronic
952981273 3:38738139-38738161 CCATGTTGCCCTTGAACTCCTGG + Intronic
955842450 3:63126686-63126708 CTGTAGTGCCCTTTATGACCTGG + Intergenic
959188897 3:103084375-103084397 CCTTGGTGCTCTTGCTGTCTAGG + Intergenic
960494453 3:118358362-118358384 CCTTGGTGCCATTGCTGTCCTGG - Intergenic
961454682 3:127018104-127018126 CAGTGGTGCCCTGGCTGGCCAGG + Intronic
967943037 3:194780863-194780885 CCGAGGTGTCCTTGTTCTCCAGG + Intergenic
968539447 4:1156351-1156373 CAGTGGAGGCCATGATGTCCAGG + Intergenic
969148485 4:5145059-5145081 CTGTGATGCCCTTGCTGTCAAGG + Intronic
969484978 4:7467162-7467184 AAGTGGTCCCCTGGATGTCCAGG + Intronic
969573474 4:8023529-8023551 CCGTGGCGGCCTTGCTGACCGGG + Intronic
972911588 4:43823286-43823308 CTGGGCTGCTCTTGATGTCCTGG - Intergenic
976796556 4:88940249-88940271 CAGTGGTGTCCTTAAGGTCCAGG - Intronic
977607061 4:98994594-98994616 CCTTGGTGCCCTGGATGCCCTGG + Intergenic
979485539 4:121265916-121265938 CCATGGTGCTTTTGGTGTCCCGG - Intergenic
984465996 4:180101001-180101023 CCGTTCTGCCCTTGCTGTCCTGG - Intergenic
988454292 5:31373497-31373519 CTGTGATGCACTTCATGTCCTGG - Intergenic
991296758 5:65089824-65089846 TAGTCTTGCCCTTGATGTCCAGG - Intergenic
992931250 5:81648564-81648586 CTGTTGTGCTCTTGATGTGCTGG + Intronic
996446399 5:123557499-123557521 CTGTGGTGCTCTTGATTTCATGG - Exonic
997103834 5:130995995-130996017 CGGTGGTGCCCTTGTTGACCGGG - Intergenic
997234837 5:132266777-132266799 CCAAGGTGCCTATGATGTCCAGG + Intronic
1002373440 5:178772428-178772450 CCGCGATGCCCTTGGTTTCCAGG + Intergenic
1002377376 5:178797876-178797898 CCATGGTGCCCTCGATGGCCAGG - Intergenic
1002523475 5:179803753-179803775 CCGTGGGGCCCTTTATCTCCTGG - Intronic
1006115296 6:31773062-31773084 CCATGCTGCCCGTGGTGTCCAGG + Exonic
1011691276 6:89871652-89871674 CCAGGGTGGCCTTGATCTCCTGG - Intronic
1015440383 6:133241090-133241112 CCTCGGGGCCCTGGATGTCCCGG - Intronic
1017300548 6:152852624-152852646 CTGTGTTGCTCTTGCTGTCCAGG + Intergenic
1020006480 7:4786133-4786155 CCTCGGAGCCCTTGGTGTCCTGG + Intronic
1022086753 7:27075886-27075908 CCAGGGTGGCCTTGATCTCCTGG - Intergenic
1022257082 7:28669662-28669684 CCCTGTTGCCCTTGATGTGATGG - Intronic
1024247133 7:47479225-47479247 CTCTGGTGCCTCTGATGTCCAGG + Intronic
1026858472 7:73770016-73770038 GCGCGGTGCCCGTGATCTCCAGG + Exonic
1036688213 8:10925462-10925484 CCTGGGTCCCCCTGATGTCCAGG - Intronic
1041956214 8:63559968-63559990 CCATGGTGCCCATAATGCCCAGG + Intergenic
1050163505 9:2741546-2741568 CTGTGGTGCCCTTGACTTCCAGG - Intronic
1053298651 9:36933461-36933483 CCGTGGTGCCCCGGGAGTCCTGG + Intronic
1057726729 9:97573239-97573261 CCCTGGTGCCCTGGGGGTCCTGG - Intronic
1057822406 9:98342637-98342659 CCATGGTGCCCTGGATGGCCAGG - Intronic
1058217317 9:102250969-102250991 CCGTAGTGGGATTGATGTCCAGG + Intergenic
1062368334 9:136222830-136222852 CCCTCGTGCCCTTGCTGTCTCGG - Intronic
1062434250 9:136539675-136539697 CCCTGGCGCCCTTGAAGACCAGG + Intronic
1200091068 X:153636272-153636294 CCTTGGGGCCCTTGAGGTTCTGG + Intergenic
1200885359 Y:8262390-8262412 CCATGGTGCCACTGCTGTCCAGG + Intergenic