ID: 1104039552

View in Genome Browser
Species Human (GRCh38)
Location 12:125121000-125121022
Sequence GCACATGTACGCGTGTACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 62}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104039552_1104039557 21 Left 1104039552 12:125121000-125121022 CCTGTGTACACGCGTACATGTGC 0: 1
1: 0
2: 1
3: 5
4: 62
Right 1104039557 12:125121044-125121066 TGGTTCCGTGCCGTAATCACGGG 0: 1
1: 0
2: 0
3: 3
4: 32
1104039552_1104039556 20 Left 1104039552 12:125121000-125121022 CCTGTGTACACGCGTACATGTGC 0: 1
1: 0
2: 1
3: 5
4: 62
Right 1104039556 12:125121043-125121065 CTGGTTCCGTGCCGTAATCACGG 0: 1
1: 0
2: 2
3: 1
4: 31
1104039552_1104039554 -3 Left 1104039552 12:125121000-125121022 CCTGTGTACACGCGTACATGTGC 0: 1
1: 0
2: 1
3: 5
4: 62
Right 1104039554 12:125121020-125121042 TGCAAGTGTTCACAGCATGGTGG 0: 1
1: 0
2: 0
3: 9
4: 161
1104039552_1104039555 1 Left 1104039552 12:125121000-125121022 CCTGTGTACACGCGTACATGTGC 0: 1
1: 0
2: 1
3: 5
4: 62
Right 1104039555 12:125121024-125121046 AGTGTTCACAGCATGGTGGCTGG 0: 1
1: 0
2: 9
3: 37
4: 355
1104039552_1104039553 -6 Left 1104039552 12:125121000-125121022 CCTGTGTACACGCGTACATGTGC 0: 1
1: 0
2: 1
3: 5
4: 62
Right 1104039553 12:125121017-125121039 ATGTGCAAGTGTTCACAGCATGG 0: 1
1: 0
2: 1
3: 21
4: 170
1104039552_1104039560 28 Left 1104039552 12:125121000-125121022 CCTGTGTACACGCGTACATGTGC 0: 1
1: 0
2: 1
3: 5
4: 62
Right 1104039560 12:125121051-125121073 GTGCCGTAATCACGGGCCCTGGG 0: 1
1: 0
2: 0
3: 1
4: 26
1104039552_1104039559 27 Left 1104039552 12:125121000-125121022 CCTGTGTACACGCGTACATGTGC 0: 1
1: 0
2: 1
3: 5
4: 62
Right 1104039559 12:125121050-125121072 CGTGCCGTAATCACGGGCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 17

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104039552 Original CRISPR GCACATGTACGCGTGTACAC AGG (reversed) Intronic
912963781 1:114219150-114219172 GCACATGCACACATATACACAGG - Intergenic
918766569 1:188492959-188492981 GCAGATGTACAGGTGTACAATGG + Intergenic
919610660 1:199741776-199741798 GCACGTGTACGCATGCGCACGGG + Intergenic
920972541 1:210754988-210755010 GCACATGTACAAGTGCAAACAGG + Intronic
1064934808 10:20667953-20667975 GCACAAGTGTGCGTGTGCACTGG + Intergenic
1065968194 10:30785363-30785385 GCACTTGTGCGCGGGGACACGGG + Intergenic
1070258655 10:74832147-74832169 GCACATGTACCCATATACACTGG - Intronic
1080327719 11:31096938-31096960 GCGCATGCATGTGTGTACACGGG - Intronic
1080747900 11:35125633-35125655 TCACGTGTATGTGTGTACACTGG + Intergenic
1084937200 11:72593266-72593288 GCACATTCATGCCTGTACACAGG + Intronic
1091635220 12:2191852-2191874 ACACATGTACTCGCATACACAGG + Intronic
1097512817 12:60565119-60565141 GCAGCTGTACTCGTGTACATTGG + Intergenic
1104039552 12:125121000-125121022 GCACATGTACGCGTGTACACAGG - Intronic
1104383684 12:128329955-128329977 ACACATGTACACATGGACACAGG - Intronic
1124998726 15:34749388-34749410 GTGCATGTATGTGTGTACACTGG - Intergenic
1128939219 15:71773787-71773809 ACACATGTACCCATGTACTCAGG - Intronic
1129243082 15:74263155-74263177 GCACATGCATGTGTGTACATGGG - Intronic
1129931174 15:79412271-79412293 GCACATGCACACATGCACACTGG - Intronic
1141808588 16:86358409-86358431 ACACATCTACGCGCTTACACAGG - Intergenic
1142268357 16:89076436-89076458 GCATGTGTACTCGTGTACATAGG + Intergenic
1142744074 17:1946434-1946456 GCATGTGTACGTGTGTGCACAGG + Intronic
1148475412 17:47925430-47925452 GCCCATGTGCGCCTGCACACTGG + Exonic
1150571614 17:66391822-66391844 GCACATGTGTGTGTGCACACAGG - Intronic
1152922089 17:83071016-83071038 GCACACGCACACGTGCACACAGG + Intergenic
1153349981 18:4068831-4068853 TCACCTGTACGCGTGGACATCGG - Intronic
1155346334 18:24861017-24861039 ACACACGTACGCATGCACACAGG + Intergenic
1158858382 18:61567340-61567362 GCACATGTACCCGTGAACTTAGG - Intergenic
1159284793 18:66335948-66335970 GCACATCTACGAGTCTACAAGGG - Intergenic
1161120723 19:2524721-2524743 GCACATACACACGTGCACACTGG - Intronic
1163412933 19:17168092-17168114 GCACATCTACGCATGGGCACTGG + Intronic
1163418829 19:17202972-17202994 GCACACATACGCGTGCAGACGGG - Intronic
1167650487 19:50725909-50725931 GCGTTTGTACGCGTGTACTCCGG - Intergenic
925886549 2:8398032-8398054 GCACATGTATGCGTGTAGGTAGG - Intergenic
929882666 2:45850765-45850787 GCACATGTACACCCCTACACTGG - Intronic
935569842 2:104647638-104647660 ACACATGTGCGTGTGTGCACTGG - Intergenic
936573450 2:113634941-113634963 GCACATGTGTGAGTGTACATGGG - Intronic
1169299991 20:4433621-4433643 GGACATGGATGCGTGTGCACCGG - Intergenic
1174451171 20:50621441-50621463 GCACATGCACACATGCACACGGG + Intronic
1175530054 20:59668392-59668414 GGACATGTACACCTGTACATAGG + Intronic
1175987017 20:62769081-62769103 GCACACGTGCACGTATACACAGG + Intergenic
1180102539 21:45595678-45595700 GCACATGCACACATGCACACAGG - Intergenic
1184868940 22:47221016-47221038 GCATATGTACACGTGTGCACAGG - Intergenic
1185132864 22:49049973-49049995 GCACATCTGTGCATGTACACTGG + Intergenic
1185426732 22:50775939-50775961 GCACATGTGTGAGTGTACATGGG + Intronic
955533217 3:59896119-59896141 GCTCATTTACGCTTGTACACTGG + Intronic
962279292 3:134038179-134038201 GCACATGCACGCACATACACAGG + Intronic
964515061 3:157498859-157498881 GTATATGTACACGTGCACACAGG - Intronic
985869322 5:2541373-2541395 GCACACGCATGCGTGCACACAGG - Intergenic
985869325 5:2541424-2541446 GCACATGCATGCGTGCACACAGG - Intergenic
985869338 5:2541795-2541817 GCACATGCAAGCATGCACACAGG - Intergenic
995815697 5:116165632-116165654 GCACACACACGCGTGTGCACAGG + Intronic
997078669 5:130712227-130712249 GAACATGTATGTGTGTACACAGG - Intergenic
999165302 5:149544629-149544651 GCACAGGTCCACTTGTACACAGG + Intronic
1004081706 6:12401073-12401095 GCACATGTAAACTTGTAGACTGG - Intergenic
1005527963 6:26670162-26670184 GTACATGTATGTGTGCACACAGG - Intergenic
1005542835 6:26831513-26831535 GTACATGTATGTGTGCACACAGG + Intergenic
1009486074 6:64223855-64223877 GTACATGTATGCATGCACACTGG - Intronic
1016857148 6:148682709-148682731 GCACATGTACACGTGCACACGGG - Intergenic
1022910128 7:34892881-34892903 GCACATGTATACATATACACAGG - Intergenic
1026962701 7:74418801-74418823 ACACATATACACATGTACACAGG + Intergenic
1039973048 8:42336445-42336467 GCACATGTGCGCCTGAGCACTGG - Intergenic
1044319098 8:90782243-90782265 GCACATGTATGTGTGTGCATAGG + Intronic
1049339036 8:142102035-142102057 GCACAGGTGCGTGGGTACACAGG + Intergenic
1058530538 9:105901386-105901408 GTACATGTACCTGTGTACCCAGG + Intergenic
1185451835 X:285597-285619 ACATATGCACACGTGTACACAGG + Intronic
1193882091 X:86936101-86936123 GTCCATGTGCACGTGTACACTGG + Intergenic
1198092094 X:133341665-133341687 GTGCATGTACCCATGTACACTGG - Intronic
1200135885 X:153874471-153874493 GCACATGGACACATGCACACAGG - Intronic
1202134183 Y:21644559-21644581 GCACATGCACACATGTGCACTGG + Intergenic