ID: 1104040125

View in Genome Browser
Species Human (GRCh38)
Location 12:125124387-125124409
Sequence ATTGTATCTTGGGGGACCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 70}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104040125_1104040134 7 Left 1104040125 12:125124387-125124409 CCTTTGGTCCCCCAAGATACAAT 0: 1
1: 0
2: 1
3: 8
4: 70
Right 1104040134 12:125124417-125124439 AGTTGGGAAGATAATGGGTTCGG 0: 1
1: 0
2: 0
3: 19
4: 244
1104040125_1104040132 1 Left 1104040125 12:125124387-125124409 CCTTTGGTCCCCCAAGATACAAT 0: 1
1: 0
2: 1
3: 8
4: 70
Right 1104040132 12:125124411-125124433 CTCTGCAGTTGGGAAGATAATGG 0: 1
1: 0
2: 0
3: 25
4: 273
1104040125_1104040131 -9 Left 1104040125 12:125124387-125124409 CCTTTGGTCCCCCAAGATACAAT 0: 1
1: 0
2: 1
3: 8
4: 70
Right 1104040131 12:125124401-125124423 AGATACAATACTCTGCAGTTGGG 0: 1
1: 0
2: 0
3: 13
4: 138
1104040125_1104040130 -10 Left 1104040125 12:125124387-125124409 CCTTTGGTCCCCCAAGATACAAT 0: 1
1: 0
2: 1
3: 8
4: 70
Right 1104040130 12:125124400-125124422 AAGATACAATACTCTGCAGTTGG 0: 1
1: 0
2: 0
3: 7
4: 131
1104040125_1104040133 2 Left 1104040125 12:125124387-125124409 CCTTTGGTCCCCCAAGATACAAT 0: 1
1: 0
2: 1
3: 8
4: 70
Right 1104040133 12:125124412-125124434 TCTGCAGTTGGGAAGATAATGGG 0: 1
1: 0
2: 2
3: 15
4: 198
1104040125_1104040135 8 Left 1104040125 12:125124387-125124409 CCTTTGGTCCCCCAAGATACAAT 0: 1
1: 0
2: 1
3: 8
4: 70
Right 1104040135 12:125124418-125124440 GTTGGGAAGATAATGGGTTCGGG 0: 1
1: 0
2: 0
3: 22
4: 330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104040125 Original CRISPR ATTGTATCTTGGGGGACCAA AGG (reversed) Intronic
900537292 1:3185177-3185199 ATTGTAGCCTGAGGCACCAAGGG - Intronic
901541851 1:9923189-9923211 ATTGTATTTGGGTTGACCAAGGG - Intronic
904076717 1:27848413-27848435 ATTGTATGTTGAAGAACCAAGGG + Intronic
907983880 1:59511358-59511380 ATTCTATCTTGGGGCTCAAAGGG + Intronic
917099715 1:171432753-171432775 TTTGTATCTGTAGGGACCAAGGG - Intergenic
1065253714 10:23843555-23843577 AGTGGATCTGGAGGGACCAATGG - Intronic
1069543275 10:69311615-69311637 ATTGTATCCTGGAGGAGGAAGGG - Intronic
1073477340 10:103762932-103762954 ATTGGCTCTTGGGGGACAGATGG - Intronic
1083220060 11:61246434-61246456 ATGGTATCTTTGGGGGCCAAGGG - Intronic
1086286898 11:85261559-85261581 ATTGGATCTTGCGGGAGGAAGGG + Intronic
1092656389 12:10689319-10689341 ATTGGATCTTGGGGTAGCAGAGG - Intergenic
1092949692 12:13490059-13490081 ATTTAATTTTGGGGTACCAAAGG - Intergenic
1093938041 12:25022085-25022107 ATTTTATCTAGGAGGACCCACGG - Intronic
1096028113 12:48385994-48386016 ATTTTTTCTTGGGGCACCAATGG - Intergenic
1098705591 12:73685055-73685077 ATTGGTTCTTTGGGGCCCAACGG - Intergenic
1099568617 12:84284570-84284592 AGTGTATATTTGGGGAGCAAGGG + Intergenic
1101302255 12:103495087-103495109 ATTGAATCTTGGAAGACCAGAGG - Intronic
1104040125 12:125124387-125124409 ATTGTATCTTGGGGGACCAAAGG - Intronic
1108793261 13:53998691-53998713 AATCTATCTTGTGGAACCAAAGG + Intergenic
1113428179 13:110227647-110227669 ATTGTATATTTGGGAATCAAGGG - Intronic
1120050246 14:79857594-79857616 ATAGTGTCCTGGGGGATCAAAGG - Intronic
1131113057 15:89777104-89777126 ACTGTATCTTGGGGCAGTAAGGG - Exonic
1133439128 16:5805916-5805938 AGTGGATCTGGGGGGACAAATGG + Intergenic
1134649691 16:15898725-15898747 AATGTATCTTGGGGGGTGAAAGG + Intergenic
1135298002 16:21300247-21300269 AGTGTATGTTGGAGGACAAAAGG - Intronic
1135375653 16:21944744-21944766 AGTGTATGTTGGAGGACAAAAGG - Intergenic
1141887553 16:86902980-86903002 ATTGTATTTTGAAGGACCAGAGG - Intergenic
1149133645 17:53339515-53339537 TTTGTATTTTGGGGGGCCAGTGG - Intergenic
1154297555 18:13163425-13163447 ATTGCCTCATGGAGGACCAAAGG - Intergenic
1156399985 18:36731507-36731529 ATTATAGCTTGGGGGCCCACTGG + Intronic
1157716054 18:49888167-49888189 ATTCTTTCTTGGGGGAGTAAGGG + Intronic
1163211843 19:15846610-15846632 CTTGTGTCTTGGGGGAAGAAAGG + Intergenic
926983249 2:18593917-18593939 TTTGTTTCTTGGGGGAAAAAAGG - Intergenic
930790179 2:55317343-55317365 ATTGTAACTGGGGGGAAAAAAGG + Exonic
938174102 2:129108282-129108304 ATTTTATCTTGCTGGACCAGTGG - Intergenic
939142792 2:138376143-138376165 ATTCTATTTTGGGGAAACAATGG - Intergenic
939639260 2:144619324-144619346 GTTGTATCTTGGGAGTTCAATGG + Intergenic
947752110 2:232538608-232538630 ACTGCATCTAGGGGGACCAGAGG + Intergenic
1174580887 20:51570754-51570776 ATTCTGTCTTGGGGGACCCTGGG - Intergenic
1174877086 20:54238585-54238607 ATTGTATCTTTGGAGATCAAAGG + Intergenic
1177018270 21:15817996-15818018 AGTGTAGCTTGGGGAACCAAGGG - Intronic
1179239178 21:39573847-39573869 ATTGTATCTTGGAGGCTCAGAGG + Intronic
1183816735 22:40308118-40308140 AGGGTATCTTGGGGGAGGAAAGG - Intronic
949344491 3:3064244-3064266 ATTCTATCCTGGGGGATCAATGG - Intergenic
953481141 3:43253559-43253581 AGTGCATCTTGGGTGACCCATGG + Intergenic
958521455 3:95193238-95193260 ATTTTAATTTGGGGCACCAAAGG - Intergenic
958712204 3:97731033-97731055 ATTGTATCGTGGGGGATGATTGG + Intronic
960311351 3:116120205-116120227 AAGGTATCTTGATGGACCAAAGG + Intronic
961961181 3:130856958-130856980 ATTGTAACTTTGGGCACAAATGG + Intronic
971076239 4:23152656-23152678 ACTGTATCATGGAGAACCAACGG - Intergenic
971737767 4:30478788-30478810 ATTGTATGTTGGGGGAGAGAAGG + Intergenic
972316938 4:37935538-37935560 ACTGTATCTTGGGTTACCAGAGG - Intronic
974245323 4:59307831-59307853 ATTGTCTCTTGGGGAATCAAAGG - Intergenic
975841032 4:78474410-78474432 ATTGGAACTTGGGGGAAAAAAGG + Intronic
976965670 4:91037188-91037210 ATTGTGTGTTGGGGGACAGAAGG - Intronic
979349491 4:119628180-119628202 ATTGGATTTTGGGGAACCAGAGG + Intronic
981070891 4:140536945-140536967 GTTGTAGCTTGGGGAACTAATGG + Intronic
984101161 4:175488148-175488170 TTTGTATTTTGGGGGATCAGCGG - Intergenic
986620346 5:9666449-9666471 ATTATATCTGGGAGGAACAAGGG + Intronic
987515825 5:18906553-18906575 GTAGTATGTTGGGGGCCCAAAGG + Intergenic
990938240 5:61173358-61173380 ATTGTATCCTGGGGGAATGACGG + Intergenic
1001702846 5:173720237-173720259 ATTTTATCTTGTGTGATCAAGGG + Intergenic
1002375672 5:178787424-178787446 GTTTTATCTTGGGGGACCAAAGG + Intergenic
1003684695 6:8290378-8290400 ACTGTATCTTGGGGGAAAAGGGG - Intergenic
1004389344 6:15197052-15197074 ATTATACTTTGGGGGACCCAGGG + Intergenic
1005020589 6:21414566-21414588 ATTGTATGTTGGGGGAAAAAAGG - Intergenic
1010406980 6:75516782-75516804 ATGGTAACTTGGTGGACCAAGGG + Intergenic
1014574766 6:123056633-123056655 ATTGTATCCTGAGAAACCAAAGG + Intronic
1033495916 7:141895796-141895818 ATTGTATGTAGGGGGTCTAAAGG - Intergenic
1037824988 8:22155659-22155681 ATTGCCTCTTGGGGCACCCATGG + Intronic
1039139729 8:34373073-34373095 ATTAGATCTCAGGGGACCAACGG - Intergenic
1044428791 8:92084669-92084691 ATTCTATCTTTGGGGAGGAAGGG + Intronic
1045210829 8:100097883-100097905 ATTGGAGATTGGGGGAACAATGG - Intronic
1048825044 8:138416140-138416162 ATTTTGTCCTGGGGGATCAAGGG - Intronic
1050333869 9:4571997-4572019 ATTTTAACTTCGGGGAGCAAGGG + Intronic
1050966602 9:11811659-11811681 AGTGTTTCTTGGGGGAACACAGG + Intergenic
1058324380 9:103677436-103677458 ATTCCTTCTTGGGGCACCAAGGG + Intergenic
1188156664 X:26749424-26749446 AGAGTATCTTGGGGGATCATGGG - Intergenic
1195327321 X:103768437-103768459 AATGTGTCTTAGGGGAACAAGGG - Intergenic
1199666630 X:150101278-150101300 GTAGTACCTTGGGGGAGCAAGGG + Intergenic