ID: 1104040133

View in Genome Browser
Species Human (GRCh38)
Location 12:125124412-125124434
Sequence TCTGCAGTTGGGAAGATAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 198}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104040124_1104040133 5 Left 1104040124 12:125124384-125124406 CCTCCTTTGGTCCCCCAAGATAC 0: 1
1: 1
2: 1
3: 13
4: 235
Right 1104040133 12:125124412-125124434 TCTGCAGTTGGGAAGATAATGGG 0: 1
1: 0
2: 2
3: 15
4: 198
1104040126_1104040133 -6 Left 1104040126 12:125124395-125124417 CCCCCAAGATACAATACTCTGCA 0: 1
1: 0
2: 0
3: 13
4: 163
Right 1104040133 12:125124412-125124434 TCTGCAGTTGGGAAGATAATGGG 0: 1
1: 0
2: 2
3: 15
4: 198
1104040129_1104040133 -9 Left 1104040129 12:125124398-125124420 CCAAGATACAATACTCTGCAGTT 0: 1
1: 0
2: 0
3: 17
4: 143
Right 1104040133 12:125124412-125124434 TCTGCAGTTGGGAAGATAATGGG 0: 1
1: 0
2: 2
3: 15
4: 198
1104040127_1104040133 -7 Left 1104040127 12:125124396-125124418 CCCCAAGATACAATACTCTGCAG 0: 1
1: 0
2: 1
3: 16
4: 155
Right 1104040133 12:125124412-125124434 TCTGCAGTTGGGAAGATAATGGG 0: 1
1: 0
2: 2
3: 15
4: 198
1104040128_1104040133 -8 Left 1104040128 12:125124397-125124419 CCCAAGATACAATACTCTGCAGT 0: 1
1: 0
2: 0
3: 13
4: 173
Right 1104040133 12:125124412-125124434 TCTGCAGTTGGGAAGATAATGGG 0: 1
1: 0
2: 2
3: 15
4: 198
1104040125_1104040133 2 Left 1104040125 12:125124387-125124409 CCTTTGGTCCCCCAAGATACAAT 0: 1
1: 0
2: 1
3: 8
4: 70
Right 1104040133 12:125124412-125124434 TCTGCAGTTGGGAAGATAATGGG 0: 1
1: 0
2: 2
3: 15
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104040133 Original CRISPR TCTGCAGTTGGGAAGATAAT GGG Intronic
902090868 1:13902140-13902162 TCTGGATTTGGTGAGATAATGGG + Intergenic
903504268 1:23821951-23821973 TCTGCAATAGCGAAAATAATGGG - Intronic
905788160 1:40774411-40774433 TCTACAGTTGGGATGACAGTGGG - Intergenic
906465730 1:46077158-46077180 TCTGCATTAAGGAAGATAATAGG + Intronic
906642055 1:47447093-47447115 TCTGCAGTAGGGAAGGAAATTGG - Intergenic
906682872 1:47742581-47742603 ATTGCAGTGGGGAAGAGAATGGG + Intergenic
906927321 1:50132295-50132317 GCTGCAGTTGGGAAAATAAATGG + Intronic
906928308 1:50142659-50142681 TCTGCTGGTGGGAATATAAATGG + Intronic
911002939 1:93185501-93185523 TATGCAGTTGAGAAGAAAAAAGG + Intronic
911039346 1:93579566-93579588 TCTTCAGTTGGGAACATCCTTGG + Intronic
911326792 1:96477875-96477897 TCTTCAGTTGGAAAGTTAAGTGG + Intergenic
914261034 1:145999380-145999402 TCTGCAAATGGGAAGATACAAGG - Intergenic
914323097 1:146584293-146584315 ACTGCAGCTGGGAAGAGACTTGG + Intergenic
915838221 1:159195055-159195077 ACTGAAGTTAGGAAAATAATTGG - Intronic
915859468 1:159428996-159429018 TCTGAAGGTTGGAAGAGAATTGG - Intergenic
918229912 1:182518746-182518768 TGAGCAGATGGTAAGATAATTGG - Intronic
918676170 1:187288836-187288858 TCTGCAATTGGGAATAAAAGTGG - Intergenic
920995248 1:210984164-210984186 TTTTCAGCTGGGAAGACAATGGG + Intronic
921082207 1:211750384-211750406 TCTGCAGAAAGAAAGATAATTGG - Intronic
921296909 1:213712668-213712690 TCTGCAGTTGTGAAGACTGTGGG + Intergenic
924079680 1:240381728-240381750 TCTGCAGCTGTTAAGATGATTGG - Intronic
1069850227 10:71399303-71399325 TCTGCATTTGGTAAGATCCTTGG + Intronic
1069920404 10:71812458-71812480 TCTGCAGTTGGGGAGGGAAAAGG - Exonic
1073104584 10:101025183-101025205 TCTGCTGTTGGAAATAGAATGGG + Intronic
1074751875 10:116594708-116594730 TCTGGTGTTGGGGAGATAGTGGG - Exonic
1076138665 10:128062857-128062879 TCCTCAGTGGGCAAGATAATTGG - Intronic
1078353313 11:10613719-10613741 TGTGAAGGTGGGAAGATATTCGG + Intronic
1078357882 11:10646435-10646457 TCTGGGGTTGGGTAGATAATTGG - Intronic
1078590217 11:12634410-12634432 TCTGGAAGTGGGAAGATATTTGG - Intergenic
1078859481 11:15234077-15234099 TTTGCAGTTAAGAAAATAATAGG - Intronic
1079319189 11:19437292-19437314 TGTACATTTGGGAAGATAGTGGG - Intronic
1080790254 11:35516147-35516169 TCTGCAGATTGGAAGGTGATAGG + Intronic
1081687246 11:45051668-45051690 TCTGCAGATGGGAGAAGAATTGG - Intergenic
1082701105 11:56432125-56432147 TCAACAGTTGGGCAGATCATTGG + Intergenic
1083324106 11:61864911-61864933 TATGGAGCTGGGAAGATATTGGG - Intronic
1083355273 11:62061621-62061643 TCTGCATTTGGAAAGAGAAGAGG + Intergenic
1086412207 11:86554009-86554031 TTTGCAATTGAGATGATAATAGG + Intronic
1086971566 11:93086388-93086410 TCTGGAGCTGGGCAGAGAATGGG - Intergenic
1088059372 11:105627691-105627713 TTTGCAGTTCGGAAGATACATGG - Intronic
1088689374 11:112312021-112312043 TATGGAGCTGGGAAGAAAATTGG - Intergenic
1088944615 11:114496538-114496560 TCTGCAGTGGGGAGGATCACAGG + Intergenic
1089126772 11:116181692-116181714 TCTGCAGAGGGGAAGATGCTAGG + Intergenic
1095505246 12:42890197-42890219 TCTGCATTTGAAGAGATAATTGG - Intergenic
1096110779 12:49027915-49027937 TCTGCAGGTGGGAAGGAAAAGGG - Exonic
1098945668 12:76586832-76586854 ACTGAATTTGTGAAGATAATTGG - Intergenic
1099193390 12:79584165-79584187 TCTGCAGGTGAAAGGATAATTGG + Intronic
1099266829 12:80457617-80457639 TCTGCAGTTTGGAAGAGAAATGG - Exonic
1100356223 12:93833258-93833280 TTTGCAGATGGGAAGATAGATGG + Intronic
1100434670 12:94560785-94560807 TCTGCAGAAGGGAAGCTATTCGG + Intergenic
1100755311 12:97744920-97744942 ACTGTTGGTGGGAAGATAATCGG + Intergenic
1101055189 12:100905178-100905200 TCTGGAGTTTGAAAGATGATTGG + Intronic
1102762385 12:115399365-115399387 TCTGCAGTTTGGTAAACAATAGG + Intergenic
1104040133 12:125124412-125124434 TCTGCAGTTGGGAAGATAATGGG + Intronic
1104060928 12:125267604-125267626 ACTGCAGTTGGGATGATAAGAGG + Intronic
1105441845 13:20421674-20421696 TTTGAAGTTGGGAAGTTAACAGG - Intronic
1106825856 13:33519571-33519593 TTTGCAGTGGGGAAGAGATTGGG - Intergenic
1107416761 13:40208369-40208391 CCTGCAGCTGGGAAGAAAAAGGG - Intergenic
1108326193 13:49333996-49334018 CCTCCGGTTGGGAAGAGAATTGG + Intronic
1109399183 13:61802763-61802785 TTTGCAATTGGTCAGATAATTGG + Intergenic
1109580231 13:64321685-64321707 TCTGAAGTTATGAATATAATAGG + Intergenic
1109887892 13:68566161-68566183 TCTACAGCTGGGAAAATCATGGG + Intergenic
1117777670 14:59199158-59199180 TGTGCAGTTGAGAAGAGACTGGG - Intronic
1118000428 14:61518046-61518068 TCTGCACTGGGGAAGAGACTTGG + Intronic
1118286579 14:64479815-64479837 TCTGCAGTTGGGAGGCTGAGAGG - Exonic
1119891613 14:78186758-78186780 GCTGCAGTAGGGGAGATAAAAGG + Intergenic
1121451446 14:94010854-94010876 TCTGCACTGGGGAAGATTAATGG - Intergenic
1123689077 15:22822315-22822337 TCAGCAGTTGTGACGAGAATGGG + Intronic
1124996254 15:34725917-34725939 TCTGCAGTTGGTCAGACAACTGG - Intergenic
1127001800 15:54517396-54517418 TCTGCAGGTGGGCAGAAATTGGG + Intronic
1128186224 15:65645408-65645430 TCTGCAGATGAGAAGACAGTTGG - Intronic
1128666550 15:69542421-69542443 TCTGCAGGTGGGAGTATAAAAGG - Intergenic
1129297520 15:74608143-74608165 TGGGCAGTGGGGAAGACAATGGG + Intronic
1130054860 15:80513764-80513786 TCTGCACTTTTGAAGAAAATTGG + Intronic
1130955591 15:88625003-88625025 TCAGCTGTTGGGAAGATGCTGGG + Intronic
1131931447 15:97447075-97447097 TCAGCATTTGAGAAGATCATAGG + Intergenic
1134335554 16:13296283-13296305 TCTGAAGGTGGGAAAATAAGTGG + Intergenic
1134421715 16:14098186-14098208 ACTGCAGTTGGGAATATAAAAGG - Intronic
1136685985 16:31995205-31995227 TCTGCAGTGGGGAAAATGAAGGG + Intergenic
1136786598 16:32938738-32938760 TCTGCAGTGGGGAAAATGAGGGG + Intergenic
1140010462 16:71126557-71126579 ACTGCAGCTGGGAAGAGACTTGG - Intronic
1140304512 16:73790570-73790592 TCTGGAGTTGGGACAATAAAAGG - Intergenic
1140674488 16:77314168-77314190 TCTCCAGTTAGGAAGATGATGGG + Intronic
1141231661 16:82172749-82172771 TCTGCACTTGGGAAACTAAGGGG + Intergenic
1141638581 16:85328667-85328689 TCTGCAGTGGGGCAGGGAATTGG + Intergenic
1203088832 16_KI270728v1_random:1200404-1200426 TCTGCAGTGGGGAAAATGAAGGG + Intergenic
1144910424 17:18677147-18677169 TCTGCTGCTGGGAATGTAATTGG + Intronic
1146217038 17:30985441-30985463 TCTGTACTTGGAAAGATAATGGG - Intronic
1147146946 17:38490870-38490892 TCTGCAGTGGGGAAAATGAGGGG + Intronic
1149485393 17:57038646-57038668 TAAGCAGTGGGGAAGACAATAGG + Intergenic
1152009821 17:77705779-77705801 TCTCCAGTTAGGTAGATTATTGG + Intergenic
1155684713 18:28534530-28534552 TCTGCAGTTCTGAAGAGAAGTGG + Intergenic
1157118116 18:44881545-44881567 TCTGCAATTGGCAAAGTAATTGG - Intronic
1158563784 18:58537018-58537040 ACTGCACTTGGGAAGGAAATTGG + Exonic
1159530126 18:69645273-69645295 TCAGCAGTTGGGAAGATTGGAGG - Intronic
1160895310 19:1399632-1399654 TCTGCAGGTGGGGAGATCCTGGG - Intronic
1162430064 19:10623082-10623104 TGTGTAGTTGGGAAGAGAAGAGG + Intronic
1162491958 19:10997967-10997989 TCTGCTGCTGTGAAGATAACTGG - Intronic
1164545539 19:29158881-29158903 TCTCCAGTTGGGAAGAAATGTGG - Intergenic
925786402 2:7435332-7435354 TCTGCAGTGGGGGAGGGAATGGG + Intergenic
927327230 2:21819038-21819060 TCTGAATTTGGGAAGACAAAAGG + Intergenic
928244780 2:29617729-29617751 ACTGCAGTAGGGGAGATAGTAGG - Intronic
929279461 2:40062096-40062118 GCAGCAGTAGGGAAGGTAATGGG - Intergenic
931061012 2:58530052-58530074 TCTGCAGTTTTGAAGAAAACTGG + Intergenic
932889985 2:75585917-75585939 ACTGCTGGTGGGAAGGTAATTGG + Intergenic
935260660 2:101353043-101353065 TCTGTAGTTAGGTAGAAAATAGG + Intronic
937635949 2:124155397-124155419 TCTGCAGTTGGAAATATACAGGG + Intronic
939913141 2:148006990-148007012 GATGGACTTGGGAAGATAATTGG - Intronic
939941940 2:148361973-148361995 TCTGCAGTTGCAAAGACCATGGG - Intronic
941644431 2:168024921-168024943 TGTGCACTGGTGAAGATAATGGG - Intronic
941870163 2:170375861-170375883 TCTTCTGTTAGGAAGATAAAAGG - Intronic
942287209 2:174431589-174431611 TCTGCAATTGGTATGATAAAAGG - Intronic
942448904 2:176097297-176097319 TCTGCAATTTGGAATATAAAGGG - Intergenic
944391233 2:199221932-199221954 CCTGCGGTGGGGAAGATACTAGG - Intergenic
944910470 2:204305786-204305808 TATGCATTTGGGAGGATAAACGG - Intergenic
945585773 2:211660617-211660639 TCAGCAGTTGGAAAGATGAGTGG + Intronic
947952690 2:234161678-234161700 TCTGCATTTGGCAAGAAACTGGG - Intergenic
1169475256 20:5925125-5925147 TCTGCCCTTGGGTAGATAAATGG - Exonic
1169606439 20:7325000-7325022 TCTGCAGAAGACAAGATAATTGG + Intergenic
1172758402 20:37304655-37304677 TCTGTAGCTGGGAGGATGATGGG + Intronic
1173696153 20:45015281-45015303 ACTGCAGATGGAAAGAAAATAGG - Intronic
1177301694 21:19254145-19254167 TCTGCCTTTGTGAAGATAAAAGG + Intergenic
1177555614 21:22684048-22684070 TCTGAAGTTGGGGAGGTAAGGGG - Intergenic
1177821213 21:26032850-26032872 TCAGCAGTTGGGAACTTACTAGG - Intronic
1180735130 22:18010854-18010876 TTTTCATTTGGGAAGAGAATGGG + Intronic
1180800361 22:18628940-18628962 TCTGCAGTGGGTAAGAGACTGGG + Intergenic
1180800385 22:18629069-18629091 TCTGCAGTGGGTAAGAGACTGGG + Intergenic
1180851597 22:19024496-19024518 TCTGCAGTGGGTAAGAGACTGGG + Intergenic
1180851621 22:19024625-19024647 TCTGCAGTGGGTAAGAGACTGGG + Intergenic
1181221332 22:21366193-21366215 TCTGCAGTGGGTAAGAGACTGGG - Intergenic
1181221356 22:21366322-21366344 TCTGCAGTGGGTAAGAGACTGGG - Intergenic
1184984973 22:48125268-48125290 ACTGCTGGTGGGAATATAATTGG + Intergenic
1185101697 22:48844119-48844141 CCTGCTTTTGGGGAGATAATTGG - Intronic
949661545 3:6284349-6284371 TCTGCATTTGGGGAGATAATAGG - Intergenic
952412259 3:33060008-33060030 TCTGAACTTGGGAAGGGAATGGG + Intronic
956413725 3:69005190-69005212 TCTGCAGTACTGAAGATAACGGG + Exonic
957805189 3:85138924-85138946 TCTGCATTTAGGAAGATAAAGGG + Intronic
960944886 3:122958958-122958980 GCTGCAATGGGGAAGATAAAAGG + Intronic
962457895 3:135582081-135582103 TCTGCTTTTAGGAAGATAAGGGG + Intergenic
962567042 3:136671416-136671438 TCTGTATTTGTGAAGATGATAGG - Intronic
962851771 3:139313466-139313488 TGTGCAGATGGGAATATACTAGG + Intronic
963796878 3:149639643-149639665 TGAGAAGTGGGGAAGATAATGGG - Intronic
965057764 3:163744230-163744252 TCTCGAGTCTGGAAGATAATTGG + Intergenic
965612039 3:170554656-170554678 TCTGCCGTGGGGCAGAGAATAGG - Intronic
965870935 3:173264599-173264621 TTTGGAGTGGGGAAGAGAATAGG + Intergenic
966064023 3:175795112-175795134 CCTGCAGGTGGGATGATATTAGG - Intronic
967778406 3:193408552-193408574 TCTGCTGCTGGGAGGATAAATGG + Intronic
968875423 4:3264645-3264667 TGGGGAGTTGGGGAGATAATGGG - Intronic
968971394 4:3797477-3797499 TCTGCATTTGAGAAAATACTGGG + Intergenic
969894357 4:10289442-10289464 TCATCAGTTGGGAAGATAATGGG + Intergenic
972084727 4:35201366-35201388 TCTCCAATTAGAAAGATAATAGG - Intergenic
972235318 4:37125858-37125880 CCTGGAGTTGAGAAGATAAAGGG + Intergenic
973840548 4:54856122-54856144 GCAGCACTTGGGCAGATAATGGG + Intergenic
976895116 4:90100019-90100041 TCTGCATTTGGGTAGACAAATGG - Intergenic
980748582 4:137057264-137057286 TGGGCAGTTGGGAAGAACATTGG - Intergenic
983098989 4:163601105-163601127 TCTGCAGTTGGGATTTAAATAGG - Intronic
984138376 4:175970903-175970925 TCTTCAGTTGGGAAAAAAAAGGG - Intronic
984368420 4:178828841-178828863 TCTGCAGTTGTGAGGAGATTTGG + Intergenic
987150761 5:15037136-15037158 TGTGCAGTTGGGAATTTATTTGG - Intergenic
987394056 5:17404327-17404349 TCTGCAGTTGAGAAGTTCAAGGG + Intergenic
991714388 5:69437795-69437817 TCTGCAGTTGGGAAATCAAGAGG + Intronic
995120543 5:108531682-108531704 TCTGCAGCTGCAAAGATAAGAGG + Intergenic
995398758 5:111717366-111717388 TCTGCAGTTGTGAAGACTGTGGG + Intronic
995471177 5:112503578-112503600 TCTGCAGTTGAGAAGACTGTGGG - Intergenic
998681244 5:144470038-144470060 TCTCCATTTGGGGAGAAAATAGG - Intronic
999954485 5:156685670-156685692 AGTACAGTTGGGGAGATAATGGG + Intronic
1000185605 5:158854943-158854965 TCTGTAGATGGGAATATAGTAGG - Intronic
1000607356 5:163339034-163339056 TCTGGAGTTGTGAACCTAATGGG - Intergenic
1000756994 5:165173863-165173885 TCAGCAGTTGGCAAGAAAAATGG - Intergenic
1004346689 6:14855671-14855693 TATGGGTTTGGGAAGATAATGGG + Intergenic
1005231504 6:23707047-23707069 TTTGCAGTTTGGAAGATAGCAGG - Intergenic
1005470978 6:26162174-26162196 TCTGCATGTAGGAGGATAATTGG + Intronic
1006434243 6:34017982-34018004 GCTGGAGTTGGGAAGATATTTGG + Intergenic
1007032974 6:38645642-38645664 TCAGCATATAGGAAGATAATGGG - Intergenic
1012290020 6:97442822-97442844 TGTGCTGTTGGGCAAATAATTGG - Intergenic
1013926969 6:115484832-115484854 TCTGAATTTGGGAAATTAATCGG - Intergenic
1014177085 6:118342698-118342720 TCTGCAGTTGTGGAGATCATGGG + Intergenic
1020988078 7:15161241-15161263 TCTGCATTATGGAAGGTAATTGG - Intergenic
1023145501 7:37146862-37146884 TGGGTGGTTGGGAAGATAATTGG - Intronic
1030999924 7:116403146-116403168 TCTGCATTTGGGATGATGTTGGG - Intronic
1031127140 7:117787866-117787888 TCTAGAGTTGGAAAGATCATGGG + Intronic
1032392153 7:131562289-131562311 TCTGCAGTGGAGAAGAGAAGAGG + Intergenic
1032590121 7:133184117-133184139 CCTGCATTTGTGCAGATAATTGG + Intergenic
1034373790 7:150626378-150626400 CCGACATTTGGGAAGATAATAGG - Exonic
1037483765 8:19328587-19328609 TCAGCATTTGGGGAGAGAATGGG - Intronic
1037521584 8:19685200-19685222 TTCCCAGTTGGCAAGATAATGGG + Intronic
1039177071 8:34820870-34820892 TGTGCAGTTGGGAAGAGCGTGGG + Intergenic
1041974901 8:63786973-63786995 TATGCATTTGGGAATAAAATAGG + Intergenic
1044468826 8:92541126-92541148 TCTGAAGTTTGGAAAAAAATAGG - Intergenic
1045254510 8:100508416-100508438 TTTGCATTTAGGAAGATAAGGGG - Intergenic
1046889391 8:119404822-119404844 TCTGGAGGGAGGAAGATAATGGG - Intergenic
1051464355 9:17360302-17360324 TTTGCAGTTGGGGAGAAAATTGG + Intronic
1051751573 9:20348064-20348086 TCTGGAGTTGAGCAGTTAATTGG - Intronic
1052965199 9:34335291-34335313 CCAGCAGTTGGGAAGAAAACTGG - Intronic
1053329073 9:37187611-37187633 TCGGGAGATGGGAAGATAAATGG + Intronic
1056676543 9:88681127-88681149 TATGGAGTTGGGAAGAGGATCGG + Intergenic
1056871791 9:90288549-90288571 TTTGCAGTAGGGGAGAAAATAGG + Intergenic
1058153027 9:101482648-101482670 AATGCAGCTGGGAAGATAGTTGG - Intronic
1058829428 9:108802135-108802157 ACTGCAGTTGTAAAGCTAATGGG + Intergenic
1059123030 9:111659659-111659681 ACTGAAGTTGAGAAGATAAATGG - Intronic
1185745788 X:2572413-2572435 GCTGCTATTGGTAAGATAATGGG + Intergenic
1186584831 X:10861917-10861939 TCAGCAACTGAGAAGATAATTGG + Intergenic
1186940414 X:14500717-14500739 TGAGCAGATGGGAAGAGAATTGG - Intergenic
1188696159 X:33193505-33193527 CCTGCAATTGGAAAGATACTTGG + Intronic
1188782055 X:34297371-34297393 TCTTCAGTTGGGAATAGAAAAGG - Intergenic
1189910405 X:45805280-45805302 AGTGCAGTTGGGAAGGTAATTGG - Intergenic
1193636939 X:83962786-83962808 TCTGCAGTGGGGATGCTAGTTGG - Intergenic
1196581539 X:117384960-117384982 ACTGCAGTTGTGAAGATTATAGG - Intergenic
1196983658 X:121243509-121243531 CCTGCACTTGGGAGGACAATTGG + Intergenic
1197416014 X:126173849-126173871 GCTGAATTTTGGAAGATAATTGG - Intergenic
1197482292 X:127002327-127002349 TTAGAAGTGGGGAAGATAATAGG + Intergenic
1197646294 X:129021269-129021291 TCCACAGTTGGCAAGAAAATGGG + Intergenic
1197841874 X:130756770-130756792 GCTGCAGGTGGGAAGCTATTGGG + Intronic
1198438652 X:136640666-136640688 TCTGCAGGTGGGCACATAGTTGG - Intergenic
1202263080 Y:22990103-22990125 TCTGGAGGTGGGATAATAATGGG + Intronic
1202416070 Y:24623844-24623866 TCTGGAGGTGGGATAATAATGGG + Intronic
1202454717 Y:25046242-25046264 TCTGGAGGTGGGATAATAATGGG - Intronic