ID: 1104040134

View in Genome Browser
Species Human (GRCh38)
Location 12:125124417-125124439
Sequence AGTTGGGAAGATAATGGGTT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 244}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104040127_1104040134 -2 Left 1104040127 12:125124396-125124418 CCCCAAGATACAATACTCTGCAG 0: 1
1: 0
2: 1
3: 16
4: 155
Right 1104040134 12:125124417-125124439 AGTTGGGAAGATAATGGGTTCGG 0: 1
1: 0
2: 0
3: 19
4: 244
1104040129_1104040134 -4 Left 1104040129 12:125124398-125124420 CCAAGATACAATACTCTGCAGTT 0: 1
1: 0
2: 0
3: 17
4: 143
Right 1104040134 12:125124417-125124439 AGTTGGGAAGATAATGGGTTCGG 0: 1
1: 0
2: 0
3: 19
4: 244
1104040128_1104040134 -3 Left 1104040128 12:125124397-125124419 CCCAAGATACAATACTCTGCAGT 0: 1
1: 0
2: 0
3: 13
4: 173
Right 1104040134 12:125124417-125124439 AGTTGGGAAGATAATGGGTTCGG 0: 1
1: 0
2: 0
3: 19
4: 244
1104040126_1104040134 -1 Left 1104040126 12:125124395-125124417 CCCCCAAGATACAATACTCTGCA 0: 1
1: 0
2: 0
3: 13
4: 163
Right 1104040134 12:125124417-125124439 AGTTGGGAAGATAATGGGTTCGG 0: 1
1: 0
2: 0
3: 19
4: 244
1104040125_1104040134 7 Left 1104040125 12:125124387-125124409 CCTTTGGTCCCCCAAGATACAAT 0: 1
1: 0
2: 1
3: 8
4: 70
Right 1104040134 12:125124417-125124439 AGTTGGGAAGATAATGGGTTCGG 0: 1
1: 0
2: 0
3: 19
4: 244
1104040124_1104040134 10 Left 1104040124 12:125124384-125124406 CCTCCTTTGGTCCCCCAAGATAC 0: 1
1: 1
2: 1
3: 13
4: 235
Right 1104040134 12:125124417-125124439 AGTTGGGAAGATAATGGGTTCGG 0: 1
1: 0
2: 0
3: 19
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104040134 Original CRISPR AGTTGGGAAGATAATGGGTT CGG Intronic
906408611 1:45561757-45561779 AGATGGGAAGAGAATGGTGTTGG - Intronic
908428088 1:64028329-64028351 AATTGGGCACATAATAGGTTTGG + Intronic
908824859 1:68123583-68123605 AGTGGGCAAGATGATGAGTTTGG - Intronic
909717035 1:78721546-78721568 AATGGGAATGATAATGGGTTGGG + Intergenic
913004068 1:114611022-114611044 TGTTGTGATGATCATGGGTTAGG - Intronic
913361513 1:117985900-117985922 AGTTGTCAAGACCATGGGTTTGG - Intronic
914897123 1:151686217-151686239 AGATGGAAAGATAGTGTGTTTGG - Intronic
915617458 1:157050353-157050375 AGTTGGGAAGATGATGTGAGAGG + Intergenic
915716412 1:157949124-157949146 AGCTGGGAAGAAAAGGGGGTGGG - Intergenic
917272707 1:173296194-173296216 AGTTAGGAAGAGAATGTGCTTGG + Intergenic
918728972 1:187965241-187965263 AATTGGGGAGAAAATGCGTTAGG - Intergenic
919868674 1:201803709-201803731 AGTTGGGTAGGTAAAGGTTTGGG + Exonic
920428641 1:205899586-205899608 AGTTGTGAAGACAATGGGAAAGG - Intergenic
921384948 1:214559180-214559202 AGTGAGGAAGAGAATGTGTTAGG - Intergenic
921527007 1:216229844-216229866 AGATGGGTAGATAATGGGAGAGG + Intronic
922513643 1:226189960-226189982 TGTTGGGATGATAATGAGTAGGG + Intergenic
923357457 1:233173582-233173604 TGTTGGGAATATAATGCCTTTGG + Intronic
1064156208 10:12905431-12905453 AGGTGGGAATAGGATGGGTTTGG + Intronic
1065411582 10:25435317-25435339 GGTTGGAGAGATAATGGGTTGGG + Intronic
1065914620 10:30343543-30343565 AGATAGTAAGATAGTGGGTTTGG - Intronic
1067108379 10:43381052-43381074 AGTAGGGAGGGAAATGGGTTTGG - Intergenic
1067764995 10:49078655-49078677 TGGTGAGAAGAAAATGGGTTTGG + Intronic
1068937312 10:62648583-62648605 AGTTGGGAAAAGAATGAGGTTGG + Intronic
1072262259 10:93690220-93690242 TGGGGGGAAGATAATGAGTTTGG - Intronic
1072743944 10:97927035-97927057 AGTCGGGGAGAAAATGGGTGTGG + Intronic
1073140968 10:101247429-101247451 AGGTGAGAAGATAAGGGATTGGG + Intergenic
1073480339 10:103782700-103782722 AGTTAAGAAGACAATGGGCTGGG + Intronic
1074751873 10:116594703-116594725 TGTTGGGGAGATAGTGGGGTTGG - Intronic
1075392124 10:122099819-122099841 AGATGGGAAGCTTATGTGTTAGG + Intronic
1079122983 11:17698368-17698390 TGTTGGTAGGATAATGGGGTGGG + Intergenic
1079378597 11:19916940-19916962 AGATGAGAAGACAATGGGTTAGG + Intronic
1080289414 11:30654137-30654159 AGATTGGGAGATAATGAGTTTGG + Intergenic
1081515865 11:43828504-43828526 AATGGGGAAGAAAATGGGTCTGG + Intronic
1082992402 11:59219083-59219105 AGTTGGTAAGATGAGGGCTTAGG - Intergenic
1084798880 11:71527974-71527996 ACTTGGGAAGAGAATTTGTTAGG - Exonic
1085733155 11:79016445-79016467 CTTTGGAAAGATAATGGATTTGG + Intronic
1086486827 11:87313681-87313703 AGTTGGCAATATAATGGCTTGGG + Intronic
1086971565 11:93086383-93086405 AGCTGGGCAGAGAATGGGTCAGG - Intergenic
1087709112 11:101529701-101529723 AGTTGGCAGGATAATGGAATAGG + Intronic
1087985417 11:104672410-104672432 AGCTGGGGAGCTAATAGGTTTGG - Intergenic
1091493843 12:955411-955433 TGTTAGCAAGATAATGGGTTGGG - Intronic
1091707914 12:2712183-2712205 AGGTGGGAGAGTAATGGGTTAGG + Intergenic
1093549498 12:20390637-20390659 AGGAGGGAAGATGATGTGTTTGG + Intronic
1095715810 12:45344865-45344887 AGTTGGGAATATGGTGGGTCAGG + Intronic
1096694105 12:53338047-53338069 AGATGGGGAGACAATGGCTTGGG + Intronic
1097289649 12:57903853-57903875 AGTCTGGAAGATGATGGGGTCGG - Intergenic
1098092447 12:66918516-66918538 ATTTGGGAATATCATTGGTTGGG - Intergenic
1098194966 12:67989980-67990002 AGTTGGGAAGAAAATGCCATGGG + Intergenic
1098339772 12:69439932-69439954 AATGGAGAAGATAATGGCTTTGG + Intergenic
1098476081 12:70905174-70905196 ATTAGGGATGTTAATGGGTTTGG + Intronic
1098936544 12:76486092-76486114 AGTAGAGAAGAAAATGGGTGTGG - Intronic
1101094477 12:101322557-101322579 AATTGGAAAGATCATGGGATTGG + Intronic
1101581546 12:106046605-106046627 AGCTGGGAGGATAATGGGGCAGG + Intergenic
1101813192 12:108125487-108125509 AGCTGGGAAGAAAGTGGTTTGGG - Intergenic
1102448582 12:113023316-113023338 AGTTTGGAAGATGAAGGGTAGGG - Intergenic
1103016669 12:117500034-117500056 AGATGGGAAGATAAGGAGATGGG + Intronic
1103025131 12:117567580-117567602 AGTAGGGAAGATAATGAGAGGGG - Intronic
1104040134 12:125124417-125124439 AGTTGGGAAGATAATGGGTTCGG + Intronic
1105702814 13:22945938-22945960 AGGAGAGAAGATAATGGGATTGG + Intergenic
1108806117 13:54158694-54158716 AATTGGGGAGACAATGAGTTTGG - Intergenic
1108942303 13:55971923-55971945 ACTTGGGAAGAGAATGGGAGGGG + Intergenic
1110294007 13:73841018-73841040 AGTTGGAAAGTTAATGGGAGAGG - Intronic
1110777777 13:79430689-79430711 AGTTGGGGAGATTATGTGTGTGG - Intergenic
1112925062 13:104663562-104663584 AGTTGGGAACAAAATGCTTTCGG - Intergenic
1113325743 13:109279487-109279509 ATTTGGCAAGATAATGGCATTGG - Intergenic
1119444353 14:74650964-74650986 AGTTGGGAATATACTCAGTTGGG - Intergenic
1120085531 14:80268283-80268305 AGTGTGGGAGAAAATGGGTTTGG - Intronic
1120417685 14:84240721-84240743 ATTTGGGGAGATAATTGGATAGG - Intergenic
1121943459 14:98095350-98095372 ACATGGGTAGTTAATGGGTTAGG + Intergenic
1122018994 14:98820840-98820862 TGTGGGGAAAATAATGAGTTAGG - Intergenic
1124191272 15:27579287-27579309 AGTTGGGAAGATGTTGGGGAGGG - Intergenic
1124890400 15:33726817-33726839 AGTTGGGAAGAAAATGGACATGG + Intronic
1124890561 15:33728253-33728275 AGTTGGGAAGAAAATGGACATGG + Intronic
1127312766 15:57767312-57767334 AGTGGGGTAGATAATGCCTTCGG - Intronic
1128471550 15:67957846-67957868 ATTAGTGAAGATAATGGGTGTGG + Intergenic
1129271168 15:74419983-74420005 AGGTGGGAAGATGCTGGGTGTGG - Intronic
1129618594 15:77121432-77121454 AGTTGGCAAGGTGATGGGGTGGG + Intronic
1131777893 15:95822373-95822395 AGTTTGGATGATAAATGGTTGGG - Intergenic
1131970181 15:97884242-97884264 ATTTGGGATGGTCATGGGTTAGG - Intergenic
1133155286 16:3870358-3870380 AGTTGGGAAGAAAATGGCCTTGG - Intronic
1133379783 16:5320327-5320349 AGTTGGGAAGTACATGGGTATGG + Intergenic
1133544319 16:6790563-6790585 TGTTGGGAAAACAATGGTTTGGG - Intronic
1135479774 16:22813426-22813448 AGGTGGGGTGACAATGGGTTGGG + Intergenic
1137579675 16:49626378-49626400 AGGTGGGAAGAGAATGGCCTGGG - Intronic
1140820336 16:78657311-78657333 AGATGGGAAGAAAATGAGGTGGG + Intronic
1142867774 17:2801147-2801169 TGATAGGAAGATAATGGGTCTGG - Intronic
1143005335 17:3828667-3828689 AGTTGGAAAGCTCATGGGTCAGG + Intronic
1144062899 17:11599097-11599119 AGTCAGGAAGAAAATGGGATGGG + Intronic
1146622639 17:34411432-34411454 GGTTGGGAAGAGAATGGGGATGG + Intergenic
1148527672 17:48356648-48356670 AGTTGTCAAGATAAATGGTTAGG - Intronic
1149678053 17:58484770-58484792 AGTTTAGAAGATAAGGGATTAGG - Intronic
1150354867 17:64474481-64474503 ACTTGGGAAGCTGATGGGTGTGG - Intergenic
1150661908 17:67088520-67088542 ACTAGGGAAGAAAATGGGTCTGG + Intronic
1155643944 18:28054532-28054554 AGTTTGGAACATCATGGTTTTGG - Intronic
1159312682 18:66730046-66730068 ATTTGGAAACATAAAGGGTTTGG - Intergenic
1164945926 19:32293004-32293026 AGCTGGGAAGATAAAGTGCTCGG - Intergenic
1166366190 19:42279792-42279814 AGTTGGGAAGAAGATGGCTTGGG + Intronic
1168294944 19:55373738-55373760 TGTGGGGAAGGTAATGGGTCTGG + Intergenic
927841180 2:26445442-26445464 AGTTTTCAAAATAATGGGTTGGG + Intronic
928760133 2:34571931-34571953 AGTAGGGAAAAAAATGGGCTGGG - Intergenic
929643549 2:43605652-43605674 GGTTTGGAAGAGAATGGGTTTGG + Intergenic
931260121 2:60610549-60610571 GTTTGGGAAGATGGTGGGTTTGG - Intergenic
933280769 2:80330462-80330484 AGTTGGGAAATTAATGACTTTGG - Intronic
933303998 2:80574818-80574840 AGATGGGAAGATAGTGGAGTGGG - Intronic
933846481 2:86331176-86331198 AGTTGGGAAGATATGAAGTTAGG - Intronic
934607615 2:95709065-95709087 AGCAGGGAAGATTATGGCTTGGG - Intergenic
935507893 2:103930209-103930231 AGTTAGGAAGACAATTGATTTGG - Intergenic
936489825 2:112960571-112960593 AGTTGGGAAGAGATTGGGACAGG - Intergenic
936560963 2:113539566-113539588 AGTTAGGAACTTTATGGGTTGGG + Intergenic
937075812 2:119105681-119105703 AGATGGGAAGAGAATGAGTGAGG - Intergenic
937247400 2:120502646-120502668 AGCTGGGAAAAGTATGGGTTTGG - Intergenic
937702471 2:124879499-124879521 AGATGGGAAATGAATGGGTTGGG + Intronic
940978483 2:159973996-159974018 AGTTGGGAAGCCAATGGGGATGG - Intronic
941454343 2:165697353-165697375 AGCAAGGAAGATAATGGATTAGG + Intergenic
942850285 2:180476322-180476344 AGTTGGATCTATAATGGGTTAGG - Intergenic
943434065 2:187841618-187841640 AGTTGGGAAGATATTTTGCTAGG - Intergenic
943747034 2:191472639-191472661 AATTGGGAAAATAATTGGTATGG - Intergenic
943908034 2:193525537-193525559 AGTTGGGGAGATGATGGGGGAGG + Intergenic
945501295 2:210578722-210578744 AGTTGAGAAGAAAATGGCTATGG - Intronic
946484181 2:220085042-220085064 AGTTGGGAAGAGAATGGCTGAGG - Intergenic
948552434 2:238782929-238782951 AGTTGGGAAGATAGAGATTTCGG - Intergenic
948713449 2:239840470-239840492 AGATGGGAAGATATTAGGATGGG - Intergenic
1170136633 20:13081358-13081380 TGTTAGGAAGATAAATGGTTGGG - Intronic
1170428025 20:16255098-16255120 GGTTGGGAAGGGAATGGGTGAGG + Intergenic
1171096560 20:22337541-22337563 AGGTGGGAAGCCACTGGGTTTGG + Intergenic
1172573787 20:35991121-35991143 TATTGGGAAGAGAATGGATTGGG + Intronic
1173333121 20:42092119-42092141 AAATGGGAAGAAAATGGTTTGGG + Intronic
1173690406 20:44956498-44956520 AGTGGGGAAGATGATCAGTTTGG + Intronic
1177014135 21:15762851-15762873 AGTTGAGAATATAATGATTTTGG + Intronic
1178227627 21:30741692-30741714 AGATGTGAAGATAATGGGTAGGG + Intergenic
1178228000 21:30746863-30746885 AGATGTGAAGATAATGGGTAGGG + Exonic
1178451775 21:32708277-32708299 AGTTCGGAAGATACCGTGTTAGG + Intronic
1179226805 21:39460977-39460999 AATTGGGAAGACAAGGGATTGGG - Intronic
1179281024 21:39934416-39934438 AGAGGGGATGATGATGGGTTTGG + Intergenic
1179780342 21:43696149-43696171 AGTTGGGAAGATATTGGTGTTGG + Intergenic
1180734040 22:18002276-18002298 AGTTGGGAAGCAAAGAGGTTAGG + Intronic
1181907889 22:26213810-26213832 ACTTGGGAAGCTGATGTGTTAGG + Intronic
1182951269 22:34378225-34378247 AATTGGTCAGATAATGGGGTAGG - Intergenic
949160977 3:881564-881586 AGTTTGGATGAGAATTGGTTAGG + Intergenic
949323654 3:2840100-2840122 TGTTGAGAAGTTATTGGGTTGGG - Intronic
949974842 3:9446719-9446741 AGGTGGGAAGATCATGAGGTCGG - Intronic
950451174 3:13066701-13066723 AGCTGGGAAGAGAACGGGGTGGG - Intronic
953206216 3:40832078-40832100 AGTTGGGAAGCAAATGGTTTGGG - Intergenic
953496875 3:43394877-43394899 AATTGGGAAGAAAAGTGGTTTGG - Intronic
954973805 3:54674432-54674454 AGTTGGGAAGATAATTGAGCAGG + Intronic
955122752 3:56077376-56077398 AGTCATGTAGATAATGGGTTTGG - Intronic
955527636 3:59837715-59837737 AGTGGTGAAGGGAATGGGTTTGG + Intronic
955601290 3:60648106-60648128 AGATGGGACGACAATGGGGTGGG + Intronic
956285212 3:67601693-67601715 AGTTGGGAAGATTATAGGCCTGG - Intronic
957811048 3:85223284-85223306 TGTGGGGAAGATATTGGGCTAGG + Intronic
958718702 3:97819786-97819808 AGTTGGGAATATATTTAGTTTGG - Intergenic
959791653 3:110368858-110368880 CGATTGGAAGATAATGGGGTGGG - Intergenic
962642903 3:137406863-137406885 TGCTGGGAAGATAATGTTTTGGG + Intergenic
963548975 3:146697036-146697058 AGTTGGGATGAGAATGTGTGAGG - Intergenic
964080048 3:152743488-152743510 AGATGGGAAACTATTGGGTTGGG - Intergenic
964176501 3:153829520-153829542 AGGTGGAATGATAATGGCTTAGG + Intergenic
964201848 3:154126309-154126331 AGTGGGGAAGATTATGAGTTTGG - Intronic
964407417 3:156363850-156363872 AGTTTGGGAGAAAATGGGTTGGG - Intronic
966065324 3:175814731-175814753 AGTTGGGAATATCATGGATCAGG + Intergenic
968834656 4:2954769-2954791 AGTTGGGAGTGTAATGGGTCTGG - Intronic
968898579 4:3419720-3419742 AGGTGGGAAGAAAATTGCTTGGG + Intronic
969073644 4:4559611-4559633 AGCTGGGAAGGGAAGGGGTTGGG + Intergenic
969327416 4:6452006-6452028 AGTTGGAAGCATAATGGGTCAGG - Intronic
969560048 4:7941064-7941086 AGTTGGGCAGAGAAGGGGGTGGG - Intergenic
969720352 4:8890126-8890148 ATTTTGGAAGATAATTGGCTTGG - Intergenic
971383256 4:26119298-26119320 AGCTGGGCATATAATGGATTGGG - Intergenic
971744432 4:30560651-30560673 GGATAGGAAGACAATGGGTTTGG + Intergenic
971763029 4:30793495-30793517 CGTTGGGAATACAATGGCTTAGG - Intronic
972279223 4:37586513-37586535 AGTTGGAAGGACAAGGGGTTTGG + Intronic
973623761 4:52751443-52751465 GGCTGGGAAGATCCTGGGTTGGG + Exonic
973623773 4:52751475-52751497 GGCTGGGAAGATCCTGGGTTGGG + Exonic
974717031 4:65680218-65680240 AGTTGAGAAGATAAGAGTTTAGG - Intergenic
974896682 4:67948519-67948541 AGTTAAGAAGATAATAGTTTTGG + Intronic
975526751 4:75359351-75359373 ATTTTCGAAGATAATGTGTTTGG - Intergenic
975857795 4:78642878-78642900 GGTTAGAAAGATAATGAGTTTGG - Intergenic
976439412 4:85056113-85056135 AGTTGGGATTATGAGGGGTTTGG - Intergenic
976678065 4:87725380-87725402 AATTGGCAAGACAATGGGATGGG + Intergenic
976828618 4:89287596-89287618 GGATGGGGAGATAATGGGCTGGG + Intronic
976878778 4:89892090-89892112 AGGTGATGAGATAATGGGTTTGG - Intronic
977319041 4:95487978-95488000 AGTTTTGAAGACAATGGGATGGG - Intronic
977830924 4:101591739-101591761 TGTATGGAGGATAATGGGTTTGG + Intronic
979317858 4:119287071-119287093 AGTTGGGAACATGATGGGCAGGG + Intronic
980857906 4:138462658-138462680 CATTGGGAAAATAATGGTTTGGG - Intergenic
986093915 5:4537478-4537500 AGTTGGAAAGAGAATGGTGTGGG - Intergenic
987620053 5:20328870-20328892 AATTGGGAAGATGAGGGGGTAGG + Intronic
989773661 5:45175536-45175558 ATTTGGGAAAAAAATGTGTTGGG - Intergenic
990520164 5:56572149-56572171 AGTTGGTAAGATAGTGTATTAGG + Intronic
995058981 5:107793400-107793422 GGTTGGGCAGATGATGGGTGGGG + Intergenic
995424959 5:112010779-112010801 AGTTGGTGAGAAAATGGATTAGG + Intergenic
996242062 5:121215909-121215931 AGCTGGGAAGAGAATGGAGTGGG - Intergenic
999521986 5:152360076-152360098 CGTGGGGAAGATAATGAGTAGGG + Intergenic
999789481 5:154925686-154925708 ACTCTGGAGGATAATGGGTTTGG + Intronic
1000075400 5:157779959-157779981 AGTTGGGAACATAATTTGTTGGG - Intergenic
1000586344 5:163103664-163103686 TGTTGGGAAGACAATAGTTTTGG + Intergenic
1003541171 6:7019317-7019339 ACTTCGGAAGAAAATGGTTTGGG - Intergenic
1005689062 6:28284208-28284230 AGGTGGGAAGAGAATGTGTGTGG + Exonic
1006961701 6:37938033-37938055 AGTTGGGAAGATGATGACTAGGG - Intronic
1007349455 6:41258323-41258345 AGTGGGGAAGCTCATGGCTTGGG + Intergenic
1007652439 6:43431936-43431958 AGTTGGTCAGAAAATGAGTTAGG + Intronic
1009637356 6:66283432-66283454 AGTTTTGAAGAGAATTGGTTAGG + Intergenic
1010917090 6:81633466-81633488 AAATGAGAAGTTAATGGGTTAGG - Intronic
1011384665 6:86782132-86782154 AGGTGGGAAGAGAATAGGTAGGG - Intergenic
1013881332 6:114904918-114904940 ACTTGGGAAGTTAAAGGGTTAGG + Intergenic
1016915043 6:149236972-149236994 AGTTGGGAAGATAAATGATTTGG - Intronic
1017611121 6:156187468-156187490 AGTTGGAAAGAGAATGAGTCAGG + Intergenic
1018211551 6:161487438-161487460 TGTTGGGAAGGTAATGAGATGGG + Intronic
1018854653 6:167666831-167666853 AATTGGTAAGAAAATGGGTCTGG - Intergenic
1018973396 6:168545087-168545109 AGTCGAGAAGATAATGGTGTGGG + Intronic
1019627884 7:2030295-2030317 AGTTAGCAAGGTAATGAGTTTGG - Intronic
1019920970 7:4163159-4163181 AGCTGGGAACATAGTGGGATGGG + Intronic
1022827444 7:34030157-34030179 AGGTGGGAAGACAAAGGTTTTGG + Intronic
1022832034 7:34077280-34077302 AGTTGAGAAGATATGGAGTTAGG + Intronic
1023243157 7:38171028-38171050 ATTTGGGAAAATAAAGGGGTGGG - Intergenic
1024019810 7:45357747-45357769 ATTAGGGAAGACAGTGGGTTTGG + Intergenic
1024777527 7:52805028-52805050 AGTTGGGAATATCATGGGAGGGG + Intergenic
1026096827 7:67353119-67353141 AGTTGGGAAAAAAATGGGGCAGG + Intergenic
1028326970 7:89539941-89539963 AGTTGCGAAGATAGTGGGAAAGG - Intergenic
1031686894 7:124741566-124741588 AGTTGGAAAGAAAATGATTTGGG - Intergenic
1032646091 7:133825556-133825578 GGCTGGGGAGATAATAGGTTTGG - Intronic
1032866876 7:135934731-135934753 AGTTAGGACCATAATGAGTTAGG - Intronic
1033275792 7:139970917-139970939 AGTAGGGAAGCTAAGGGGCTGGG - Intronic
1033715608 7:143998727-143998749 GATTGGGAAGAAAATAGGTTGGG + Intergenic
1034487169 7:151373257-151373279 TGTTGGGAAAATAATGAGGTTGG + Intronic
1035930306 8:3773268-3773290 ATTTGGGGATATAATAGGTTTGG + Intronic
1036510814 8:9398419-9398441 AGATGGGCAGAGAATGGATTGGG + Intergenic
1036806563 8:11838453-11838475 AGTTGGGAAGATTCTGCGTCCGG - Exonic
1037719132 8:21427930-21427952 TGATGGGAAGATAATGGGAATGG - Intergenic
1038848154 8:31248881-31248903 TTTTGGGAAGATAATTTGTTTGG + Intergenic
1039241393 8:35560770-35560792 GGTTGGGAAAATACTGTGTTTGG + Intronic
1039934878 8:42033574-42033596 AGTGGGGAAGCAAATGGGTGCGG - Intronic
1041678324 8:60560181-60560203 AGATGGGAAGATAATGAGCCAGG - Intronic
1043133350 8:76489452-76489474 AGTTGGGAAGATGTTGGGCATGG - Intergenic
1044768719 8:95606171-95606193 AGTTGGGGATATCATGGCTTTGG + Intergenic
1045574596 8:103406624-103406646 AGCTGGGAAGATGATGGGGCAGG + Intronic
1048310530 8:133319184-133319206 AGTGGGGAAGAGAAAGGGTGGGG - Intergenic
1048376425 8:133826424-133826446 GGGTGGGAATTTAATGGGTTTGG + Intergenic
1048840327 8:138560072-138560094 AGTTGGGAAAATAAGGGAGTGGG - Intergenic
1049871696 8:144984173-144984195 ATTTGGGAAGATATTTGGGTGGG - Intergenic
1049891717 9:75760-75782 AGTTAGGAACTTTATGGGTTGGG - Intergenic
1050163686 9:2743060-2743082 GGTTGGGAAGATAGTGGGGTAGG + Intronic
1051501182 9:17779371-17779393 AATGGGAAAGAGAATGGGTTTGG + Intronic
1051746267 9:20297852-20297874 AGTTGGGGAGATGGTGGGTGGGG - Intergenic
1051981570 9:23026068-23026090 AGGTGAGAAGAAAATGGGTGTGG - Intergenic
1052040182 9:23729267-23729289 AGTTGGGAAGAAAATGGAATAGG - Intronic
1052436104 9:28431262-28431284 AGTTAGGAAGATACTGGATGTGG - Intronic
1053733144 9:41076851-41076873 AGTTAGGAACTTTATGGGTTGGG - Intergenic
1054695279 9:68354712-68354734 AGTTAGGAACTTTATGGGTTGGG + Intronic
1055284260 9:74711666-74711688 AGGGGGAAAGATAATAGGTTTGG + Intergenic
1056555623 9:87684869-87684891 CGTTGGGAGGATAAAAGGTTAGG - Intronic
1056639845 9:88361136-88361158 AGGTGGGAAGATTATGGATGGGG - Intergenic
1060824396 9:126679712-126679734 GGTTAGGAAGATAGTGGGTCAGG - Intronic
1061261710 9:129483847-129483869 AGCTGGGAAGATTTTGGGTGCGG + Intergenic
1186722897 X:12324806-12324828 ATTAGGTAAGATAATGGGTGTGG + Intronic
1188438491 X:30189957-30189979 AGTTGGAAAGATACTGGAGTGGG - Intergenic
1188547484 X:31325202-31325224 AGTTGGGAAGAGAATGAGAAAGG - Intronic
1190755861 X:53401328-53401350 AGTAGGGAAGGTAATGGGAATGG - Intronic
1190826643 X:54024006-54024028 AGTTGGGAATATATTTAGTTGGG - Intronic
1191061662 X:56304454-56304476 AGGTGGGCAGATCATGAGTTCGG + Intergenic
1194524465 X:94961255-94961277 ACTTTGGAAGACAATTGGTTAGG - Intergenic
1194871404 X:99136843-99136865 AGAAAGGAAGATAGTGGGTTAGG + Intergenic
1195969735 X:110460255-110460277 TGTTGGGAAGTGGATGGGTTAGG + Intergenic
1198037647 X:132817409-132817431 AGTTGGGAGAAGAATGGGCTTGG + Intronic
1200428236 Y:3046053-3046075 AGGTGGGGTGAGAATGGGTTTGG - Intergenic
1201500974 Y:14642350-14642372 GGTTGGGAAGAGACTGGGTGGGG - Intronic