ID: 1104040135

View in Genome Browser
Species Human (GRCh38)
Location 12:125124418-125124440
Sequence GTTGGGAAGATAATGGGTTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 330}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104040127_1104040135 -1 Left 1104040127 12:125124396-125124418 CCCCAAGATACAATACTCTGCAG 0: 1
1: 0
2: 1
3: 16
4: 155
Right 1104040135 12:125124418-125124440 GTTGGGAAGATAATGGGTTCGGG 0: 1
1: 0
2: 0
3: 22
4: 330
1104040129_1104040135 -3 Left 1104040129 12:125124398-125124420 CCAAGATACAATACTCTGCAGTT 0: 1
1: 0
2: 0
3: 17
4: 143
Right 1104040135 12:125124418-125124440 GTTGGGAAGATAATGGGTTCGGG 0: 1
1: 0
2: 0
3: 22
4: 330
1104040128_1104040135 -2 Left 1104040128 12:125124397-125124419 CCCAAGATACAATACTCTGCAGT 0: 1
1: 0
2: 0
3: 13
4: 173
Right 1104040135 12:125124418-125124440 GTTGGGAAGATAATGGGTTCGGG 0: 1
1: 0
2: 0
3: 22
4: 330
1104040126_1104040135 0 Left 1104040126 12:125124395-125124417 CCCCCAAGATACAATACTCTGCA 0: 1
1: 0
2: 0
3: 13
4: 163
Right 1104040135 12:125124418-125124440 GTTGGGAAGATAATGGGTTCGGG 0: 1
1: 0
2: 0
3: 22
4: 330
1104040125_1104040135 8 Left 1104040125 12:125124387-125124409 CCTTTGGTCCCCCAAGATACAAT 0: 1
1: 0
2: 1
3: 8
4: 70
Right 1104040135 12:125124418-125124440 GTTGGGAAGATAATGGGTTCGGG 0: 1
1: 0
2: 0
3: 22
4: 330
1104040124_1104040135 11 Left 1104040124 12:125124384-125124406 CCTCCTTTGGTCCCCCAAGATAC 0: 1
1: 1
2: 1
3: 13
4: 235
Right 1104040135 12:125124418-125124440 GTTGGGAAGATAATGGGTTCGGG 0: 1
1: 0
2: 0
3: 22
4: 330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104040135 Original CRISPR GTTGGGAAGATAATGGGTTC GGG Intronic
900470408 1:2851337-2851359 GTTGGGAAGAAGAAGCGTTCTGG + Intergenic
901355071 1:8639000-8639022 GATGGGAGGATAATGAGATCAGG - Intronic
901526546 1:9826510-9826532 GGTGAGAAGATAAAGGGATCAGG - Intergenic
901764082 1:11488979-11489001 GATGGGAAGAGAAAGGGCTCTGG + Intronic
903836679 1:26207988-26208010 GTAGGGAAGGCATTGGGTTCTGG + Intergenic
904176803 1:28635532-28635554 GGTGGGCAGATCATGAGTTCAGG - Intronic
904858097 1:33515091-33515113 GTTGGGAAGTTCATGAGTTTAGG - Exonic
905461039 1:38123209-38123231 CTTTGGAAGACAATGGCTTCAGG + Intergenic
905856037 1:41314839-41314861 GCAGGGAAGATCATGGGATCAGG - Intergenic
906020063 1:42620108-42620130 GATGGGAAGATCATAGGCTCTGG + Intronic
907350887 1:53829921-53829943 GGTGGGCAGATCATGAGTTCAGG + Intronic
908349720 1:63272808-63272830 GTTGGGAGGATGATGTGATCTGG - Intergenic
908698203 1:66868846-66868868 GGTGGGCAGATCATGGGGTCAGG + Intronic
909398718 1:75200136-75200158 GGTGGGAAGATCATGAGGTCAGG - Intergenic
911677470 1:100675642-100675664 ATTAGGAAGCAAATGGGTTCTGG + Intergenic
912768756 1:112442479-112442501 GTGGGGAAGAAAATGTGTTTAGG - Intronic
913061454 1:115212049-115212071 GTTGGGCAGATCATGAGGTCAGG + Intergenic
913395997 1:118373435-118373457 GATGGGCAGATCATGAGTTCAGG - Intergenic
914003053 1:143708969-143708991 GGTGGGCAGATCATGAGTTCAGG - Intergenic
915435542 1:155902931-155902953 GGTGGGAAGATCATGAGGTCAGG + Intronic
915587294 1:156851204-156851226 GTGGTGAAGAGAATGGGCTCTGG - Intronic
916170108 1:161995585-161995607 GTTGGGGAGAGGCTGGGTTCTGG + Intronic
916591807 1:166198516-166198538 GTTGGGTAGATATGGGATTCTGG - Intergenic
916801836 1:168223162-168223184 GTAGGGAACACAATGAGTTCAGG + Intergenic
919511512 1:198471697-198471719 GTGGGGAAGACAATTGGTGCAGG - Intergenic
919644944 1:200086278-200086300 GGTGGGGAGAGAATGAGTTCCGG + Intronic
920313189 1:205060483-205060505 GGTGGGAAGATCATGAGGTCAGG + Intronic
920318773 1:205100855-205100877 GGTGGGAGGATTATGGTTTCAGG + Intronic
920957141 1:210630068-210630090 GTTGGGCAGATCATGAGGTCAGG - Intronic
921651555 1:217684863-217684885 GTTGTGAATATAAAGGGATCTGG + Intronic
922337453 1:224629234-224629256 GGTGGGCAGATCATGGGTTCAGG - Intronic
922805463 1:228384890-228384912 GTTGGGAAAATAATTTATTCTGG + Intergenic
923158958 1:231301285-231301307 TGTGGAAAGCTAATGGGTTCTGG - Intergenic
923170925 1:231416298-231416320 CTTTGAAAGATAATGGATTCCGG - Intronic
923572138 1:235125983-235126005 GGTGGGAAGATCATGAGGTCAGG - Intronic
923923177 1:238592945-238592967 GTTGAGAAGATAGAGAGTTCAGG - Intergenic
924229552 1:241952082-241952104 TTTGGGAAGATGAAGAGTTCTGG - Intergenic
1063633905 10:7762510-7762532 GTTGTGAAGATGATTGATTCTGG - Exonic
1065411583 10:25435318-25435340 GTTGGAGAGATAATGGGTTGGGG + Intronic
1066576277 10:36828843-36828865 GGTGGGCAGATCATGGGGTCAGG + Intergenic
1068123524 10:52809697-52809719 GGTGGGAAGATCATGAGGTCAGG - Intergenic
1068259561 10:54561909-54561931 GGTGGGCAGATAATGAGGTCAGG - Intronic
1068507917 10:57926418-57926440 GGTGGGAAGATCATGAGGTCAGG + Intergenic
1069500516 10:68948893-68948915 GTTGGGAATATGATTAGTTCAGG + Intergenic
1070085867 10:73236639-73236661 GGTGGGCAGATAATGAGGTCAGG - Intronic
1071832634 10:89387085-89387107 GGTGGGCAGATCATGGGGTCAGG + Intronic
1072181162 10:92981886-92981908 GTTGGGCAGATCATGAGGTCAGG + Intronic
1073346882 10:102789965-102789987 GTTGGGCAGATCATGAGGTCAGG - Intronic
1073410253 10:103335736-103335758 GGTGGGCAGATAATGAGGTCAGG + Intronic
1073593516 10:104778350-104778372 TTTGGGGAAATAATGGATTCAGG + Intronic
1074751868 10:116594685-116594707 GTTGGGGAGATAATGGGAGCAGG - Intronic
1074751872 10:116594702-116594724 GTTGGGGAGATAGTGGGGTTGGG - Intronic
1074970611 10:118533540-118533562 GTTGGGAAAATCCTGGGCTCTGG + Intergenic
1076308987 10:129489129-129489151 GGTGGGCAGATCATGAGTTCAGG + Intronic
1076363755 10:129909173-129909195 CATGGGGAGATCATGGGTTCTGG - Intronic
1079122984 11:17698369-17698391 GTTGGTAGGATAATGGGGTGGGG + Intergenic
1079145976 11:17852273-17852295 GTTTGAAAGAGCATGGGTTCGGG - Intronic
1079252977 11:18801033-18801055 TGTGGGAAAATAATGGGATCTGG - Intergenic
1079827530 11:25215317-25215339 GGTTGGAAGTTAATGGGTTTTGG - Intergenic
1080054560 11:27892721-27892743 GTTGGGCAGAGTATAGGTTCTGG + Intergenic
1081386003 11:42474232-42474254 GGTGGGCAGATCATGAGTTCAGG + Intergenic
1081791194 11:45787210-45787232 GTTGGGGAGAGGATGGTTTCAGG + Intergenic
1083147876 11:60772369-60772391 GCTGGGCAGAGAATGGGTTGTGG + Intronic
1084980704 11:72827083-72827105 CTTGGGAGGACACTGGGTTCTGG + Intronic
1085038121 11:73311591-73311613 GTAGGGAAGCCTATGGGTTCTGG - Exonic
1085592273 11:77774992-77775014 GTTGGGCAGATCATGAGGTCAGG - Intronic
1085664446 11:78401237-78401259 TTTTGCAAGATAAAGGGTTCTGG - Intronic
1085733156 11:79016446-79016468 TTTGGAAAGATAATGGATTTGGG + Intronic
1085781252 11:79411176-79411198 CTGGGGAAGATCAAGGGTTCAGG - Intronic
1087420342 11:97916413-97916435 GATGGGAAAATAATGAGTTTAGG + Intergenic
1087696954 11:101390209-101390231 GTGGAGAAGAAAATGGATTCTGG + Intergenic
1088240620 11:107770327-107770349 GGTGGGAAGATCATGAGGTCAGG + Intergenic
1090876337 11:130791810-130791832 GGTGGGCAGATCATGGGGTCAGG + Intergenic
1090957430 11:131525693-131525715 AATGGGAAGATAATGGGCTCTGG + Intronic
1091493842 12:955410-955432 GTTAGCAAGATAATGGGTTGGGG - Intronic
1093281479 12:17201788-17201810 GGTGGGAAGATCATGAGGTCAGG + Intergenic
1095513223 12:42976382-42976404 GCTGTTAAGATAATGGGTTCCGG + Intergenic
1095808908 12:46350711-46350733 TTGGGGAAGCTGATGGGTTCAGG + Intergenic
1096026152 12:48363872-48363894 GGTGGGAAGATCATGAGGTCAGG - Intergenic
1097289648 12:57903852-57903874 GTCTGGAAGATGATGGGGTCGGG - Intergenic
1098102367 12:67031608-67031630 AATGGAAAGATGATGGGTTCAGG - Intergenic
1099431959 12:82597572-82597594 GAGAGGAAGATAATGAGTTCTGG - Intergenic
1101572022 12:105962355-105962377 GTGGGGAAAAGAATGAGTTCTGG + Intergenic
1102310105 12:111838040-111838062 GTTGGGCAGATCATGAGGTCAGG - Intergenic
1102428290 12:112861782-112861804 GTTGGGCAGATCATGAGGTCAGG + Intronic
1104040135 12:125124418-125124440 GTTGGGAAGATAATGGGTTCGGG + Intronic
1104899405 12:132180463-132180485 GTTTGGAAGATGACAGGTTCTGG + Intergenic
1105055720 12:133097412-133097434 GGTGGGCAGATCATGAGTTCAGG + Intronic
1105494790 13:20920987-20921009 GGTGGGAAGATCATGAGGTCAGG + Intergenic
1106221428 13:27749001-27749023 ATTGGGAAGAGCATGGGCTCTGG - Intergenic
1106538924 13:30672863-30672885 GGTGGGCAGATCATGGGGTCAGG - Intergenic
1109600134 13:64614912-64614934 GTTGGGAATATAATAGTCTCTGG + Intergenic
1110392412 13:74990687-74990709 GATTGGAAAATAATGTGTTCTGG - Intergenic
1110856605 13:80303676-80303698 CTTGGGAAAATGATGGCTTCAGG - Intergenic
1113023277 13:105912587-105912609 GGTGGGAAGATCATGAGGTCAGG + Intergenic
1113235163 13:108264351-108264373 GTTGAGAAGAGGATGGGTTTAGG - Intronic
1113750584 13:112773937-112773959 CTTGGGAAGAGAAGGGGTCCCGG + Intronic
1116773437 14:49152925-49152947 GCTGGGAAGACAATGGGCTCAGG + Intergenic
1119193944 14:72703092-72703114 GTTGAGGAGATAATAGCTTCAGG - Intronic
1120297625 14:82663961-82663983 GGTGGGCAGATCATGAGTTCAGG - Intergenic
1121668262 14:95688911-95688933 TTTGGGAAGATAAAAAGTTCTGG + Intronic
1121995401 14:98598707-98598729 GTGGAGAGGAAAATGGGTTCTGG - Intergenic
1124008003 15:25810151-25810173 GTTGGGGAGATGATGGATGCGGG + Intronic
1128888657 15:71311393-71311415 TTTTGGAAGATAATGGGTTTTGG + Intronic
1130169939 15:81500889-81500911 GGTGGGCAGATCATGAGTTCAGG + Intergenic
1131496863 15:92919618-92919640 GATGGGAAGATCATGAGGTCAGG - Intronic
1131549810 15:93347691-93347713 GGTGGGCAGATAATGAGGTCAGG + Intergenic
1133155285 16:3870357-3870379 GTTGGGAAGAAAATGGCCTTGGG - Intronic
1133544318 16:6790562-6790584 GTTGGGAAAACAATGGTTTGGGG - Intronic
1137005958 16:35274520-35274542 GTTGGGAAGACAGTGAGGTCTGG + Intergenic
1138115656 16:54358547-54358569 GTTGGGAGGATCATGAGGTCAGG + Intergenic
1138676697 16:58656546-58656568 GTTGGGCAGATCACGAGTTCAGG + Intergenic
1139364001 16:66422298-66422320 GATGGGAAATTAATGGGTTTTGG + Intergenic
1140721629 16:77777272-77777294 GGTGGGCAGATAATGAGGTCAGG + Intergenic
1141680870 16:85542996-85543018 GGTGGGTAGATCATGAGTTCAGG + Intergenic
1142867773 17:2801146-2801168 GATAGGAAGATAATGGGTCTGGG - Intronic
1142922916 17:3206957-3206979 CCTGAGAAGATGATGGGTTCTGG - Intergenic
1143470122 17:7168523-7168545 GGTGGGAAGATAATGAGGTCAGG - Intergenic
1143761711 17:9109102-9109124 GTTGGGAGGATCATGAGGTCAGG - Intronic
1143814869 17:9504743-9504765 GGTGGGAAGATCATGAGGTCAGG + Intronic
1143838821 17:9714450-9714472 GGTGGGCAGATCATGGGGTCAGG + Intronic
1143896261 17:10138533-10138555 GGTGGGCAGATCATGGGGTCAGG + Intronic
1144642186 17:16943718-16943740 GTTGGGAAGAGCAAGGATTCAGG - Intronic
1145930819 17:28684089-28684111 GGTGGGCAGATCATGAGTTCAGG - Intronic
1147026941 17:37594687-37594709 GGTGGGCAGATCATGAGTTCAGG - Intronic
1147760735 17:42795985-42796007 GTGGGGAAGATGAGGAGTTCTGG + Exonic
1147893176 17:43731966-43731988 GGTGGGAGGATAATGAGGTCAGG - Intergenic
1147954974 17:44127970-44127992 GGTGGGCAGATCATGGGGTCAGG - Intergenic
1148289121 17:46427256-46427278 GTTGGGTAGATAATGCGTAAAGG + Intergenic
1148311290 17:46644833-46644855 GTTGGGTAGATAATGCGTAAAGG + Intronic
1148731933 17:49842131-49842153 GGTGGGAAGATCATGAGGTCAGG - Intronic
1149909771 17:60556548-60556570 GTGGGGAAGATCATGAGGTCAGG - Intergenic
1149987378 17:61357669-61357691 GGTGGGTAGATAATGAGGTCAGG - Intronic
1150299029 17:64033157-64033179 GGTGGGAAGATCATGAGGTCAGG + Intergenic
1150458969 17:65331123-65331145 TTTAGGAAGATGAAGGGTTCTGG - Intergenic
1156000683 18:32380721-32380743 GTTGGGAAGATAATGAAATCTGG - Intronic
1156726663 18:40136790-40136812 GGTGGGCAGATCATGAGTTCAGG + Intergenic
1158991691 18:62875181-62875203 GGTGGGCAGATAATGAGGTCAGG - Intronic
1159610494 18:70519843-70519865 GGTGGGCAGATCATGAGTTCAGG + Intergenic
1160131056 18:76225348-76225370 ATTGGGAAGATTATGGGTTGTGG - Intergenic
1163056210 19:14720300-14720322 CTGGGGAAGATATTGTGTTCAGG + Exonic
1163177573 19:15575327-15575349 GATGGGCAGATCATGAGTTCAGG - Intergenic
1163676415 19:18657691-18657713 GGAGGAAAGATAATGGCTTCTGG - Intronic
1164107827 19:22124458-22124480 GGTGGGCAGATCATGGGGTCAGG - Intergenic
1166366191 19:42279793-42279815 GTTGGGAAGAAGATGGCTTGGGG + Intronic
1166775002 19:45307139-45307161 GTGGGTAAGAGAGTGGGTTCTGG + Intronic
1167053716 19:47095651-47095673 GTGAGGAAGAAATTGGGTTCAGG + Intronic
1168294945 19:55373739-55373761 GTGGGGAAGGTAATGGGTCTGGG + Intergenic
926126395 2:10274805-10274827 GGTGGGCAGATAATGAGGTCAGG + Intergenic
927350613 2:22108695-22108717 GGTGGGCAGATCATGAGTTCAGG + Intergenic
927663504 2:25013032-25013054 GGTGGGCAGATCATGGGGTCAGG - Intergenic
927746087 2:25622590-25622612 GGTGGGAAGAAAAGGGGATCAGG - Intronic
928071584 2:28222750-28222772 GTCAGGAAGAGAAGGGGTTCTGG - Intronic
928306811 2:30177159-30177181 GGTGGGCAGATAATGAGGTCAGG - Intergenic
929050930 2:37836284-37836306 GATGGGCAGATCATGGGGTCAGG - Intergenic
929279459 2:40062090-40062112 GTAGGGAAGGTAATGGGTGGTGG - Intergenic
929441520 2:41968995-41969017 GGTGGGAGGATCATGGGGTCAGG - Intergenic
931617570 2:64175826-64175848 GTTATGAAGAGCATGGGTTCTGG + Intergenic
933009450 2:77040668-77040690 ATTGGGCTGATAATGGGTTTAGG + Intronic
933795639 2:85917393-85917415 GGTGGGCAGATAATGAGGTCAGG - Intergenic
933986107 2:87593565-87593587 GATGGGAGGAGCATGGGTTCTGG + Intergenic
934778697 2:96955279-96955301 GGTGGGAAGATCATGAGGTCAGG + Intronic
935070402 2:99688951-99688973 GGTGGGGAGGTAATAGGTTCTGG - Intronic
935302922 2:101709155-101709177 CTGGGGAAGATAAAGGATTCAGG - Intronic
935609697 2:105008828-105008850 GGTGGGCAGATCATGGGGTCAGG + Intergenic
935886801 2:107629550-107629572 GGTGGGCAGATCATGAGTTCAGG - Intergenic
935985181 2:108665751-108665773 GGTGGGCAGATAATGAGATCAGG - Intronic
936137616 2:109909395-109909417 GGTGGGCAGATAATGAGATCAGG - Intergenic
936207081 2:110462090-110462112 GGTGGGCAGATAATGAGATCAGG + Intronic
936307730 2:111357238-111357260 GATGGGAGGAGCATGGGTTCTGG - Intergenic
936551719 2:113448673-113448695 GGTGGGCAGATAACGAGTTCAGG + Intronic
936590228 2:113796535-113796557 GGTGGGAGGATCATGAGTTCAGG - Intergenic
937117578 2:119419545-119419567 GGTGGGCAGATCATGGGGTCAGG + Intergenic
937409960 2:121665905-121665927 GGAGGGAAGAAAATGGGGTCTGG - Intergenic
937792239 2:125974103-125974125 GTTGTTAAGTTAATGGTTTCAGG - Intergenic
938867400 2:135437185-135437207 GGTGGGTAGATCATGAGTTCAGG - Intronic
940083500 2:149831865-149831887 GTGGGAAAGATAAAGGGGTCTGG + Intergenic
940170600 2:150825923-150825945 TTTGGGAAGAGCATGGGCTCTGG + Intergenic
940668244 2:156635545-156635567 GTTGGGCAGATTATGAGGTCAGG - Intergenic
940722488 2:157297618-157297640 GTTAGGACGAGAATGCGTTCTGG + Intronic
941132591 2:161671911-161671933 AGTGGGAAGATAATGTGTTTTGG + Intronic
942640690 2:178058083-178058105 GGTGGGTAGATCATGAGTTCAGG - Intronic
943357576 2:186876325-186876347 GATGGGCAGATCATGGGGTCAGG + Intergenic
944903592 2:204240624-204240646 GATGGGAAGATCATGAGGTCAGG - Intergenic
945646043 2:212495709-212495731 GTAGGAAAGATAATGTATTCTGG - Intronic
946218432 2:218204726-218204748 GGTGGGCAGATCATGGGGTCAGG - Intergenic
946484180 2:220085041-220085063 GTTGGGAAGAGAATGGCTGAGGG - Intergenic
946665283 2:222043078-222043100 GTTAGGAAGATCATGGGGTTTGG - Intergenic
947223699 2:227820029-227820051 GTTGGGCAGATCATGAGGTCAGG - Intergenic
948467829 2:238160564-238160586 GTTGGGCGGAGAAAGGGTTCAGG - Intronic
948552433 2:238782928-238782950 GTTGGGAAGATAGAGATTTCGGG - Intergenic
1169300551 20:4438664-4438686 GTAAGGAAGATTAAGGGTTCAGG + Intergenic
1171137429 20:22709064-22709086 GTTGGGAAGGTAAGGGGAACAGG - Intergenic
1173037763 20:39428843-39428865 TTTGGGAAACTAATGGCTTCAGG - Intergenic
1173645999 20:44633540-44633562 GCTGGGAAGACCATGGGTTAAGG + Intronic
1173715578 20:45201089-45201111 GTTGAGAAGAACATGTGTTCTGG + Intergenic
1173859819 20:46275955-46275977 GGTGGGAAGAAGAGGGGTTCAGG + Intronic
1174010430 20:47445228-47445250 GGTGGGAGGATCATGAGTTCAGG - Intergenic
1174731676 20:52924149-52924171 GTTGTTAAAGTAATGGGTTCTGG - Intergenic
1177100902 21:16896273-16896295 GTTTGGAAGAAAATGGATTTTGG - Intergenic
1177815868 21:25975925-25975947 GTTTGGTAGGAAATGGGTTCAGG + Intronic
1178063718 21:28880043-28880065 TTTGGGAAAATAATGTGTTACGG + Intronic
1178227628 21:30741693-30741715 GATGTGAAGATAATGGGTAGGGG + Intergenic
1178228001 21:30746864-30746886 GATGTGAAGATAATGGGTAGGGG + Exonic
1178323194 21:31621745-31621767 GATGGGCAGATAATGAGGTCAGG + Intergenic
1178511903 21:33212347-33212369 GCTGCGAAGACAAAGGGTTCTGG - Intergenic
1178714635 21:34952774-34952796 GCTGGGAACATACTGGGTACTGG + Intronic
1179031941 21:37728342-37728364 TTTGGGAAGATGAAGAGTTCTGG + Intronic
1179435723 21:41360823-41360845 CTTGGGAAGAGAAGTGGTTCAGG + Intergenic
1181629770 22:24144571-24144593 GATGGGAAGATCATGGGCACAGG + Intronic
1182866128 22:33606174-33606196 GGTGGGTAGATAATGAGATCAGG + Intronic
1185034927 22:48469210-48469232 GGTGGGAAGATCATGAGGTCAGG - Intergenic
949974841 3:9446718-9446740 GGTGGGAAGATCATGAGGTCGGG - Intronic
953938484 3:47068722-47068744 GGTGGGAAGATCATGAGATCAGG - Intronic
954589042 3:51764124-51764146 GGTGGGAGGATAATGAGGTCAGG + Intergenic
958540899 3:95470133-95470155 GTTGGGAAGAGAATAGCTTTTGG + Intergenic
958639077 3:96780975-96780997 GGTGGGCAGATCATGAGTTCAGG + Intergenic
959791652 3:110368857-110368879 GATTGGAAGATAATGGGGTGGGG - Intergenic
959803725 3:110526226-110526248 TTTGGGAAGATTAAAGGTTCTGG - Intergenic
961991163 3:131192828-131192850 TTTGGGAAGATAAAAAGTTCTGG + Intronic
962782989 3:138739214-138739236 GGTGGGCAGATAATGAGGTCAGG + Intronic
963812288 3:149789855-149789877 GGTGGGAAGATCATGAGGTCAGG - Intronic
964755518 3:160088071-160088093 TTTGGAAAGCTAATGGGTTCTGG - Intergenic
965493084 3:169363794-169363816 GGTGGGAAAATAATGAGATCCGG - Intronic
965882457 3:173402151-173402173 GTAGGTAAAATAATGGATTCTGG + Intronic
968067988 3:195769391-195769413 GGAGGGGAGATAAAGGGTTCTGG + Intronic
969135349 4:5024814-5024836 GTTGGGAAGAGTCTGGCTTCTGG + Intergenic
970033508 4:11704743-11704765 GGTGGGTTAATAATGGGTTCAGG - Intergenic
970430085 4:15981188-15981210 GGTGGGCAGATAATGAGGTCAGG - Intronic
971064105 4:23008002-23008024 GTTGGGCAGATCATGAGGTCAGG + Intergenic
971190546 4:24424502-24424524 GGTGGGAGGATAATGAGGTCAGG - Intergenic
971232319 4:24809643-24809665 GCTGGGAAGAGATTGGCTTCTGG - Intronic
971324670 4:25634159-25634181 TTTTGGAAGCTAATGGGTACTGG + Intergenic
971457671 4:26859997-26860019 GGTGGGAAGGTGATGAGTTCAGG + Intronic
971770390 4:30888101-30888123 GGTGGGCAGATAATGAGGTCAGG - Intronic
972016805 4:34256911-34256933 GGTGGGCAGATCATGAGTTCAGG + Intergenic
972047197 4:34681278-34681300 GGTGGGCAGATCATGAGTTCTGG - Intergenic
972698599 4:41472276-41472298 GTTGGCAAAATCATGGCTTCAGG - Intronic
973623762 4:52751444-52751466 GCTGGGAAGATCCTGGGTTGGGG + Exonic
973623774 4:52751476-52751498 GCTGGGAAGATCCTGGGTTGGGG + Exonic
974499300 4:62677976-62677998 GTAGGAAAGATAATGTGTGCAGG - Intergenic
974856379 4:67466123-67466145 GTTGGGCAGATCATGAGGTCAGG + Intergenic
976828619 4:89287597-89287619 GATGGGGAGATAATGGGCTGGGG + Intronic
977465790 4:97381922-97381944 GTTGGTAATATAATGGGGTCTGG - Intronic
978240453 4:106509032-106509054 GGTGGGCAGATCATGGGGTCAGG - Intergenic
979793907 4:124820021-124820043 GATGGGCAGATCATGAGTTCAGG - Intergenic
980857905 4:138462657-138462679 ATTGGGAAAATAATGGTTTGGGG - Intergenic
982019839 4:151191872-151191894 GGTGGGAAGATCATGAGGTCAGG - Intronic
982729880 4:158944636-158944658 ATGGGGAAGATGATGAGTTCAGG - Intronic
983729491 4:170975757-170975779 GGTGGGCAGATCATGAGTTCAGG + Intergenic
984040083 4:174721254-174721276 GGTGGGAAGATCATGAGGTCAGG - Intronic
984495035 4:180486356-180486378 GGTGGGAAGATCACGAGTTCAGG - Intergenic
984701186 4:182819696-182819718 AGTGGGAAGAGCATGGGTTCTGG - Intergenic
984774932 4:183473417-183473439 CTTGGGAAGATAAAAAGTTCCGG - Intergenic
984876744 4:184375482-184375504 GTTAGGTAGATAATGGGTGAAGG - Intergenic
985324528 4:188753240-188753262 GGTGGGAAGATCGTGAGTTCAGG + Intergenic
985368049 4:189254559-189254581 ATTGGGAAGAGAATGGGCTGAGG - Intergenic
987097580 5:14563605-14563627 GCTGGGATGATAAAGGGTTATGG + Intergenic
988954216 5:36298069-36298091 GGTGGGAAGATCATGAGGTCAGG + Intronic
989180291 5:38569586-38569608 GTTGTGGAGATGATGGTTTCAGG - Intronic
990613894 5:57487579-57487601 GTTGGGCAGAGATTGGGCTCAGG - Intergenic
992763124 5:79969428-79969450 GGTAGGAAGAGAATGGATTCTGG - Intergenic
993137200 5:83984278-83984300 ATAGGGAATATAAGGGGTTCTGG + Intronic
993509774 5:88757208-88757230 TTTGGGAAAATAGTGGGTTTTGG - Intronic
995069441 5:107901806-107901828 GTTGGGGAGATAATGGGGAAAGG + Intronic
995380158 5:111522940-111522962 GGTGGGAAGATCATGAGGTCAGG - Intergenic
996606811 5:125332633-125332655 GTTGCAAAGCTAATGGGTTGAGG + Intergenic
998088745 5:139348584-139348606 GGTGGGCAGATCATGGGGTCAGG - Intronic
998274015 5:140734697-140734719 GTTGGGAATATTATGTATTCTGG + Intergenic
999213859 5:149915236-149915258 GGTGGGCAGATCATGGGGTCAGG - Intronic
999806392 5:155085423-155085445 GGTGGGAGGATAAAGGGTTCAGG - Intergenic
999836949 5:155383938-155383960 GTTGGGATGCAGATGGGTTCTGG - Intergenic
1000716509 5:164651219-164651241 GGTGGGAGGATCATGGGGTCAGG - Intergenic
1001687077 5:173601704-173601726 ATTGGGAAGATAAAAAGTTCTGG + Intergenic
1001978296 5:176019052-176019074 GGTGGGCAGATCATGGGGTCAGG + Intronic
1002239121 5:177824710-177824732 GGTGGGCAGATCATGGGGTCAGG - Intergenic
1003162539 6:3648623-3648645 GGTGGGCAGATCATGGGGTCAGG - Intergenic
1003359309 6:5409219-5409241 GTTGGGTAGATCATGAGGTCAGG + Intronic
1003376042 6:5578578-5578600 GTTGGGCAGATCATGAGGTCAGG + Intronic
1004347367 6:14861368-14861390 GCTGGGAAGAGAATGGGGACAGG - Intergenic
1005922540 6:30415186-30415208 GGTGGGAAGATGAGGGGTTCAGG + Intergenic
1006059707 6:31411019-31411041 GGTGGAAAGGTGATGGGTTCGGG + Intronic
1006072195 6:31506090-31506112 GGTGGAAAGGTGATGGGTTCGGG + Intronic
1006929520 6:37679363-37679385 CTTGGGAGGAAAATGGGGTCTGG + Intronic
1007625287 6:43243215-43243237 GTGGGGAAGATAAAGGGTGATGG + Intergenic
1007934832 6:45723557-45723579 GGTGGGCAGATCATGGGGTCAGG + Intergenic
1007955487 6:45914300-45914322 GTGGGGAAGACAAGGGGTCCCGG - Exonic
1009767534 6:68100443-68100465 GTTTTGAAAATAATGTGTTCAGG - Intergenic
1010485004 6:76400284-76400306 GTAGGCAAGAAAATAGGTTCTGG - Intergenic
1011670945 6:89682477-89682499 GGTGGGCAGATCATGGGGTCAGG + Intronic
1013469889 6:110453817-110453839 GCTGGGAAGATCAAGGGTACTGG + Intronic
1014206461 6:118661112-118661134 GGTGGGCAGATAATGAGGTCAGG - Intronic
1014281938 6:119451026-119451048 GGTGAGGAGATAATGGGGTCGGG - Intergenic
1015143541 6:129960396-129960418 GGTGGGCAGATCATGAGTTCAGG - Intergenic
1017206732 6:151809993-151810015 ATAGGGAAGAAAATGGTTTCTGG - Intronic
1017442255 6:154475186-154475208 AGTGGGAAGACAATGGGTTCTGG - Intronic
1017464252 6:154679725-154679747 GGTGGGAAGATCATGAGGTCAGG + Intergenic
1018130364 6:160724985-160725007 GTCGGGCAGATCATGGGGTCAGG + Intronic
1021975010 7:26003507-26003529 TTTGGGAAGATAAAAAGTTCTGG + Intergenic
1022868617 7:34450836-34450858 GTTGGGCAGATCATGCGGTCAGG + Intergenic
1022925283 7:35050568-35050590 ATTGGGCAGATCATGGGGTCAGG - Intergenic
1023780503 7:43650950-43650972 GGTGGGCAGGAAATGGGTTCAGG + Intronic
1023985899 7:45095756-45095778 GTTGGGCAGATCATGAGGTCAGG - Intergenic
1025220151 7:57101120-57101142 GTTGGGCAGATCATGAGGTCAGG - Intergenic
1025651532 7:63473915-63473937 GTTGGGCAGATCATGAGGTCAGG + Intergenic
1027055671 7:75047872-75047894 GATGGGCAGATCATGGGGTCAGG - Intronic
1028144960 7:87311159-87311181 GTTGGAATGAGAATGGATTCAGG - Intergenic
1029223234 7:99006797-99006819 TTTGTGAAGATACTAGGTTCAGG - Intronic
1029823302 7:103165268-103165290 GTTGGGCAGATCATGAGGTCAGG - Intergenic
1030118363 7:106081430-106081452 GTTGGGCAGATGATGAGGTCAGG - Intergenic
1030689873 7:112521200-112521222 GTTGGGCAGATCATGAGGTCAGG + Intergenic
1032131497 7:129232562-129232584 ATTGGGAAGATAATGGATGGCGG - Intronic
1032458096 7:132088578-132088600 GAGGGGAAGAAAATGGGTCCCGG - Intergenic
1032646090 7:133825555-133825577 GCTGGGGAGATAATAGGTTTGGG - Intronic
1032759236 7:134923266-134923288 GGTGGGAAGTTCATGGATTCTGG + Intronic
1033609362 7:142951176-142951198 GTGGAAAAGATAATGGCTTCAGG + Intronic
1033715609 7:143998728-143998750 ATTGGGAAGAAAATAGGTTGGGG + Intergenic
1035952831 8:4042896-4042918 GGTGGGAAGATTATGAGTTCAGG + Intronic
1036394832 8:8360777-8360799 CTTGGAAAGATTTTGGGTTCAGG + Intronic
1038437537 8:27546521-27546543 GTTAGGAAAATAATGTGATCTGG - Intergenic
1039241394 8:35560771-35560793 GTTGGGAAAATACTGTGTTTGGG + Intronic
1039294560 8:36135800-36135822 TTTGGGAAGATAAAAGGTTCTGG + Intergenic
1042303127 8:67307514-67307536 GTTAGGAAGAAAAGGGGTTTTGG + Intronic
1043375704 8:79647115-79647137 ATTGGGAAGGAAATGGGTCCAGG - Intronic
1046682304 8:117183985-117184007 GTAGGCAACATAATGGGTTGTGG - Intergenic
1047742243 8:127815894-127815916 GGTGGGCAGATAATGAGTTCAGG + Intergenic
1049826557 8:144672507-144672529 GTTGGCCAGACAAGGGGTTCTGG + Intergenic
1050547577 9:6721815-6721837 GGTGGGCAGATAATGAGGTCAGG - Intronic
1052928518 9:34038219-34038241 GGTGGGAAGATCATGAGGTCAGG + Intronic
1055907912 9:81315185-81315207 GTAGGAAAGATAATGGGCTAAGG - Intergenic
1059133759 9:111783254-111783276 GTTGAGAAGATAATGGGAAGTGG - Intronic
1062381242 9:136287849-136287871 TTTGGGAAGATGAAGAGTTCTGG + Intronic
1186031088 X:5369665-5369687 GGTGGGAGGATCATGAGTTCAGG - Intergenic
1186232149 X:7466936-7466958 ATTGAGAAGGTATTGGGTTCTGG + Intergenic
1186472002 X:9828987-9829009 GTTGGGAAGGTAATGCTTCCTGG + Intronic
1187297388 X:18015086-18015108 TTTGGGAAGGTAATACGTTCCGG + Intergenic
1189654984 X:43235588-43235610 GCTGGGAAGCTAACAGGTTCTGG + Intergenic
1190275198 X:48894865-48894887 GAGGGGAAGAAAGTGGGTTCTGG - Intronic
1190300205 X:49053078-49053100 GTTTGGAGGGTAATGGTTTCAGG + Intergenic
1190623359 X:52311259-52311281 GTTGAGAAGATAATGGGAACAGG - Intergenic
1191061663 X:56304455-56304477 GGTGGGCAGATCATGAGTTCGGG + Intergenic
1191257957 X:58287920-58287942 GTTGGGAAGGCAATGGCTTCTGG - Intergenic
1191739903 X:64425495-64425517 CTGGGGAAGATAAGGGGTTATGG + Intergenic
1193124715 X:77858978-77859000 GGTGGGCAGATAATGAGGTCAGG + Intronic
1193134436 X:77954369-77954391 GGTGGGCAGATAATGAGGTCAGG - Intronic
1194282278 X:91967510-91967532 GGTGGGTGGATAATGGTTTCAGG - Intronic
1195464592 X:105166383-105166405 GTTGGGAAGTTAATTGCTTTTGG - Intronic
1196660024 X:118259886-118259908 GTTGGGGAGATAATGAGTTTAGG - Intergenic
1197193668 X:123676788-123676810 CTTTGGAAGAGAAAGGGTTCAGG - Intronic
1198866753 X:141131252-141131274 GGTGGGAAGATCATGAGGTCAGG - Intergenic
1199066089 X:143420106-143420128 GTTTGGAAGATGATGGGTAATGG - Intergenic
1200599867 Y:5192161-5192183 GGTGGGTGGATAATGGTTTCAGG - Intronic
1202116312 Y:21471708-21471730 GGTGGGCAGATCATGGGCTCAGG - Intergenic