ID: 1104040526

View in Genome Browser
Species Human (GRCh38)
Location 12:125127248-125127270
Sequence CAGAGTGAGCAGCAGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 789
Summary {0: 1, 1: 0, 2: 8, 3: 89, 4: 691}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104040518_1104040526 16 Left 1104040518 12:125127209-125127231 CCTCGGCCTGAGGTGGGGGGTCT 0: 1
1: 1
2: 2
3: 10
4: 179
Right 1104040526 12:125127248-125127270 CAGAGTGAGCAGCAGGAAGGAGG 0: 1
1: 0
2: 8
3: 89
4: 691
1104040510_1104040526 28 Left 1104040510 12:125127197-125127219 CCACCGTTGGTTCCTCGGCCTGA 0: 1
1: 0
2: 1
3: 3
4: 46
Right 1104040526 12:125127248-125127270 CAGAGTGAGCAGCAGGAAGGAGG 0: 1
1: 0
2: 8
3: 89
4: 691
1104040509_1104040526 29 Left 1104040509 12:125127196-125127218 CCCACCGTTGGTTCCTCGGCCTG 0: 1
1: 0
2: 1
3: 3
4: 61
Right 1104040526 12:125127248-125127270 CAGAGTGAGCAGCAGGAAGGAGG 0: 1
1: 0
2: 8
3: 89
4: 691
1104040508_1104040526 30 Left 1104040508 12:125127195-125127217 CCCCACCGTTGGTTCCTCGGCCT 0: 1
1: 0
2: 1
3: 2
4: 66
Right 1104040526 12:125127248-125127270 CAGAGTGAGCAGCAGGAAGGAGG 0: 1
1: 0
2: 8
3: 89
4: 691
1104040519_1104040526 10 Left 1104040519 12:125127215-125127237 CCTGAGGTGGGGGGTCTGAGCCA 0: 2
1: 0
2: 2
3: 25
4: 536
Right 1104040526 12:125127248-125127270 CAGAGTGAGCAGCAGGAAGGAGG 0: 1
1: 0
2: 8
3: 89
4: 691
1104040512_1104040526 25 Left 1104040512 12:125127200-125127222 CCGTTGGTTCCTCGGCCTGAGGT 0: 1
1: 0
2: 0
3: 5
4: 106
Right 1104040526 12:125127248-125127270 CAGAGTGAGCAGCAGGAAGGAGG 0: 1
1: 0
2: 8
3: 89
4: 691
1104040520_1104040526 -10 Left 1104040520 12:125127235-125127257 CCATTCCCACCAGCAGAGTGAGC 0: 1
1: 0
2: 1
3: 26
4: 250
Right 1104040526 12:125127248-125127270 CAGAGTGAGCAGCAGGAAGGAGG 0: 1
1: 0
2: 8
3: 89
4: 691

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104040526 Original CRISPR CAGAGTGAGCAGCAGGAAGG AGG Intronic
900974945 1:6011158-6011180 CTGAGGGAGCAGCAGGAGTGAGG + Intronic
901395921 1:8981449-8981471 CTGAGAAAGCAGGAGGAAGGAGG - Intergenic
902410337 1:16208274-16208296 CAGGGGCAGCAGCAGGGAGGAGG - Intronic
902654818 1:17859934-17859956 CAGAGGGAGGAGCAGGGAGGTGG + Intergenic
902688281 1:18093250-18093272 CAGATTGAGCTGTAGGAAAGAGG - Intergenic
903187026 1:21634565-21634587 CAGAGGGATGGGCAGGAAGGTGG + Intronic
904045065 1:27603776-27603798 CAGAGAGAGCGGGAGGGAGGAGG - Intronic
904045102 1:27603962-27603984 CGGAGAGAGCAGAAGGCAGGAGG - Intronic
904998625 1:34650765-34650787 CTGAGGAAGCAGCAGGAAGGAGG + Intergenic
905033457 1:34902674-34902696 TACAGAGAGCAGCAGGCAGGTGG + Intronic
905490646 1:38340872-38340894 CAGAATGAGCACCAGGAAAGAGG + Intergenic
905506201 1:38481492-38481514 CAGAGTGGGATGAAGGAAGGTGG - Intergenic
905656677 1:39690432-39690454 CCCACGGAGCAGCAGGAAGGTGG + Intronic
905872901 1:41415254-41415276 CACAGGGAGAAGCAGGAAGGTGG - Intergenic
905885262 1:41488389-41488411 CAGAGCGAGCAGCTGGGAAGAGG + Intergenic
905890707 1:41516750-41516772 CAGAGGGAGCAGCAGGTGTGGGG - Intronic
906034085 1:42740159-42740181 CAGGGGGAGCAGCGAGAAGGAGG + Exonic
906105682 1:43290737-43290759 CTGAGTGAACAGCAGGAAGGGGG + Intergenic
906687563 1:47772324-47772346 CAGAGAGAGGAGCAGGACGAAGG + Intronic
908569231 1:65391438-65391460 CAAAATGAGCAGCAGGAAAGAGG - Intronic
909086446 1:71174277-71174299 CAGGGTGGGGAGCTGGAAGGAGG + Intergenic
909493209 1:76248105-76248127 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
910065513 1:83145940-83145962 TGGAGTGAGCAACAGGAAGAAGG + Intergenic
910541073 1:88357860-88357882 CAGAGTGGGGAGTAGGGAGGGGG + Intergenic
910626852 1:89316477-89316499 GAGGGTGAGCAGAAGCAAGGTGG + Intergenic
910721429 1:90290569-90290591 CGGGGAGAGCAGCAGGGAGGAGG + Intergenic
910849288 1:91635263-91635285 AACAGTGAGGAGCAGAAAGGTGG - Intergenic
911133847 1:94418531-94418553 CAGGCAGAGCAGCAGGAACGCGG - Exonic
911829262 1:102530111-102530133 CAGGGAGGGCAGCAGGATGGAGG - Intergenic
912032461 1:105265677-105265699 GAGGGTGAGCTGAAGGAAGGTGG - Intergenic
912614450 1:111084124-111084146 GAGAGAGAGAAGCATGAAGGGGG - Intergenic
912763183 1:112386631-112386653 CAGAGTGGGCACCAGGAGTGGGG - Intergenic
912823820 1:112887711-112887733 CAGCCAAAGCAGCAGGAAGGCGG - Intergenic
912957735 1:114167304-114167326 CCAACTGAGCAGCAGGAACGAGG + Intergenic
913436380 1:118851633-118851655 CTGAGAGAGCACCAGGAAGCAGG + Intergenic
915144716 1:153789667-153789689 CAGAGCGAGCTCCAGGAGGGCGG - Intergenic
915598094 1:156906634-156906656 CAGAGTGTGCCCCAGGAATGTGG + Exonic
917219752 1:172716347-172716369 CAGAGTGAGCCCCTGGAGGGGGG + Intergenic
917422221 1:174876008-174876030 AAGAGCGAGCACAAGGAAGGAGG - Intronic
917484959 1:175447383-175447405 GAGGGTGGGCAGCGGGAAGGAGG + Intronic
917762249 1:178174696-178174718 CAGAGGCAGAAGCAGGAAGCAGG - Intronic
918122124 1:181549355-181549377 CAGAGTGAGAATGAGGAAGAAGG + Intronic
918241719 1:182626164-182626186 TAGAGGAATCAGCAGGAAGGTGG - Intergenic
919204340 1:194401676-194401698 CAGAGTGAGGAGAGGAAAGGAGG + Intergenic
919799569 1:201345347-201345369 AAGAGTCAGCTGCAGGAGGGAGG - Intergenic
920365757 1:205447631-205447653 CTGAGTGACAAGCAGGACGGGGG + Intronic
920947335 1:210542028-210542050 AAGAGAAAGCAGAAGGAAGGAGG - Intronic
921039589 1:211416840-211416862 CAGGGTCCCCAGCAGGAAGGTGG - Intergenic
922069880 1:222181522-222181544 ATGAATTAGCAGCAGGAAGGGGG + Intergenic
922277522 1:224092833-224092855 AAGAGTGAGAGGCAGCAAGGGGG - Intergenic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
922593321 1:226795413-226795435 GAGAGGGAGAGGCAGGAAGGAGG - Intergenic
923010304 1:230083163-230083185 CAGAGTGGGGAGCAGGATGATGG + Intronic
923468513 1:234269467-234269489 CACACTGGGCTGCAGGAAGGAGG - Intronic
923647427 1:235838177-235838199 GAGAGTGAGAAGTGGGAAGGAGG + Intronic
923790306 1:237106015-237106037 CAGAGTGTGCAGCAGGACTGGGG + Intronic
1062802747 10:392223-392245 CAGCTTCTGCAGCAGGAAGGCGG + Intronic
1063847330 10:10145222-10145244 CATGGGGAGCAGTAGGAAGGAGG - Intergenic
1063936963 10:11088260-11088282 CAGAGTGAACAGCATGAGTGAGG + Intronic
1064634028 10:17345529-17345551 CTGTTTGAGAAGCAGGAAGGAGG + Intronic
1064691968 10:17927567-17927589 CAGATTCACCAGCAGGAAGTGGG + Intergenic
1065326826 10:24556865-24556887 CAGAGGGAGCCGCGGGTAGGTGG - Intergenic
1065422292 10:25558622-25558644 CAGAGTAAGCGGCAGCCAGGTGG - Intronic
1065473128 10:26103449-26103471 CAGCGTGAGCAACAAGAAGATGG - Intronic
1065819547 10:29512797-29512819 CAGACTCAGCAGGAGGCAGGAGG - Exonic
1065953308 10:30671608-30671630 CAGACTCAGCAGGAGGCAGGAGG + Intergenic
1066523440 10:36248888-36248910 GAGAGAGGGCAGCAGGTAGGCGG + Intergenic
1067097072 10:43308554-43308576 CAGAATGGGCTGCAGGAAGAGGG - Intergenic
1067473544 10:46552199-46552221 CGGAGTGGGCAGGAGGAAAGAGG + Intronic
1067525187 10:47034225-47034247 CTGAGTGCGGAGCATGAAGGTGG + Intergenic
1067574567 10:47401175-47401197 CAGAGTAAGGAGCTTGAAGGGGG - Intergenic
1068117785 10:52752962-52752984 CAGAGTGAGGAGCAGTGAGCAGG - Intergenic
1068575076 10:58675980-58676002 GAGAGTGAGCAGAAGCAGGGTGG + Intronic
1069785844 10:70987513-70987535 CAGAGTGGGCAGTGGGTAGGAGG - Intergenic
1069800990 10:71081362-71081384 CAGTTAGAGCAGCAGGATGGAGG - Intergenic
1069917273 10:71795489-71795511 GAGAGTCAGCTGGAGGAAGGGGG - Intronic
1070161307 10:73868258-73868280 CAGAGGAAGCAGCAGGAAGAAGG + Intronic
1070602255 10:77873976-77873998 CAGTGTGAGCTGGAGGAGGGCGG - Intronic
1070707188 10:78648245-78648267 CACAGTTAGGAACAGGAAGGTGG - Intergenic
1070843649 10:79505200-79505222 CAGCGTGAGCAGGAGCATGGAGG - Intergenic
1070891316 10:79943892-79943914 CCAAGTCAGCAGCAGGAAGATGG + Intronic
1070930017 10:80254400-80254422 CAGCGTGAGCAGGAGCATGGAGG + Intergenic
1071339911 10:84636112-84636134 CAGAGTCATCAGCAGCAAGAAGG + Intergenic
1071417707 10:85456571-85456593 CAGAGTGAGTAGCAAGTATGAGG - Intergenic
1071532558 10:86400930-86400952 CAGAGAGAGCGCCTGGAAGGCGG + Intergenic
1072009370 10:91290241-91290263 CAGAGTGGGAAGCAGGAGGAGGG + Intergenic
1073096311 10:100982210-100982232 CAGAGGGAGCAGCAGGCAGAGGG + Intronic
1073542269 10:104323883-104323905 CACAGTAAAGAGCAGGAAGGTGG - Intronic
1073818847 10:107237056-107237078 CTGAGGGACCAGCAGGAAAGGGG + Intergenic
1074533580 10:114313112-114313134 GAGAGGGGGCAGCAGGAAGGAGG + Intronic
1074735146 10:116423399-116423421 CAGAGTGAGCAGGGGGAAATCGG + Intergenic
1074895159 10:117770957-117770979 CAGAGGGAGCAGCTGGGAGGTGG + Intergenic
1074977709 10:118594891-118594913 CAGCGTGAGCGGCACGCAGGCGG + Exonic
1075007306 10:118840246-118840268 TAAAGGAAGCAGCAGGAAGGCGG + Intergenic
1075228786 10:120653668-120653690 CAGACTCACCAGCAGCAAGGAGG + Intergenic
1075427604 10:122353954-122353976 GAGAGGGAGCAAGAGGAAGGAGG - Intergenic
1075696113 10:124436729-124436751 CAGAATGAGATGAAGGAAGGAGG - Intergenic
1076064589 10:127439409-127439431 CAGAGAGACCTGGAGGAAGGTGG + Intronic
1076097632 10:127744915-127744937 CAGGGAGTGCAGCAGGAAAGGGG - Intergenic
1076108139 10:127840796-127840818 CAGGATGAGCGGGAGGAAGGTGG + Intergenic
1076550158 10:131273030-131273052 CAGACAGAGCAGCAGGGAGTTGG + Intronic
1076564094 10:131386487-131386509 CAGAGGGAGGAGCAGGGAGAGGG + Intergenic
1076719307 10:132386311-132386333 CAGAGGCAGCAGCTGGAAGGCGG + Intergenic
1076775163 10:132691466-132691488 CAGCGTGTGCTGCAGGAAGCTGG + Intronic
1077249447 11:1554528-1554550 CAAAGTGAGCAGCCAGCAGGGGG - Exonic
1077364195 11:2154973-2154995 CAGCGTGAGCAGCCGCAAGCTGG + Intronic
1077408307 11:2392323-2392345 GAGAGTGGGGCGCAGGAAGGAGG - Intronic
1079099284 11:17530893-17530915 CAGCGGCAGCAGCTGGAAGGAGG + Intronic
1079410279 11:20181094-20181116 AAGAGGGAGGAGGAGGAAGGAGG - Intergenic
1080241584 11:30133334-30133356 CAGACTGAGCTGCAAAAAGGTGG - Intergenic
1081269284 11:41064767-41064789 CAGAGGGAGCAGAAGCAGGGTGG + Intronic
1081808509 11:45902657-45902679 CTCAGTGGGCGGCAGGAAGGCGG - Exonic
1081814211 11:45929573-45929595 CAGGGTGAGCTGCAGTCAGGCGG - Intronic
1083106730 11:60365466-60365488 CAGAGTCAGGGGCAGGAATGAGG - Intronic
1083181119 11:60986307-60986329 CAGTCTCACCAGCAGGAAGGTGG + Intronic
1083665751 11:64273578-64273600 CAGAGTGAGAAGCAGGTGGGGGG + Intronic
1083756057 11:64792232-64792254 CAGGGCGGCCAGCAGGAAGGTGG + Exonic
1083793285 11:64999735-64999757 CAGAGTGTGGAGCAGGACTGAGG - Intergenic
1084041539 11:66545809-66545831 CAGGTTGAGCAGCTGGAAGGCGG + Exonic
1084410483 11:69003632-69003654 CAGAGCCAGGAGCAGGCAGGCGG - Intergenic
1084477844 11:69398950-69398972 CACAGTGGGGACCAGGAAGGGGG + Intergenic
1084491258 11:69479856-69479878 CAGAGGAGGCGGCAGGAAGGTGG - Intergenic
1084732459 11:71082210-71082232 CAGCGTGAACAGCAGCCAGGTGG - Intronic
1084937368 11:72594317-72594339 CAGAGGGTGCAGAAGGAAGATGG - Intronic
1084960356 11:72713172-72713194 CAGAGTGATGACCAAGAAGGTGG - Exonic
1085390761 11:76180975-76180997 GAGTGGGAGCAGCAGGCAGGAGG - Intergenic
1085400146 11:76230930-76230952 CCAAGGTAGCAGCAGGAAGGGGG + Intergenic
1085717894 11:78889355-78889377 TGCAGTGAGGAGCAGGAAGGAGG - Intronic
1087026440 11:93654412-93654434 GAGAGAGAGAAGCACGAAGGAGG - Intergenic
1087241803 11:95789472-95789494 GAGACTGAGGAGCAGGATGGCGG - Exonic
1088598140 11:111455071-111455093 CAGAGGGAGCAGCAGCAGGTGGG + Exonic
1088755712 11:112883531-112883553 GAGAGAGAGCGGCAGGAAGTGGG + Intergenic
1088779946 11:113124209-113124231 TAGACTGAGAAGGAGGAAGGAGG + Intronic
1090201707 11:124862314-124862336 AAGAGAGAGTAGCAGGAAGCAGG - Intergenic
1090475838 11:127019135-127019157 CAGTGTTTTCAGCAGGAAGGAGG + Intergenic
1090799908 11:130163942-130163964 CAGAGTGAGGGTCAGGTAGGGGG - Intronic
1090961965 11:131565173-131565195 AAGGGTCAGCTGCAGGAAGGGGG - Intronic
1091058195 11:132438557-132438579 TAGGGTGGGCAGCAGGAAGGTGG + Intronic
1091058226 11:132438706-132438728 TAGGGTGTGCAGCAGGAAGGTGG + Intronic
1091173708 11:133541428-133541450 CAAAGTGAAGAGCAGGAATGCGG + Intergenic
1091404437 12:200486-200508 CAGGGGGAGCCACAGGAAGGCGG - Intronic
1091696204 12:2629972-2629994 CAGAGTGGGGAGTTGGAAGGGGG + Intronic
1091754685 12:3043741-3043763 CAGAGTGAACAGGAGAGAGGAGG + Intergenic
1091883171 12:3996407-3996429 CTGAGAGAGAAGAAGGAAGGAGG - Intergenic
1092765601 12:11850201-11850223 CCGAGTGTGCAGGAGGAAGCAGG - Intronic
1092926337 12:13275710-13275732 CACAGTGAAAGGCAGGAAGGGGG + Intergenic
1093406258 12:18808550-18808572 CAGAGTGATCAGCAGGAAAATGG + Intergenic
1093496526 12:19763777-19763799 CATAGTGTGCACCAGTAAGGTGG - Intergenic
1093608165 12:21119737-21119759 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
1093680119 12:21992929-21992951 CATCTTAAGCAGCAGGAAGGAGG + Intergenic
1093780142 12:23126058-23126080 CAGAGTCAACAGGAGGAATGTGG - Intergenic
1094372748 12:29755813-29755835 CAAACTGAGCAGCAAGAAGAAGG + Exonic
1094441757 12:30485616-30485638 CAGAGGGAGCAGCAGGAAATGGG - Intergenic
1095595218 12:43950995-43951017 GAGAGTGAGCAGAAGCAGGGTGG + Intronic
1095655338 12:44661938-44661960 GAGAGAGAGGAGCAGGAGGGAGG - Intronic
1095705729 12:45235175-45235197 CAGAGTCTGCTACAGGAAGGAGG - Intronic
1095810984 12:46372911-46372933 CAGAGGGAGGGGCAGGGAGGCGG - Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097269502 12:57765515-57765537 GAGAGTGCGCATCGGGAAGGTGG + Intronic
1097654516 12:62343692-62343714 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
1097856529 12:64469365-64469387 CGGAGAAAGGAGCAGGAAGGGGG - Intronic
1098460769 12:70730842-70730864 GAGAGAGAGCAGAAGGAAGGAGG + Intronic
1098467080 12:70799856-70799878 CAGAGAGAGCAGCAGCAGGTAGG + Intronic
1098558955 12:71851170-71851192 CACATAGAGCAGGAGGAAGGGGG + Intronic
1099135172 12:78888794-78888816 GACAGTGAGCAGGAGGAAGGAGG - Intronic
1099413347 12:82358810-82358832 CAGAGTGGGAAGCAGGTGGGTGG + Exonic
1100125166 12:91415994-91416016 CTGAGTGAGCAGCACATAGGAGG - Intergenic
1100329809 12:93572102-93572124 CAGAGCGGGCACCAGGAAGCGGG + Exonic
1100823861 12:98456867-98456889 CAGCGTGAGCAGCAGGATGAAGG + Intergenic
1101412045 12:104477639-104477661 CACAGTGAGAACCAGGAAGTGGG + Intronic
1101793438 12:107951532-107951554 CAGAGTTTGAAGCAGGAAAGAGG - Intergenic
1102073627 12:110042709-110042731 CAGGGTGGGCAGCAAGAAGGGGG + Intronic
1102230370 12:111257646-111257668 AAGAGGGAGGAGGAGGAAGGAGG - Intronic
1103809633 12:123603028-123603050 TAGTTTGAGCAGCAGAAAGGAGG + Intronic
1103916194 12:124376832-124376854 CAGACGGGGCAGGAGGAAGGAGG + Intronic
1104040526 12:125127248-125127270 CAGAGTGAGCAGCAGGAAGGAGG + Intronic
1104276828 12:127336728-127336750 CAGGGAGAGCAACAGGAAGGTGG + Intergenic
1104512159 12:129390692-129390714 CAGAGTCACCAGCAAGAAGAAGG - Intronic
1104703002 12:130921440-130921462 AAGTGGGAGCAGAAGGAAGGGGG + Intergenic
1104770141 12:131356380-131356402 CAGAGTGAGCTGCAGGCATGGGG + Intergenic
1104958955 12:132479118-132479140 CAGAGTGGGCCGCAGGAGGCCGG + Intergenic
1105016978 12:132792231-132792253 CACAGTGAGTGGCAGGGAGGTGG + Intronic
1105771606 13:23617357-23617379 CAGGGGGAGCACCAGGGAGGAGG + Intronic
1106084406 13:26527316-26527338 CAGCGTGGGCACCAGCAAGGAGG - Intergenic
1106101530 13:26697778-26697800 AGGAGTGAGCTGCATGAAGGTGG + Intergenic
1106378893 13:29216655-29216677 CAGGGTGAGCAGAAGCAGGGTGG - Intronic
1106533557 13:30617866-30617888 CCCAGCGTGCAGCAGGAAGGAGG + Exonic
1106636430 13:31533578-31533600 CAGAGGGCACAGCAAGAAGGTGG - Intergenic
1108141650 13:47428922-47428944 CAGGCTGAAGAGCAGGAAGGAGG + Intergenic
1108173291 13:47766415-47766437 CAGAGGGTGCAGCAAGATGGAGG + Intergenic
1108953490 13:56120075-56120097 CACAGTGGGTAGTAGGAAGGTGG - Intergenic
1109173986 13:59132621-59132643 CAGATTGCAAAGCAGGAAGGTGG - Intergenic
1109555988 13:63976340-63976362 CAGATTCTGCAGCAGGAAAGGGG - Intergenic
1109621701 13:64916804-64916826 AAGAGTGAGGAGGAGGAAGGAGG - Intergenic
1110195665 13:72785119-72785141 CAATGTGAGTAGCAGGAAGTTGG - Intronic
1110593490 13:77292257-77292279 CAGAGCAAGCAGCAGGAAAAAGG - Intronic
1111057520 13:82971057-82971079 CAGAATGAGCAGTAGAAAAGGGG - Intergenic
1111320020 13:86614871-86614893 GAGAGAGAGCAGGAGGCAGGTGG - Intergenic
1112004341 13:95241514-95241536 CAGGGGGGGCAGGAGGAAGGAGG - Intronic
1112248135 13:97753242-97753264 CAGAGAGAGTTGCAGGAAAGAGG - Intergenic
1113149985 13:107252477-107252499 GAGAGAGAGGAGAAGGAAGGAGG + Intronic
1114482426 14:23044098-23044120 CAGAGGGAGCATCAGGAAGGAGG - Exonic
1115094538 14:29618967-29618989 GAGAATGAGGAGGAGGAAGGGGG + Intronic
1115175706 14:30559309-30559331 CAGAGAGAGAAGCAGGACCGTGG + Intronic
1115912249 14:38269255-38269277 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
1115977128 14:39009040-39009062 AACAATGAGCAGCAAGAAGGTGG + Intergenic
1117105523 14:52394061-52394083 GGGAGTGAGAGGCAGGAAGGGGG + Intergenic
1117172312 14:53113581-53113603 GAGAGTGAGCAGAAGCATGGTGG + Intronic
1117244432 14:53870166-53870188 CAGAGGAAGCAGGAGGAAGTGGG + Intergenic
1117248738 14:53913954-53913976 CAGAGTGGGGAGCAGGAAGGTGG - Intergenic
1119894380 14:78207311-78207333 TAGAGTGCGCAGGAAGAAGGTGG - Intergenic
1120673985 14:87397479-87397501 CAGAATTAGAAGGAGGAAGGGGG - Intergenic
1120905213 14:89614497-89614519 CATAGTGAGCAGGAAAAAGGTGG - Intronic
1121084944 14:91138648-91138670 GAGAGTGAGCAAGAGGGAGGGGG + Intronic
1121121380 14:91377845-91377867 CAGTGCGTGCAGCAGGAAGGAGG + Intronic
1121697945 14:95928286-95928308 GAGAGGGAGAAGCAGGGAGGGGG - Intergenic
1122477432 14:102020518-102020540 CAGACTGAGAAACAGGAAGAGGG - Intronic
1122941020 14:104981418-104981440 CAGAGTGGGCAGGAGAAGGGAGG - Intergenic
1123885888 15:24728086-24728108 TAAAGAAAGCAGCAGGAAGGTGG - Intergenic
1124801451 15:32837039-32837061 CAGAGTGAGAAGGATGAAGATGG - Intronic
1127620020 15:60724894-60724916 CAGTGTGAGGAGCGGGGAGGAGG - Intronic
1127730518 15:61797692-61797714 CACAGAGAGAAGCATGAAGGAGG + Intergenic
1128244940 15:66126674-66126696 CAGAGACAGTAGCAGGAAGCAGG + Intronic
1128765557 15:70248975-70248997 CACAGTGAGAGGGAGGAAGGTGG + Intergenic
1129183475 15:73891659-73891681 CAGAGTGGGCACCAGGAGTGGGG - Intergenic
1129234229 15:74214158-74214180 CATTGTGGGAAGCAGGAAGGGGG + Intergenic
1129281731 15:74490300-74490322 CAGGGTGAGCAGCCGGAAGAGGG - Intergenic
1129391963 15:75225174-75225196 CAGAGGGAGCAGCAGCATGAGGG + Intergenic
1129472413 15:75762988-75763010 CAGAGGGAGCAGCAGCATGAGGG - Intergenic
1129746497 15:78025336-78025358 CAGCGTCAGCATCAGGAAGCCGG - Exonic
1129867998 15:78923698-78923720 CAGAAGGTGCAGCAGGAAGGTGG - Intronic
1129887003 15:79045556-79045578 AAGAGAGAGAAGCAGGCAGGAGG - Intronic
1131379253 15:91950170-91950192 CAGAGGAAGCAGCTGGAATGAGG + Intronic
1132322063 15:100932834-100932856 CAGAGGGAGCAGCAGATAGATGG - Intronic
1132478557 16:154279-154301 CAGGGTGACCAGCAGGCAGTGGG - Exonic
1132480735 16:165035-165057 CAGGGTGACCAGCAGGCAGTGGG - Intronic
1132751584 16:1460142-1460164 CAGAGTGAGGAGATGGAAGGAGG + Intronic
1132753238 16:1468732-1468754 CCGCGTAAGCACCAGGAAGGGGG - Intronic
1132844087 16:1992122-1992144 CACATCGAGCAGCAGGAAGGCGG - Exonic
1134449395 16:14354215-14354237 TAGAGGGAGGAGGAGGAAGGGGG + Intergenic
1134461716 16:14435216-14435238 AAGGGAGAGGAGCAGGAAGGGGG + Intergenic
1135208172 16:20499885-20499907 CAAAGTGAGCACCAGGAGTGGGG - Intergenic
1135210727 16:20523815-20523837 CAAAGTGAGCACCAGGAGTGGGG + Intergenic
1135934963 16:26771757-26771779 CAGAGCAAGGAGCAGGATGGAGG - Intergenic
1136067162 16:27766998-27767020 CTGAGTGAGAAGCAGCAGGGGGG + Intronic
1136080987 16:27852530-27852552 CAGAGGGAGGAGGAGGAGGGTGG + Intronic
1136294321 16:29293052-29293074 CAGTGTGAGCCGCAGGGAGAAGG - Intergenic
1137462788 16:48680529-48680551 CATTGGGAGCAGAAGGAAGGTGG - Intergenic
1138352145 16:56351822-56351844 GAGGGTGACCAGGAGGAAGGGGG - Intronic
1138455414 16:57117894-57117916 CAGAGTGAGGTGCGGGGAGGAGG - Intronic
1138539322 16:57679000-57679022 CACTGGGAGCAGCAGGGAGGAGG + Intronic
1138596445 16:58031655-58031677 CAGCAGGAGAAGCAGGAAGGAGG - Intronic
1138799673 16:60012812-60012834 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
1139055100 16:63173846-63173868 AAGAGTGAGAAGCAGGAGGAGGG - Intergenic
1141293937 16:82749177-82749199 GAGAGAGAGAAGGAGGAAGGTGG + Intronic
1141427141 16:83951884-83951906 CAGGGAGAGAAGGAGGAAGGAGG - Intronic
1141602758 16:85136509-85136531 CAGAGATGGCCGCAGGAAGGGGG - Intergenic
1141753979 16:85979080-85979102 CAGAGCGAGCAGCAGACTGGAGG + Intergenic
1141812255 16:86383394-86383416 CAGATGGAGTCGCAGGAAGGTGG - Intergenic
1142100227 16:88267099-88267121 CAGTGTGAGCCGCAGGGAGAAGG - Intergenic
1142181759 16:88674636-88674658 CAGCTTGAGCACCAGGAAGGAGG - Intergenic
1142304706 16:89278761-89278783 GAGAGTGAGCGGCGTGAAGGGGG + Intronic
1142351520 16:89582963-89582985 CTCAGTGAGGAGCAGGACGGGGG - Intronic
1142501412 17:335262-335284 CAGGGTGAACAGTGGGAAGGAGG + Intronic
1142578000 17:921955-921977 CAGAGGGAGAAGCAGGTTGGAGG - Intronic
1143796319 17:9339676-9339698 CAGAGTACACAGCAGGAATGAGG - Intronic
1144137756 17:12314618-12314640 CAGTGGCAGCAGCAGGAGGGTGG + Intergenic
1144266417 17:13573859-13573881 CAGAGAGAGCAGAGAGAAGGAGG - Intronic
1144634249 17:16893972-16893994 CAGCGCCAGCAGCAGGAGGGCGG - Intergenic
1145168363 17:20633867-20633889 CAGCGCCAGCAGCAGGAGGGCGG - Intergenic
1145315807 17:21732807-21732829 CACAGAGAGCAGTAGGCAGGGGG + Intergenic
1145758053 17:27407264-27407286 CAGAGTGAGCTCCACGCAGGTGG - Intergenic
1145826363 17:27879993-27880015 GAGAGGGGGCAGCAGGAAGAAGG - Intronic
1146058313 17:29591943-29591965 CAGGGTGTGGAGGAGGAAGGAGG + Intronic
1148020198 17:44548274-44548296 CAGAGTGAGAAGATGGGAGGGGG + Intergenic
1148051020 17:44769953-44769975 CAGAGGGGGCAGCAGGAAGGGGG - Intronic
1148690907 17:49526364-49526386 CTGAGTGGGCAGGAGGGAGGTGG - Intergenic
1148758703 17:49988084-49988106 CAGAGAGAGAGGAAGGAAGGAGG - Intergenic
1148913222 17:50954449-50954471 CAGAGGAAGCAGCAGGAACTGGG + Intergenic
1149386862 17:56151002-56151024 CAGAGTGAGAGGCAGGATGGAGG + Intronic
1149400419 17:56290171-56290193 CATATTGAGCAGGAGGAAGAAGG - Intronic
1149544315 17:57491805-57491827 TTGAATGAACAGCAGGAAGGAGG - Intronic
1150267068 17:63838542-63838564 CAGGCTGAGCAGCAGGAAAGTGG + Intronic
1150551087 17:66210905-66210927 AAGGGTGAGGAGAAGGAAGGTGG + Intergenic
1150674925 17:67236865-67236887 CAAAGTGAGCAGTAGAAGGGAGG - Intronic
1150772027 17:68050365-68050387 CAGAAAGAGAAGAAGGAAGGAGG - Intergenic
1151384022 17:73744256-73744278 CAGAGTGAAAGGCAGGAAGAGGG - Intergenic
1151563965 17:74886847-74886869 CAAACTAAGGAGCAGGAAGGTGG - Intronic
1151580210 17:74973091-74973113 CAGACTGAGAAGGAGGAAAGTGG - Intronic
1151888738 17:76939665-76939687 CAGAGTGGGGAGGAGGAAGGGGG - Intronic
1152103114 17:78314271-78314293 CAGGGTGAGCGGGAGGAGGGAGG + Intergenic
1152630320 17:81408080-81408102 CAGGGGCAGCAGGAGGAAGGGGG - Intronic
1152723436 17:81933957-81933979 CAGCGAGGGCAGGAGGAAGGTGG + Intronic
1153541635 18:6161761-6161783 CAGAGTGAGCAGAATGCAGTGGG - Intronic
1153778982 18:8477950-8477972 CAGTGGAAGCAGCAGGAAGGTGG + Intergenic
1153813319 18:8771008-8771030 ATGAGTGAACAGGAGGAAGGGGG + Intronic
1153979593 18:10297666-10297688 GAGGGGGAGAAGCAGGAAGGAGG - Intergenic
1153985003 18:10343846-10343868 CAGAGTGCCCAGGAGGAAGCTGG - Intergenic
1155400628 18:25435187-25435209 GAGAGGGACCACCAGGAAGGGGG + Intergenic
1155517383 18:26637211-26637233 TAGAGTCAGGAGGAGGAAGGAGG - Intronic
1156625332 18:38901404-38901426 AAGGGTGAGCCTCAGGAAGGTGG + Intergenic
1157009987 18:43635634-43635656 CAGAGTGAGAGGCAGGTAGGCGG + Intergenic
1157183626 18:45519624-45519646 CAGAGTAAGCACGAAGAAGGAGG + Intronic
1157190915 18:45580945-45580967 CAGGCTGAGCAGGAGGCAGGAGG + Intronic
1157394701 18:47331857-47331879 CAGACTCAGAAGCTGGAAGGAGG - Intergenic
1158610508 18:58935491-58935513 GAGAGGGAGGAGGAGGAAGGGGG - Intronic
1159581237 18:70236565-70236587 GAGGGTGAGCAGAAGCAAGGTGG + Intergenic
1160536658 18:79598054-79598076 CAGGGTGGGCACCAGGTAGGAGG + Intergenic
1160705512 19:528227-528249 CAGCCTGAGCAACAGGAACGGGG + Intergenic
1160775219 19:852410-852432 CAGAGGGAGCAGCGGGAGGTTGG - Intronic
1161053322 19:2176916-2176938 GACAGTGAGCAGGAGGAAAGGGG + Intronic
1161235081 19:3193644-3193666 CAGAGCCAGCAGCTGGGAGGGGG - Intronic
1161286451 19:3471004-3471026 CAGAGTGAGGAGAGGGATGGAGG + Intergenic
1161585272 19:5102341-5102363 CAGAGGCAACTGCAGGAAGGAGG - Intronic
1161630806 19:5354508-5354530 CAGAGTGAGGAGTGGGAAAGAGG + Intergenic
1161756428 19:6137456-6137478 CAGAGTGAGGAGGGGGAGGGAGG + Intronic
1162217726 19:9150163-9150185 CAGAGTGAGTGGCAGCCAGGTGG - Intronic
1162502076 19:11059837-11059859 GAGAGTGAGGAGGAGGAAGAGGG + Exonic
1162869319 19:13573516-13573538 CAGATGGAGCAGCAAGAACGGGG + Intronic
1162934393 19:13974187-13974209 CAGTGAGTGAAGCAGGAAGGGGG + Intronic
1163222131 19:15929333-15929355 CTGAGAGAGAAGCAGGAAGAGGG + Intronic
1163326302 19:16605575-16605597 CAGAGAGAGCAGCAGGAAAGGGG + Intronic
1163580343 19:18135059-18135081 CAGGGAGAGAAGCAGGAAGAGGG + Intronic
1163779639 19:19239663-19239685 CAGGATGAGGAGCAGAAAGGAGG - Intronic
1163786759 19:19278822-19278844 AAGAGGGAGAAGCAGGAAGGAGG + Intronic
1163811177 19:19432767-19432789 CAGAGTGAGCAGGCTGAAGTGGG + Intronic
1163831309 19:19548360-19548382 CAGAGTTATCAGCAGGGATGGGG - Intergenic
1163902542 19:20117452-20117474 CAGAGCCAGAAGAAGGAAGGAGG - Intronic
1163989799 19:20988043-20988065 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
1164292879 19:23883166-23883188 AAGAGTGACCCGCAGGAATGGGG + Intergenic
1164512005 19:28905078-28905100 CTGAGTGAGGAGCAGGGAGCTGG - Intergenic
1164609289 19:29621282-29621304 CACAGGGTGCAGCGGGAAGGTGG - Intergenic
1164773805 19:30834739-30834761 CAGAGTGAGGGGCAGGAACTGGG - Intergenic
1164913087 19:32027906-32027928 CAGAGTGGGCATCTGAAAGGCGG - Intergenic
1165060221 19:33201439-33201461 CAGAGTGTGGGGCAGGGAGGGGG + Intronic
1165269320 19:34691424-34691446 CAGACTGCAAAGCAGGAAGGGGG - Intergenic
1165397854 19:35576961-35576983 CAGAGGGAGGAGCAGAGAGGTGG + Intergenic
1165470478 19:36001163-36001185 AAAAGTGAGCAAGAGGAAGGGGG - Intergenic
1165757232 19:38300999-38301021 CAGAGAGAGCAGAAGGAGAGAGG - Intronic
1165895064 19:39136463-39136485 CTGACTGAACAGAAGGAAGGAGG - Intronic
1165935364 19:39385445-39385467 CAGAGTGTGCAGGACGCAGGCGG + Intronic
1165949255 19:39464772-39464794 CAGGGTGAGCCGGTGGAAGGAGG - Intronic
1166321432 19:42021551-42021573 CACAGTGATCAGAAGAAAGGGGG + Intronic
1166391000 19:42408900-42408922 CAGAGTGAGCAGTGGGGAGAGGG + Intronic
1166627482 19:44372071-44372093 CAGAATGAGCTGTAGGAAGGTGG - Intronic
1167095429 19:47372838-47372860 CAGAGTGCGCGGCAGCACGGCGG + Exonic
1167114077 19:47478880-47478902 GAGATTCAGAAGCAGGAAGGTGG + Intronic
1167145071 19:47676495-47676517 AAGAGGGAGAAGGAGGAAGGAGG - Intronic
1167191341 19:47991932-47991954 CAGAGTGAGAGCAAGGAAGGAGG - Intronic
1167794055 19:51697657-51697679 CAGAGGGAGCAGCAGGGAGATGG + Intergenic
1168277490 19:55285593-55285615 CAGAGTGGGAAACAGGATGGAGG + Intronic
925145911 2:1583272-1583294 AAGAGTGACCAGCGGGAGGGAGG - Intergenic
925173815 2:1768517-1768539 CAGAGGGAGCAGCATGAAATAGG - Intergenic
926045669 2:9708024-9708046 TAGAGGGAGCAGCATGGAGGTGG - Intergenic
926085389 2:10016580-10016602 CAGGGTGAGTAGGAGGAGGGAGG + Intergenic
926442456 2:12904092-12904114 TAGAGGGAACAGCAAGAAGGAGG - Intergenic
927586842 2:24315759-24315781 GAGAGAGAGAAGCAGCAAGGGGG - Intronic
927711631 2:25329810-25329832 CAGCGTGTGCAGCATGAGGGGGG - Intronic
927889317 2:26738543-26738565 CAGAGGGAGCAGCAGGTTGGTGG + Intergenic
930728933 2:54709359-54709381 CAGAGTGAGCAGCAGGAGCTGGG - Intergenic
930882643 2:56289507-56289529 CAGAGGGAGCAGCATGAGAGAGG + Intronic
930887782 2:56347703-56347725 CAGAGTGAACTGGAGGAGGGTGG + Intronic
931139183 2:59438282-59438304 AACAGTGAGCAGCAGGAACAGGG - Intergenic
931346214 2:61449126-61449148 CAGCCTGGGCAACAGGAAGGAGG + Intronic
931464558 2:62475124-62475146 CAGGAGAAGCAGCAGGAAGGGGG + Intergenic
931811434 2:65858404-65858426 CACAGTGAGTAGTAGGAAGCAGG + Intergenic
932134339 2:69215085-69215107 CAGCCTGTGCAGCAGGATGGAGG - Intronic
932646868 2:73511463-73511485 GAGGGTGAGCAGCAGCAGGGTGG - Intronic
932809344 2:74811178-74811200 AAGAGTTTGCATCAGGAAGGAGG + Intergenic
933317794 2:80736558-80736580 GAGAGTGAGCAGAAGTACGGTGG + Intergenic
933466520 2:82658556-82658578 CAGAGTGTGCAACAGGGGGGTGG - Intergenic
933488368 2:82950819-82950841 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
933966663 2:87435533-87435555 GAGAGTGAGCAGCATGAGGGTGG - Intergenic
934562189 2:95319194-95319216 CAGAGTCTGCAGGAGGAAGGCGG + Intronic
934696472 2:96404193-96404215 CAGAATGAGTAGCAGGGAAGTGG + Intergenic
934709056 2:96503424-96503446 CTGAGTGAGCAGCACAGAGGAGG - Intronic
934938662 2:98483741-98483763 CAGAGTAGCCAACAGGAAGGTGG - Intronic
934948273 2:98557912-98557934 CAGAGTGTACAGGAGGAAGGCGG - Intronic
935064642 2:99636964-99636986 CAGAGTGAGCAGCTGCAGGGTGG + Intronic
936327130 2:111514954-111514976 GAGAGTGAGCAGCGTGAGGGTGG + Intergenic
936398373 2:112147605-112147627 CAGGGAGGGCAGCAGCAAGGCGG - Intronic
936964533 2:118114502-118114524 AAGAGTGAGTAGCTGGATGGAGG - Intergenic
937039217 2:118807998-118808020 CAGAGTGGGCAGGAGGGAGAGGG + Intergenic
937039827 2:118812722-118812744 CAGAGTGAGCAGCAAGATCCTGG - Intergenic
937479209 2:122241579-122241601 AAGGGTGAGAAGAAGGAAGGAGG + Intergenic
937552318 2:123108922-123108944 GAGAGGGAGGAGCAGGATGGTGG - Intergenic
937562644 2:123244619-123244641 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
937653515 2:124347490-124347512 CAGATTGAGCAGAAGAAAGCTGG + Intronic
937900092 2:127013382-127013404 CAGAGACAGCAGCAGAGAGGTGG + Intergenic
938187552 2:129245210-129245232 CAGAGAGATGAGCAGGAAGAGGG - Intergenic
938403807 2:131016034-131016056 TAGAGTGAGAAGCAAGAAGGAGG - Intronic
938418557 2:131124677-131124699 CAGTGTATGCATCAGGAAGGGGG + Intronic
938546023 2:132332490-132332512 CAGAATGAGCTGCAGGAAGGCGG + Intergenic
939004211 2:136766396-136766418 GAGAGTGAGGGGCAGGGAGGGGG + Intronic
939200293 2:139025203-139025225 CAGAGTGAGCAGCAGCACTCAGG - Intergenic
939269410 2:139918131-139918153 GAAAGTGAGCAGCATGAAGCTGG - Intergenic
939554687 2:143660235-143660257 CAGAATGTGGAGGAGGAAGGAGG - Intronic
940030639 2:149257941-149257963 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
941110919 2:161417970-161417992 CAGACTGAGCTGCGAGAAGGGGG + Intronic
943240465 2:185377314-185377336 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
944537434 2:200725086-200725108 CAGAGGGTCCAGCAGGAAGAGGG + Intergenic
945033389 2:205685145-205685167 CAGAGAGCGCGGCAGGCAGGTGG - Intronic
945318173 2:208392829-208392851 CAGACTGAGCCGCTGGAATGGGG + Intronic
945395211 2:209307709-209307731 CAGAGTGGGCACCAGGAATGGGG + Intergenic
946104945 2:217360857-217360879 CAGGGTGGGCAGCAGGGATGGGG - Intronic
946283628 2:218685199-218685221 CAGAGTCAGCTGCATGAAGCTGG + Exonic
946411605 2:219517893-219517915 CAGAGTGGGGAGTGGGAAGGAGG - Intronic
946764735 2:223030085-223030107 CAGAGAAAGCAGGAGGTAGGGGG + Intergenic
947033424 2:225824398-225824420 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
947669267 2:231926205-231926227 CAGCGTGAGCAGCAGGGCGCAGG + Exonic
947812983 2:233015823-233015845 GAGAGTGAGCAGAAGGATGAGGG - Exonic
947951082 2:234147845-234147867 TAGAGTGATCAGCAAGAGGGTGG + Intergenic
947952587 2:234160980-234161002 CAGAAAGTGCACCAGGAAGGAGG + Intergenic
948233220 2:236366798-236366820 GAGAGAGAGGAGGAGGAAGGAGG - Intronic
948281188 2:236749038-236749060 CAGCGTGAGCAGCTGCAGGGAGG - Intergenic
948478806 2:238238131-238238153 CAGAGTGAGCAGTGTGATGGTGG - Intergenic
948665734 2:239533718-239533740 CAGAGAGAGCAGGAGCAAGCAGG - Intergenic
948891658 2:240909798-240909820 CAGAGTGAGCAGGGAGCAGGCGG + Intergenic
948963715 2:241359645-241359667 CAGAGAGAGCAGAAAGAAAGAGG - Intronic
1168842983 20:921529-921551 AAGATTGAGCATCAGGAATGTGG - Intergenic
1168916333 20:1491291-1491313 CAGTGCCAGCAGCAGGAAGCAGG + Exonic
1168954433 20:1824925-1824947 AAGAGTGAGCAGCTGGCTGGAGG + Intergenic
1169039683 20:2482751-2482773 CAGAGTGGCCCTCAGGAAGGAGG - Exonic
1169388200 20:5168816-5168838 CAGAGGGAGCAGTGGGCAGGAGG - Intronic
1170791211 20:19511051-19511073 CAGGGTCAGCAGCAGGGTGGGGG - Intronic
1171173515 20:23035159-23035181 CAGAGTCGGCAGCGGGGAGGGGG + Intergenic
1171267421 20:23783008-23783030 GAGAGGGAGCACCAGGAAAGGGG - Intergenic
1171327733 20:24310544-24310566 CAGAGGAAGCAGCAGGAGTGTGG + Intergenic
1171412212 20:24955268-24955290 CAGTGTTACCATCAGGAAGGAGG - Intronic
1171874886 20:30565223-30565245 CAGAATGAGCTGCAGGAAGGCGG + Intergenic
1172173939 20:32961103-32961125 CAGAGTGGGGAGCGGGAATGGGG - Intronic
1172702284 20:36861081-36861103 CAGAGTGAGTAGCAGGAACCGGG + Intronic
1172943496 20:38670825-38670847 AAGAGTGAGCTGCTGGAATGGGG - Intergenic
1173080935 20:39866776-39866798 CAGTGTGAGAAACAGCAAGGAGG + Intergenic
1173355398 20:42282888-42282910 ATGAGTGAGCAGATGGAAGGAGG + Intronic
1173999287 20:47362604-47362626 CAGAGTGAGCCACAGGAGGGTGG - Intergenic
1174055791 20:47797295-47797317 CACATAGAGCAGCAGGAAGGGGG - Intergenic
1174271042 20:49368769-49368791 CAGAGTGGGCAGGAGGGAGAAGG - Exonic
1174834091 20:53839800-53839822 CAGGGTGAGGAGCAGGATGCAGG - Intergenic
1175724813 20:61310587-61310609 CAGGCTGGACAGCAGGAAGGGGG - Intronic
1175748408 20:61477579-61477601 CAGACTGAGCTCAAGGAAGGCGG - Intronic
1175754859 20:61523024-61523046 CAGAGGAAGGAGCAGGAGGGAGG + Intronic
1175795272 20:61766915-61766937 CAGAGTCAGAATCAGGCAGGAGG - Intronic
1175840042 20:62020931-62020953 CAGCGTGAACATGAGGAAGGAGG + Intronic
1176016213 20:62934532-62934554 GAGACTGAGGAGCAGGGAGGGGG - Intronic
1176159670 20:63641867-63641889 CAGGGCTAGCAGCAGGCAGGGGG - Intronic
1176661927 21:9644908-9644930 AGGAGTGAAGAGCAGGAAGGTGG + Intergenic
1177046901 21:16182555-16182577 GAGAGAGAGAAGGAGGAAGGAGG - Intergenic
1178209881 21:30517503-30517525 CAGAGTGAACAGCATGATTGTGG - Intergenic
1179003636 21:37487985-37488007 AAGAGTGAGGAGAAGGCAGGAGG - Intronic
1179076409 21:38126418-38126440 CAGAGTGGTCAGGAGGCAGGAGG + Intronic
1179236741 21:39554167-39554189 CAGAATGACTAGGAGGAAGGAGG - Intergenic
1179278962 21:39917470-39917492 TAGAGGGAGAAGCTGGAAGGAGG + Intronic
1179409665 21:41153048-41153070 CAGAGTGGCCAGCAGGATGTGGG + Intergenic
1179494538 21:41763503-41763525 AAAAGTGAGAAGCAGGGAGGTGG + Intronic
1179768209 21:43590843-43590865 CAGGGAGAGGAGCAGGAAGGAGG + Intronic
1179831790 21:44001451-44001473 CAGAGTGAGCTGAAGGCATGTGG + Intergenic
1179902033 21:44399377-44399399 CAGGGCGAGCTGCAGGCAGGTGG - Exonic
1180157677 21:45986035-45986057 AAGTGGGAGCAGCAGGAAGGAGG - Intronic
1180897408 22:19346909-19346931 AAGAATAATCAGCAGGAAGGAGG + Intronic
1180917229 22:19497697-19497719 CAGGCTGAGCAGCAGGAGTGGGG - Intronic
1181284024 22:21739344-21739366 CAGAGTTAGCAGAGGGGAGGAGG - Intergenic
1181461894 22:23090576-23090598 CAGTCTGAGGGGCAGGAAGGAGG - Intronic
1181772792 22:25138953-25138975 CAGAGGGAAGACCAGGAAGGGGG - Intronic
1181817284 22:25448104-25448126 CAGAATGAGAAGAAGGAAAGCGG + Intergenic
1181920155 22:26314408-26314430 CAGTGTGGCCAGCAAGAAGGGGG + Intronic
1182134828 22:27891671-27891693 GAGAGAGAGGAGGAGGAAGGAGG - Intronic
1182771794 22:32801704-32801726 CAGAGCGGGCAGCAGGCAGGCGG + Exonic
1182860395 22:33554642-33554664 AAGAGTTGGCAGCAGGTAGGAGG - Intronic
1183068521 22:35380341-35380363 CAGAGTGTGGAGGAGGCAGGCGG + Intronic
1183201503 22:36388082-36388104 CAGTGGGTGTAGCAGGAAGGGGG - Intergenic
1183261075 22:36796365-36796387 CAAAGTGTCCAGCAAGAAGGAGG + Intergenic
1183470943 22:38006427-38006449 CTGAGTGAGCGGCTGGAGGGTGG - Intronic
1183811163 22:40258875-40258897 CAGAGTGACCTGCAGGACTGAGG - Intronic
1184067775 22:42130006-42130028 AGGAGTGAGCAGGTGGAAGGAGG + Intronic
1184070510 22:42143678-42143700 AGGAGTGAGCAGGTGGAAGGAGG + Intergenic
1184072250 22:42153313-42153335 AGGAGTGAGCAGGTGGAAGGAGG + Intergenic
1184474080 22:44711328-44711350 CAGAGGGAACAGCAGGATGGAGG + Intronic
1184586637 22:45452519-45452541 CATAGTGGACAGAAGGAAGGGGG - Intergenic
1184634726 22:45817976-45817998 CAGGGTGAGAAGCTGGAAGTTGG + Intronic
1184751520 22:46489062-46489084 CTGGGTGACCAGCAGGAAGGTGG - Intronic
1184767392 22:46578748-46578770 AAGGGTGTGCAGCAGGAAGGAGG - Intronic
1184775188 22:46619637-46619659 CAGAGTGAACAGGAGGACCGGGG - Intronic
1184795311 22:46728753-46728775 CAGAGTCAGCAGCTGGGAGCTGG + Intronic
1184799087 22:46749170-46749192 CAGAGAAAGCAGCAGGCAGTCGG - Intergenic
1185305744 22:50114932-50114954 GAGAGAGAGCAGCTGGAAGTAGG - Intronic
950939779 3:16882119-16882141 CAGAGAGACAAGCAGGAATGAGG + Intronic
951078279 3:18423974-18423996 GAGAGTGGGAAGCAGGGAGGAGG + Exonic
951719201 3:25679801-25679823 GAGAGAGAGCAGCAGGACAGGGG + Intergenic
952408389 3:33025930-33025952 GAAAGGGTGCAGCAGGAAGGAGG + Intronic
952590147 3:34942633-34942655 CAGAGAGAGAGGAAGGAAGGAGG - Intergenic
952608152 3:35174102-35174124 AAGAGTGAGCAGAAGCAGGGTGG - Intergenic
952851379 3:37732543-37732565 AAAAGTGGGCAGCTGGAAGGGGG + Intronic
952887530 3:38020760-38020782 CAGAGTGAACTGAAGGAAGCTGG + Intronic
953138595 3:40205880-40205902 CAGAGAAAGGAGCAGTAAGGAGG - Intronic
953347048 3:42184976-42184998 CAGCAGGAGCTGCAGGAAGGTGG - Intronic
953723038 3:45372991-45373013 CAGAGCAAGCAGCAAGAAGTAGG + Intergenic
953735644 3:45491871-45491893 CAGAGTTAGCACCAGGAGGGAGG - Intronic
954138382 3:48592770-48592792 CCGAGTGAGCGGCAGGAGGTAGG - Exonic
954283709 3:49602877-49602899 CAGAGTGTGCAGAAGAGAGGAGG - Intronic
954304417 3:49717900-49717922 CAGGGCGAGCAGCAAGAGGGTGG + Exonic
957877940 3:86173734-86173756 CACAGGCAGGAGCAGGAAGGTGG - Intergenic
957889959 3:86344451-86344473 CAGAGTGAGACTCAGGAAGCAGG - Intergenic
958073996 3:88652802-88652824 CAGAGTAATCAGTAGAAAGGGGG + Intergenic
958085933 3:88806887-88806909 CACTCTCAGCAGCAGGAAGGTGG - Intergenic
960048842 3:113221909-113221931 CAGTGTGAGCAGCAATCAGGAGG - Intronic
960611159 3:119555959-119555981 CAGACTGGGCTGCAGGAAGGAGG - Intronic
961366221 3:126401672-126401694 GAGAGGGAGCAGCAGGTGGGAGG + Intronic
962642438 3:137401115-137401137 GAGGGTGAGCAGAAGCAAGGTGG - Intergenic
963115840 3:141728291-141728313 CTAAATGAGAAGCAGGAAGGAGG + Intergenic
963295089 3:143537442-143537464 CAGAGTGGGCAGCAGTGGGGAGG - Intronic
966016855 3:175150709-175150731 CAGAGTGAGCAGCAGAAGGGAGG - Intronic
966616285 3:181916714-181916736 CAGAGTTAGGAGCAGGATGGAGG - Intergenic
968442156 4:629507-629529 CAGGGAGAGGAGCTGGAAGGTGG - Intronic
968478141 4:821968-821990 CAGAGGGTGCAGCAGAGAGGAGG - Intronic
968612802 4:1564701-1564723 CAGAGTGAGGGGCAGGATGGGGG + Intergenic
968652499 4:1765842-1765864 CAGAGTGGGGAGAAGGGAGGAGG + Intergenic
968921907 4:3526748-3526770 CAGACTGAGCTGCAGGGAGCAGG - Intronic
969057894 4:4413574-4413596 CAGAGGGAGCAGCGGGCAGTGGG + Intronic
969058377 4:4415899-4415921 CAGCGCGTGCATCAGGAAGGAGG - Intronic
969061484 4:4438743-4438765 CACAGTGACCAGCATGCAGGGGG + Intronic
969193886 4:5545505-5545527 CAGAGTTATCAGGAGGAAGCAGG + Intronic
969217054 4:5731113-5731135 CAGAGTTGGCAGCTGGGAGGAGG + Intronic
969249802 4:5959618-5959640 CAGAGGGAGCTGCAGGCAAGAGG + Exonic
969302824 4:6307312-6307334 TGGAAGGAGCAGCAGGAAGGTGG - Intergenic
969320820 4:6411396-6411418 CAGCAGGAGCAGCAGGAAGGAGG + Intronic
969372524 4:6742977-6742999 CGGAGTCAACAGCAGGAACGAGG + Intergenic
969542417 4:7801255-7801277 CAGTTTGAGGAGCAGGAAGGCGG - Intronic
969672719 4:8598564-8598586 CAGTGGGAGCAGCAGGAACCCGG - Intronic
969817124 4:9695167-9695189 CAGGGTGTGCAGCATGCAGGTGG - Intergenic
970416075 4:15858180-15858202 CACAGTGGGCAGCTGGAAAGGGG - Intergenic
970732554 4:19123910-19123932 CAGAGCTAGCCGAAGGAAGGAGG + Intergenic
971272233 4:25160739-25160761 CAGAGTAAGAAGCAGGTACGTGG + Intronic
971351979 4:25863090-25863112 CAGAGGGAGCGGCCGGGAGGAGG - Intronic
972918247 4:43905815-43905837 CACATGGAGCATCAGGAAGGGGG + Intergenic
974385869 4:61201582-61201604 CAGAGAAAGCAGCAGGAGGGTGG - Intronic
976222590 4:82769791-82769813 CAGAGTGAGAGGGAGGAAGGGGG + Intronic
978189332 4:105895154-105895176 CAGGGTGCCCAGCAGGAAAGGGG - Intronic
978472743 4:109088289-109088311 CACAGTGAGGAGCAGGTATGGGG + Intronic
979023045 4:115526975-115526997 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
979090661 4:116478397-116478419 CAGAGTGGGCATCAGGAGTGGGG + Intergenic
979363802 4:119796265-119796287 AAGAGAGAGTAGGAGGAAGGGGG + Intergenic
979439453 4:120734105-120734127 CAGAGTGTCCAGGAGGAAGGGGG + Intronic
980106660 4:128594721-128594743 CAGAGTAAGCTGGAGGGAGGGGG - Intergenic
980151736 4:129056080-129056102 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
981964275 4:150581986-150582008 GAGAGCGAGCACGAGGAAGGGGG + Exonic
982097891 4:151939849-151939871 CAGAGTCAGCAGCAGCAGAGTGG - Intergenic
982437082 4:155392172-155392194 CAGAGAGAGAAAGAGGAAGGAGG + Intergenic
982848079 4:160276409-160276431 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
984766605 4:183404907-183404929 TAGAGTGAGTAGGAGGGAGGAGG + Intergenic
984964123 4:185126475-185126497 GAATGTGAGCAGCAGGACGGAGG + Intergenic
985317328 4:188672336-188672358 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
985413468 4:189711638-189711660 AGGAGTGAAGAGCAGGAAGGTGG - Intergenic
985546893 5:514431-514453 CAGGGTGGGCCCCAGGAAGGGGG - Intronic
985621006 5:956176-956198 TAGCGTGAGCTCCAGGAAGGCGG + Intergenic
985774548 5:1833974-1833996 AAGAGGGAGCAGCCGGGAGGTGG - Intergenic
986280094 5:6315700-6315722 CAGCAGGAGCAGGAGGAAGGTGG - Intergenic
986919327 5:12664302-12664324 CAGGGTGAGGAACAGGAAAGAGG + Intergenic
988204007 5:28110806-28110828 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
988873154 5:35413073-35413095 CAGAGTGAGCCCCTGGAAGAGGG - Intergenic
989987205 5:50714780-50714802 CACAGTCAGCTGCAGGAGGGAGG - Intronic
989987954 5:50724847-50724869 CAGAGTGGGAGGGAGGAAGGGGG - Intronic
990380744 5:55220487-55220509 CACAGTGAGCTGGAGGAGGGCGG - Exonic
990868320 5:60403751-60403773 GAGAGACAGCATCAGGAAGGAGG - Intronic
990903535 5:60779139-60779161 CAGTGAAAGCAGCAGGAAAGGGG - Intronic
990986966 5:61649582-61649604 CAGAGTGCACAGGGGGAAGGTGG - Intronic
991124098 5:63050225-63050247 CAGTGAGAGCATAAGGAAGGAGG - Intergenic
991332824 5:65510940-65510962 CAGAGTCACCAGCAGCAAGAGGG + Intergenic
991651986 5:68865112-68865134 CAGAGTGGGCAGAAGCAGGGTGG + Intergenic
992158620 5:73979465-73979487 CAGAAGGAGAAGCAGAAAGGCGG + Intergenic
992417362 5:76564828-76564850 CTGGGAGAGGAGCAGGAAGGAGG + Intronic
993442794 5:87977637-87977659 TAGTGGGAGCAGGAGGAAGGGGG - Intergenic
993852075 5:93023177-93023199 AATGGAGAGCAGCAGGAAGGAGG - Intergenic
995551414 5:113285499-113285521 CAGAGTGAGCAGGGGGAGAGTGG - Intronic
995885328 5:116888152-116888174 AAGGGAGAGCAGCAGGAGGGTGG + Intergenic
996939035 5:128981605-128981627 TAGAGTGAGCAGAAGGATGGAGG + Intronic
998285695 5:140858165-140858187 CAGCGTGAGCACCAGCAAGCTGG - Exonic
998413214 5:141926812-141926834 CATAGTGAGAAGTAGGAAGTGGG + Intronic
998503135 5:142651071-142651093 CAGAGAGAGGTGAAGGAAGGCGG + Intronic
999112828 5:149136993-149137015 AAGAATGACCATCAGGAAGGAGG + Intergenic
999400367 5:151259407-151259429 AGGAGTGGGCAGCAGGGAGGTGG + Intronic
1000091481 5:157933062-157933084 TAGAGTGGGCAGCAGGAGGCTGG + Intergenic
1000302115 5:159965661-159965683 CAGAGGAAGAAGGAGGAAGGAGG + Intronic
1000821740 5:165993309-165993331 AAGAGTGGCCAGGAGGAAGGAGG - Intergenic
1001485725 5:172118399-172118421 CAGAGTGAGGTGCAGGCATGTGG + Intronic
1001639206 5:173233328-173233350 CAGAGTGAGCCGCAGCCAGCTGG - Intronic
1001946647 5:175784392-175784414 CAGAGTGGGAGGCAGGATGGGGG - Intergenic
1002419810 5:179139645-179139667 TAGAGTGGGCTGCAGGCAGGTGG + Intronic
1002855910 6:1038128-1038150 GACAGTGAGCAGCAAGAAGGGGG + Intergenic
1004468370 6:15906519-15906541 CACAGTGAGGAACAGAAAGGAGG + Intergenic
1004715577 6:18213630-18213652 CAAAGTGAGCAGAAGAAAGGTGG - Intronic
1004772559 6:18800611-18800633 CACAGTAATAAGCAGGAAGGTGG + Intergenic
1006452186 6:34111695-34111717 CAGAATGGGCAGCAGCCAGGTGG + Intronic
1006609743 6:35287147-35287169 CAGAATGAGCAGGAGGAAACTGG + Intronic
1006651417 6:35554874-35554896 CAGAGTCAGCAGCAGGGAGAAGG + Intergenic
1007287369 6:40757363-40757385 CAGAGAGAGAAGCAGGTTGGTGG + Intergenic
1007657747 6:43462151-43462173 CAGAGTGAGCAGAGAGGAGGAGG - Intergenic
1007782255 6:44261168-44261190 CAGAGTGAGAGGAAGGAATGTGG - Intronic
1007784962 6:44274565-44274587 GCGGGTGAGAAGCAGGAAGGAGG + Intronic
1008407676 6:51136734-51136756 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
1009676202 6:66825635-66825657 TAGACAGTGCAGCAGGAAGGTGG - Intergenic
1009846972 6:69146324-69146346 CAGAGTGAGCACTGGGAATGGGG + Intronic
1009873222 6:69473904-69473926 CAGAGTGAGAAAAAGGAAGCAGG - Intergenic
1010653408 6:78481367-78481389 CTGAGAGAGAAGCAGAAAGGAGG - Intergenic
1010687302 6:78867792-78867814 GCGAGTGAGCAGCACCAAGGAGG + Exonic
1010767524 6:79793166-79793188 AAGCCTGAGCAGCAAGAAGGGGG - Intergenic
1010793356 6:80090649-80090671 CAGCATGAGCAGCAGGAAAATGG + Intergenic
1011186147 6:84677735-84677757 CTGAGTGAATAGGAGGAAGGTGG - Intergenic
1011577977 6:88825851-88825873 CAGAGTGAGGAGAAGGATAGTGG - Intronic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1015201443 6:130585987-130586009 CAGAGGCAGCAGCATGAAGCAGG + Intergenic
1015382876 6:132589459-132589481 CAGGGAGAGCAGCAGGAAGTTGG + Exonic
1015414262 6:132930881-132930903 CTGTCTGAGCAGCAGGAGGGAGG + Intergenic
1015863018 6:137700132-137700154 GGGAGTAAACAGCAGGAAGGAGG + Intergenic
1016125371 6:140395763-140395785 AACAGTGAGCAGCAGGAGGGAGG - Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017079975 6:150658743-150658765 CAGGGTGAGGAGCAGGGAGGAGG - Intronic
1017492758 6:154958781-154958803 CAGGGTGGGCAGCAGGATGAAGG - Intronic
1017577232 6:155818459-155818481 CAGAGAAAGCAAGAGGAAGGAGG + Intergenic
1018036876 6:159889314-159889336 CAGAGTGACCAACTAGAAGGAGG - Intergenic
1018038063 6:159898610-159898632 AAGAGGGAGGAGGAGGAAGGAGG - Intergenic
1018113927 6:160564673-160564695 GAGAGTGAGCCGAAGCAAGGCGG + Intronic
1018365005 6:163110987-163111009 CAGAATGTCCAGCAGGAAGAGGG - Intronic
1018508202 6:164494184-164494206 CGGAGTGAGAAGAAGGAACGAGG + Intergenic
1019414719 7:922020-922042 GGGAGTGAGCACCAGGAAGTCGG + Intronic
1019453508 7:1112385-1112407 CAGAGTGAGCAGGTGGAGGCCGG - Intronic
1019481249 7:1267750-1267772 CAGAGTGTGCTGCACGAAAGGGG + Intergenic
1019756948 7:2777622-2777644 GTGAGGAAGCAGCAGGAAGGTGG + Intronic
1019879689 7:3847554-3847576 CAGCGTGAGAAGCAGGCAAGAGG - Intronic
1019908944 7:4086621-4086643 CAGAGAGATGAGAAGGAAGGAGG - Intronic
1019919772 7:4156169-4156191 CAGAGTGGGCATCAGGAATGTGG - Intronic
1020107354 7:5428265-5428287 CGGCGTGAGCAGCGGGAAGGAGG - Intergenic
1020340174 7:7101519-7101541 CAGAGGGAGCAGGAGGGAGTAGG - Intergenic
1021977649 7:26025967-26025989 CAGGGTGAGGAACAGGAAAGAGG + Intergenic
1022561550 7:31354820-31354842 GAGATTGGGCAGCAAGAAGGAGG - Intergenic
1023028432 7:36072753-36072775 CCGAGTAAGCACCATGAAGGAGG + Intergenic
1023048514 7:36231703-36231725 CAGAATCAGCAGAAGAAAGGCGG + Intronic
1023086160 7:36571726-36571748 AAGAGACAGCAGCAGGCAGGAGG - Intronic
1023149128 7:37183193-37183215 CAGAAGGAGAAGGAGGAAGGAGG + Intronic
1023512383 7:40967483-40967505 GAGATTGGGAAGCAGGAAGGAGG - Intergenic
1023618759 7:42048429-42048451 CCGAGTGAGGAGCGGGGAGGAGG + Intronic
1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG + Exonic
1024307944 7:47943887-47943909 GTGAGTGAGCAGCAGGAATGGGG - Intronic
1024527009 7:50357412-50357434 CAAAATGAGAAGCAGGAAGAGGG - Intronic
1025237199 7:57242862-57242884 CACACAGAGCAGCAGGAAGGGGG + Intergenic
1025607682 7:63051190-63051212 CAGAGTGAGAGGAAGGAAAGAGG - Intergenic
1026250544 7:68666217-68666239 CAGAGAGAGAGGCAGGAAGAGGG - Intergenic
1026268543 7:68816620-68816642 CAGAGCCAGCAGCAGACAGGAGG + Intergenic
1026445698 7:70482783-70482805 TAGAGAAAGCAGCAGGAATGGGG - Intronic
1026950654 7:74344259-74344281 CAGGGTTGGCAGCAGCAAGGGGG + Intronic
1027267355 7:76501678-76501700 CAGAGTGGGCACCCGGAAGAGGG - Intronic
1027278597 7:76588813-76588835 TGGAGTGAGCAACAGGAAGAAGG - Intergenic
1027319168 7:77001543-77001565 CAGAGTGGGCACCCGGAAGAGGG - Intergenic
1027898880 7:84082326-84082348 AAGAATGAGCAGCAGGAAGTGGG + Intronic
1028898163 7:96065214-96065236 TAGAGAGAGCTGCAGGAATGAGG - Intronic
1029677085 7:102077230-102077252 CAGAGAAAGCAGCAGCAGGGAGG + Intronic
1030216211 7:107045392-107045414 CAGAGAGCGGAGTAGGAAGGTGG - Intronic
1030810449 7:113966316-113966338 CAGAGTGAGGAGGATGAAAGAGG + Intronic
1032062277 7:128735144-128735166 GAGAGGGAGCAACAGGAATGAGG - Intergenic
1032774098 7:135091744-135091766 CAGTATGAGCAGAAGCAAGGAGG - Intronic
1033051030 7:138004391-138004413 GAGCGTGAGCACCAGGAAGTGGG - Intronic
1033172172 7:139093911-139093933 CAGAGTGATCAGAAGAAAGTCGG - Intronic
1033767575 7:144510917-144510939 CAGAAATATCAGCAGGAAGGTGG + Intronic
1033822112 7:145147395-145147417 CACAGTCAGGAACAGGAAGGGGG - Intergenic
1034132985 7:148738195-148738217 TAAAGTGAGCAGCAGGATGACGG - Intronic
1034356731 7:150456476-150456498 CAGAGTGAGAAGGAGACAGGAGG - Intronic
1034983337 7:155491897-155491919 CAGAGCAGGAAGCAGGAAGGAGG + Intronic
1035060640 7:156066800-156066822 CGGAGGGAGAATCAGGAAGGAGG + Intergenic
1035981493 8:4377274-4377296 CAGAGAGAGCAAAAGGGAGGAGG + Intronic
1035983692 8:4401995-4402017 CAGTGGTAGCAGCAGGAATGTGG - Intronic
1036023702 8:4878956-4878978 CACAGTGAGAAGCAGGGAGAGGG + Intronic
1036282952 8:7417195-7417217 CAGAGTGGGCAGCAGGTGAGTGG - Intergenic
1036338516 8:7894323-7894345 CAGAGTGGGCAGCAGGTGAGTGG + Intergenic
1036425403 8:8641386-8641408 CAGAGTGTGTAGGAGGAGGGAGG - Intergenic
1036445836 8:8821149-8821171 CAGAGGGAGCAGCTGCCAGGTGG + Intronic
1036696803 8:10980125-10980147 CAGAGGGAGCTTCAAGAAGGGGG + Intronic
1036708439 8:11061771-11061793 AAGAATGAGAAGAAGGAAGGGGG + Intronic
1037635748 8:20700097-20700119 GAGAGGGAGGAGCAGAAAGGGGG + Intergenic
1037716812 8:21407904-21407926 CAGAGTGGGGAGGAGGAAGGTGG - Intergenic
1037835640 8:22213410-22213432 CAGAGGAAGCAGCAGCAGGGAGG - Intergenic
1038210116 8:25510209-25510231 CAGAGAGAGCTGCAGAGAGGAGG - Intergenic
1038229302 8:25685608-25685630 CAGAATGCGCGGCAGGAAAGAGG - Intergenic
1038567124 8:28628995-28629017 CAGAATGAGAAGCTGGAAGGTGG + Intronic
1038591029 8:28838112-28838134 CAGAGAGAGCAGCATACAGGCGG + Intronic
1038740564 8:30213141-30213163 CAGAGGGAGGAGCAGGGATGGGG + Intergenic
1038780989 8:30568400-30568422 CAGAGTGAGGGGCAGGCAGCGGG + Intronic
1039447466 8:37644073-37644095 AAGGGTGAGCAGAAGGCAGGTGG + Intergenic
1039796183 8:40917586-40917608 CAGAGAGAGCAACAGGAGCGTGG + Intergenic
1039854418 8:41400018-41400040 CCGAGTGCGCAGCCGCAAGGAGG + Intergenic
1040770551 8:50970132-50970154 CAGAATGAGAAGGGGGAAGGGGG + Intergenic
1040914976 8:52559470-52559492 GAGAGTGAGGAGGAGAAAGGTGG - Intronic
1041635219 8:60134983-60135005 CAGGGAGAGCAGCAGGCAAGTGG - Intergenic
1041732951 8:61081246-61081268 AAGAGAGAGCAGAAGGAATGAGG + Intronic
1042579153 8:70257516-70257538 GAGAAAGAGCAGCAGGCAGGAGG + Intronic
1043392324 8:79803817-79803839 CAGAGTAGGAAGCAAGAAGGAGG + Intergenic
1043585475 8:81763817-81763839 TAAACTGAGAAGCAGGAAGGAGG + Intergenic
1045128925 8:99126250-99126272 CAGAGTAAGCATGGGGAAGGAGG + Intronic
1046591256 8:116209874-116209896 CCTAGTGAGCAGTAGGTAGGAGG - Intergenic
1047402530 8:124558646-124558668 CTGTCTGAGCAGCAGGCAGGGGG + Intronic
1047489186 8:125360444-125360466 CACAGTGAGCAGAACGAAGTCGG - Intronic
1047636371 8:126767600-126767622 CAGCCTGAGCAGGAGGAAGTTGG - Intergenic
1048798818 8:138177160-138177182 CAGAGTGGGGAGCTGGCAGGTGG - Intronic
1048850133 8:138637015-138637037 GAGAGCGGGCAGCAGGAAAGGGG + Intronic
1049254706 8:141607652-141607674 CCCAGTGAGAAGGAGGAAGGAGG - Intergenic
1049377028 8:142294149-142294171 CAGAGTGGCCAGAGGGAAGGTGG + Intronic
1050151274 9:2621770-2621792 CGGGGTGAGCAGCGGGGAGGGGG - Intergenic
1050881011 9:10700704-10700726 CAGTGTGAGCAGCAGCACTGTGG - Intergenic
1051246828 9:15120199-15120221 GAGAGTGAGGAATAGGAAGGAGG - Intergenic
1051374113 9:16386883-16386905 CAGAGAGACCAGCAGGAGGCAGG + Intergenic
1052030107 9:23618927-23618949 CAGAGTGAGCAGGGAGAAGGAGG - Intergenic
1052857905 9:33418399-33418421 CAGAGAGTACAGCAGGAAGAGGG + Intergenic
1053416890 9:37952434-37952456 CACTGTGAGCAGCGGGCAGGAGG + Intronic
1053480547 9:38413434-38413456 CAGTGGGAGGAGGAGGAAGGAGG - Intronic
1055119185 9:72638509-72638531 CAAAATAAGCAGCAGGAAGGGGG - Intronic
1055496894 9:76864293-76864315 CAGAGGGGGTAGCAGGAAGGAGG + Intronic
1055570943 9:77616494-77616516 CTAAGTCAGCAGCAGGAAGATGG + Intronic
1055739556 9:79371608-79371630 GAGAGTGATTAGCAGGATGGTGG - Intergenic
1055766173 9:79666106-79666128 TAGAGTGAGAAGCAGGAATGAGG + Intronic
1056385358 9:86092362-86092384 CAGAGTCAGGAGAAGGAAAGAGG - Intronic
1056418720 9:86402877-86402899 GAGAATGAGCAGCATGAAGCCGG - Intergenic
1056541219 9:87572983-87573005 CAGAATCAGCATCTGGAAGGTGG - Intronic
1057168640 9:92947582-92947604 CACAGTGGGCAGCAGGAGGCTGG - Exonic
1057169592 9:92953513-92953535 CAGTGTGAGCAGCGAGAAGCTGG - Intronic
1057416146 9:94863796-94863818 CATTGTAGGCAGCAGGAAGGAGG + Intronic
1057999732 9:99852745-99852767 AAGACTGAGAAGGAGGAAGGAGG + Intronic
1058906122 9:109484028-109484050 CAGAGTGAAGAGGAGGAAGTTGG - Intronic
1058918218 9:109587874-109587896 CAGAGACTGCAGGAGGAAGGTGG + Intergenic
1059379252 9:113910339-113910361 CAGAGTGAAGAGCAGGAACCAGG - Intronic
1060549924 9:124480063-124480085 CAGTGTGAGCAGAAGGATGGAGG - Intergenic
1060551493 9:124487614-124487636 CTGAGTGAGCCGCAGGGCGGTGG + Intronic
1060724296 9:125997019-125997041 CAGAAAGAGCAGTAGAAAGGAGG - Intergenic
1061076171 9:128342893-128342915 AAGAGTGAGAAGCAGGAGGCTGG - Intronic
1061120218 9:128637302-128637324 CAGGGGCTGCAGCAGGAAGGTGG + Intronic
1061133592 9:128721418-128721440 GAGGGACAGCAGCAGGAAGGTGG + Exonic
1061212842 9:129203518-129203540 CAGAGGGAACAGCATGAAGGAGG + Intergenic
1061408893 9:130407662-130407684 CAGAGTGGGCCGCACGCAGGCGG + Intronic
1061431739 9:130535651-130535673 CTGAGTGAGCAGCTGGAGGCGGG + Intergenic
1061780203 9:132991402-132991424 CTCAGTGGGCAGCAGGCAGGTGG - Exonic
1061940872 9:133883096-133883118 CAGAGAGAGCAGCAGGGGGTGGG - Intronic
1062160970 9:135079643-135079665 CAGAGGCTGCAGCAGGAAGAAGG + Intronic
1062181229 9:135192288-135192310 CGGACGGAGCAGCAGGGAGGTGG - Intergenic
1062190716 9:135246619-135246641 GAGGATGAGCAGAAGGAAGGAGG - Intergenic
1062372613 9:136247807-136247829 CAGAAGGAGCAGCAGCGAGGTGG + Intergenic
1062456414 9:136641360-136641382 CCCAGAGAGCAGCAGCAAGGGGG + Intergenic
1062546639 9:137066537-137066559 CAGTGTGAGGAGCTGGAAAGGGG - Intronic
1203639488 Un_KI270750v1:146751-146773 AGGAGTGAAGAGCAGGAAGGTGG + Intergenic
1185569716 X:1124194-1124216 CGGAGTGAGCAGAAGGACAGAGG + Intergenic
1185750791 X:2608786-2608808 CCCCGTGAGCAGCTGGAAGGGGG + Intergenic
1185895406 X:3854160-3854182 AAGAGGGAGAAGAAGGAAGGAGG - Intergenic
1185900523 X:3892584-3892606 AAGAGGGAGAAGAAGGAAGGAGG - Intergenic
1185905639 X:3931015-3931037 AAGAGGGAGAAGAAGGAAGGAGG - Intergenic
1186157130 X:6737516-6737538 GAGAGTGAGCAGCAGGTATTAGG + Intergenic
1186643532 X:11482518-11482540 CAGTATGAGCACAAGGAAGGTGG - Intronic
1186774941 X:12855044-12855066 GAGGGTGAGCAGAAGCAAGGTGG - Intergenic
1187611310 X:20946807-20946829 CTGAGTGAGTAGGAGGAAGGAGG - Intergenic
1187620445 X:21047354-21047376 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
1187981778 X:24765062-24765084 GTGAGGGAGCAGCAGGTAGGAGG - Intronic
1187989702 X:24856207-24856229 CAGAGTTAGGAGTGGGAAGGAGG - Intronic
1189586190 X:42464416-42464438 GAGAGAGAGCAGGAGGAAAGGGG + Intergenic
1190008025 X:46758781-46758803 GAGCGTGAGCAGCAGGATGAAGG + Exonic
1190113212 X:47608622-47608644 GAGAGGGAGCAACAGGAGGGAGG + Intronic
1190357154 X:49616659-49616681 GAGAGAGAGAAGGAGGAAGGGGG - Intergenic
1190463152 X:50698907-50698929 CAGAGTTAGGAGGAGGAAGGTGG - Intronic
1190795193 X:53734467-53734489 CAAAGTTAGCAGCAGGAACTGGG - Intergenic
1191766804 X:64706345-64706367 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
1192145480 X:68679590-68679612 GAGAGTGAGCAGGAGGGAAGGGG + Intronic
1192331870 X:70182185-70182207 CAGAGGGACAAGAAGGAAGGAGG + Intronic
1192998102 X:76533692-76533714 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
1193763782 X:85499945-85499967 CAAAGTGAGAAGGAGAAAGGAGG + Intergenic
1194737052 X:97525044-97525066 TAGAGTGAGTAGCTGGATGGTGG - Intronic
1195540060 X:106053296-106053318 CAGAGGCTGCAGAAGGAAGGGGG + Intergenic
1195615069 X:106905674-106905696 GAGAATCAGCAGAAGGAAGGAGG + Intronic
1195651491 X:107289585-107289607 CAGAATGAGCTGCAGGCTGGGGG - Intergenic
1196148002 X:112341211-112341233 CAAAGTTAGCGGTAGGAAGGAGG + Intergenic
1196315159 X:114213667-114213689 AAGAGAGAGAAGGAGGAAGGAGG + Intergenic
1196928723 X:120660181-120660203 AGGAGTGAGTAGCAGGAAGCAGG - Intergenic
1197048495 X:122029368-122029390 GAGAGAGAGCAACAGGAAGGTGG + Intergenic
1197654720 X:129104619-129104641 GGGAGTGAGCAGCAGAAAGAAGG - Intergenic
1197782765 X:130173398-130173420 CAGTTTGACCAGCAAGAAGGAGG - Intronic
1198060648 X:133042490-133042512 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
1198204188 X:134450876-134450898 CAGAAGGAGGATCAGGAAGGTGG + Intergenic
1198295482 X:135282783-135282805 GAGGGTGAGCAGAAGCAAGGTGG - Intronic
1198801370 X:140451238-140451260 AAGAGTGAGCACAAGAAAGGAGG + Intergenic
1199184388 X:144898137-144898159 CAAAGTGAGCATCAGCATGGTGG + Intergenic
1199418228 X:147611796-147611818 CACAGTAAGCAGAAAGAAGGTGG + Intergenic
1199665824 X:150095659-150095681 CAGAGTCAGGAGGAGGATGGTGG - Intergenic
1200050345 X:153426168-153426190 GACAGTGAGGAGCAGGAAAGAGG - Intergenic