ID: 1104049346

View in Genome Browser
Species Human (GRCh38)
Location 12:125185777-125185799
Sequence CAGCGAAGGCGGCCTGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 1, 2: 1, 3: 33, 4: 296}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104049346_1104049357 26 Left 1104049346 12:125185777-125185799 CCATCCCCAGGCCGCCTTCGCTG 0: 1
1: 1
2: 1
3: 33
4: 296
Right 1104049357 12:125185826-125185848 CGCACCCCTAGCCCCCATCCCGG 0: 1
1: 0
2: 1
3: 27
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104049346 Original CRISPR CAGCGAAGGCGGCCTGGGGA TGG (reversed) Intergenic
900242452 1:1623536-1623558 CGGCGAGGGCGGCGTGGGCACGG + Exonic
900296648 1:1955262-1955284 CAGGGCAGGAGGCATGGGGAGGG + Intronic
900410304 1:2509677-2509699 CCCCGAAGGTGGCCTGGGGAGGG - Intronic
900838239 1:5023594-5023616 CAAGGAAGGCTGCCTGGTGAGGG - Intergenic
901378309 1:8855550-8855572 CAGAGTAGGCTGCCTGGGGAAGG + Intergenic
901612510 1:10510024-10510046 CAGGGAAGGCAGCCCAGGGATGG + Intronic
901818121 1:11806359-11806381 CGGCGGAGTCGGCCTGGGGAGGG + Intronic
902757098 1:18556155-18556177 CAGGGAAGGCTTCCTGGAGAAGG - Intergenic
903032265 1:20472420-20472442 CAGGGAAGGCTTCCTGGAGACGG + Intergenic
903180880 1:21604266-21604288 CAGAGAAGGAAGCCAGGGGAAGG + Intronic
903369069 1:22823294-22823316 CAGCGAAGGCTTCCTGGAGGAGG - Intronic
903822340 1:26112011-26112033 CAGCGGAGTCATCCTGGGGAAGG + Intronic
904011393 1:27392440-27392462 CAGCGCGGGCGGACTCGGGAGGG + Intergenic
906109175 1:43312059-43312081 CAGCTGAGCCGGCCAGGGGAAGG + Exonic
907012631 1:50977929-50977951 CAGCGAAGGAGGCCAGTGGCCGG + Intergenic
907237583 1:53062551-53062573 CAGCGGGAGGGGCCTGGGGACGG - Intronic
908516830 1:64901204-64901226 CAGAGAAGGCATGCTGGGGAAGG - Intronic
908605333 1:65792377-65792399 GAGCGCGGGCGGCCGGGGGAGGG + Intergenic
910730054 1:90385286-90385308 CTGAGAAGGCAGCATGGGGAAGG + Intergenic
911092730 1:94030633-94030655 CACCGAATGCTGCCTTGGGATGG + Intronic
913530341 1:119729499-119729521 CGGAGAAGGAAGCCTGGGGAAGG - Intronic
914681985 1:149944933-149944955 CAACGAGGGCGGCCGGCGGAAGG - Exonic
915835514 1:159172402-159172424 CAGAGAAGGGGGCCTGGGTGAGG + Intronic
919012510 1:191983401-191983423 CAGTGATGGCAGTCTGGGGAGGG + Intergenic
919845730 1:201641015-201641037 CAGGGAAGGCGGCCTAGAGGAGG + Intronic
920108129 1:203568924-203568946 CTGAGGAGGCAGCCTGGGGAAGG - Intergenic
921307466 1:213811390-213811412 CAGTGAAGTAGGCATGGGGATGG - Intergenic
921932839 1:220769332-220769354 CAGCTAGGGCGGCCAGCGGAAGG + Intronic
1062895619 10:1101126-1101148 CAGGGAGGGCGGCCTGGAGCAGG - Intronic
1063054914 10:2494651-2494673 AAGCGAAGGCATCCAGGGGAAGG - Intergenic
1063362176 10:5467838-5467860 CAGGGAAGGCTGCCTGGGAAAGG - Intergenic
1065322899 10:24525263-24525285 AGGTGAAGGCAGCCTGGGGAGGG + Intronic
1065879576 10:30027338-30027360 ACGCGAAAGCGGCCCGGGGATGG + Exonic
1067787232 10:49259570-49259592 CAGCCAAGGCTGCCTGTGGTTGG + Intergenic
1069069305 10:63977228-63977250 CAGAGATGACAGCCTGGGGAAGG - Intergenic
1069624469 10:69859435-69859457 CAGAGAAGAGGGGCTGGGGAAGG - Intronic
1069881265 10:71595365-71595387 CAGGGAAGGCTTCCTGGGGGAGG - Intronic
1070439523 10:76429765-76429787 CAGCCATGGGGGCCTGGGCAGGG + Intronic
1070570511 10:77637129-77637151 AAGGGAAGGCGGCGAGGGGAAGG + Intronic
1070728041 10:78805300-78805322 CAGAGAAGCAGGCTTGGGGAAGG - Intergenic
1071437055 10:85657161-85657183 CAGCAAAGGCGTCCTGGAGAAGG - Intronic
1072620226 10:97074773-97074795 CAGAGCAGGGTGCCTGGGGATGG - Intronic
1073178157 10:101569110-101569132 CAGAGAGAGGGGCCTGGGGAGGG + Intergenic
1074152696 10:110771680-110771702 CAGAGAAGGCTGCCTGGAGGAGG + Intronic
1074764559 10:116691198-116691220 CAGGGGAAGCAGCCTGGGGAAGG + Intronic
1078091765 11:8268509-8268531 CAGCGCAGGCGGCCGGCGGCGGG - Intronic
1080446922 11:32345973-32345995 CAGGGAAGGTGGCCTGAAGAAGG - Intergenic
1080706575 11:34701251-34701273 CAGCAGAGGAGGCCTGGGCAGGG + Intergenic
1081443131 11:43101649-43101671 CTGAGAAGGCAGCCTGTGGAAGG - Intergenic
1081694890 11:45102834-45102856 CAGGGAAGGCTTCCTGGGAATGG + Intronic
1081771279 11:45651806-45651828 CACAGAAGGGGGACTGGGGAGGG + Intronic
1081870922 11:46382146-46382168 GATCGAAGGAGGGCTGGGGACGG + Intronic
1083726549 11:64631340-64631362 CAGGGACGGAGGCCTGGAGAAGG + Intronic
1083812177 11:65112203-65112225 CAGCGAAGGGTGTCTGGAGAGGG + Intronic
1083904287 11:65660061-65660083 CAGGAAAGGCGGGCTGGGGAGGG + Intronic
1084608419 11:70185856-70185878 CAGTGCAGGGGGCCTGGGGTCGG - Intronic
1085274066 11:75287083-75287105 CAGGGAAGGCGTCCTGATGATGG - Intronic
1088858527 11:113778534-113778556 CAGCAAGGGGAGCCTGGGGAGGG + Intergenic
1089384460 11:118058764-118058786 CAGCTCGGGGGGCCTGGGGAAGG + Intergenic
1089394818 11:118129697-118129719 GAGCCAGGGCGGCCTGGGCAAGG + Intergenic
1089604900 11:119636111-119636133 GAGCGATGGGGGCCTGGGGCTGG - Intronic
1092329598 12:7571528-7571550 CAGGGAAGGAGGGCTGGGGAAGG - Intergenic
1092742985 12:11648731-11648753 CAGAGAAGCGGTCCTGGGGAGGG + Intergenic
1092981561 12:13799718-13799740 CAGGGAAGGAGGACTGGGGGTGG + Intronic
1095589269 12:43885821-43885843 CAGTGAAGGCTTCCTGGAGATGG + Intronic
1096460872 12:51820979-51821001 CCGCGAAGGCGGCCTGGAGGAGG + Intergenic
1096465863 12:51847645-51847667 CAGAGGAGGAGGCCTGGGAAGGG - Intergenic
1098205876 12:68109244-68109266 CACCTAAGGTAGCCTGGGGAAGG - Intergenic
1100664632 12:96737938-96737960 CATGGAAGGCAGGCTGGGGATGG + Intronic
1101398831 12:104371143-104371165 CAGAGAATGCCGCCTGGGTAGGG + Intergenic
1101651028 12:106677233-106677255 CAGCTAAGGCTGCATGGGAAGGG + Intronic
1102040714 12:109798941-109798963 CAGCGAAGGGGGCCCAGGGTGGG + Intronic
1102289319 12:111685965-111685987 CAGCGACGGCGGCCGGGAGGCGG - Exonic
1102458189 12:113084054-113084076 CAGCGAAGGAGGCCCAGAGAGGG + Intronic
1102551220 12:113693643-113693665 CAGGGAAGGCTTCCTGGGGGAGG + Intergenic
1103120085 12:118372862-118372884 CAGCGGCGGCGGCCGCGGGAGGG - Exonic
1104049346 12:125185777-125185799 CAGCGAAGGCGGCCTGGGGATGG - Intergenic
1104111664 12:125710332-125710354 CAGAGAAGGCGACGTGGTGATGG + Intergenic
1105437786 13:20391885-20391907 CAGCCAAGGAGGCCTCGGGCTGG - Intergenic
1105705261 13:22964393-22964415 CAGGGAAGGTTCCCTGGGGAAGG - Intergenic
1105858176 13:24389409-24389431 CAGGGAAGGTTCCCTGGGGAAGG - Intergenic
1108674578 13:52725099-52725121 CAGAGAAGGCTGCATGGAGAAGG - Intronic
1110151322 13:72258384-72258406 TAGCCATGGTGGCCTGGGGAAGG + Intergenic
1113911296 13:113842660-113842682 CAGGGCAGGCGGCCTGTGCAGGG + Intronic
1119480242 14:74954277-74954299 CAGCCAAGGCGGGCTGTGCAGGG - Intronic
1121096123 14:91219254-91219276 CAGTGAAGGCTGCCTGGAGGAGG + Intronic
1121897705 14:97663976-97663998 CAGAGAAGGCTGCCTGGAAAAGG + Intergenic
1122179944 14:99947506-99947528 CAGAGAAGGCTGCATGTGGAAGG - Intergenic
1122228282 14:100292245-100292267 CTGAGAAGGAGCCCTGGGGAAGG + Exonic
1122243130 14:100382312-100382334 CAGTGAAGGCCTCCTGAGGAAGG + Intronic
1122941988 14:104985650-104985672 CAGCGGAGGCGGCCCGGGGCAGG + Intergenic
1123034753 14:105467356-105467378 CAGTGAAAGCCGCCTGGCGAAGG - Intronic
1124215579 15:27805344-27805366 CCGCGAAGGAGGCCTGGGCTGGG + Intronic
1125464599 15:39938312-39938334 CTGCGAATGTGGTCTGGGGAAGG - Intronic
1127763583 15:62164480-62164502 CAGCGAGCGCGTCCTGGGGCAGG + Exonic
1127872219 15:63083164-63083186 CAGCAACAGGGGCCTGGGGAAGG - Intergenic
1128261546 15:66236409-66236431 CAGGGAATGTGGACTGGGGAGGG + Intronic
1128313379 15:66645376-66645398 CAGAGAAGGCTGCCTGGAGGAGG - Intronic
1128766854 15:70256473-70256495 CAGGGAAGGCTTCCTGGAGAAGG + Intergenic
1129661827 15:77557046-77557068 CAGCGAAGGAGAAATGGGGAGGG + Intergenic
1129871328 15:78943842-78943864 AAGCGAGGGCTGCCTGGAGAAGG - Intronic
1131457862 15:92597319-92597341 GAGAGAAGGAGGCCTGGGAAAGG + Intergenic
1132764299 16:1526548-1526570 CAGCCACGGCCCCCTGGGGAAGG - Intronic
1132867999 16:2103338-2103360 CACCGACGGAGGCCTGGGGCTGG + Exonic
1133000850 16:2850695-2850717 CAGCAAAGGAGGGCTGGAGAGGG + Intergenic
1134388334 16:13795043-13795065 CAGTTAGGGCAGCCTGGGGATGG + Intergenic
1134523772 16:14929776-14929798 CACCGACGGAGGCCTGGGGCTGG - Intronic
1134549130 16:15131159-15131181 CACCGACGGAGGCCTGGGGCTGG + Intronic
1134711363 16:16328261-16328283 CACCGACGGAGGCCTGGGGCTGG - Intergenic
1134719213 16:16371564-16371586 CACCGACGGAGGCCTGGGGCTGG - Intergenic
1134948213 16:18340321-18340343 CACCGACGGAGGCCTGGGGCTGG + Intergenic
1134955466 16:18380432-18380454 CACCGACGGAGGCCTGGGGCTGG + Intergenic
1135918365 16:26626025-26626047 CATCCAAGGCTGCCTGGGTAGGG + Intergenic
1136268188 16:29132921-29132943 GAGAGACGGCGGCTTGGGGAAGG - Intergenic
1138280251 16:55767582-55767604 GAGTGAAGGCAGCTTGGGGAGGG + Intergenic
1138288236 16:55826056-55826078 GAGTGAAGGCAGCTTGGGGAGGG - Intronic
1138459315 16:57138626-57138648 CAGGGAAGGCTGCTTGGGGGAGG - Intronic
1138585048 16:57964052-57964074 CAGCTAGGGAGCCCTGGGGATGG - Intronic
1140225088 16:73070749-73070771 GAATGCAGGCGGCCTGGGGAGGG - Intergenic
1140478107 16:75249028-75249050 CAGAGGAGGTGGCATGGGGAGGG + Intronic
1140481509 16:75265254-75265276 CAGCCAAGCCGTCCTGGGGGAGG + Intronic
1141254329 16:82386566-82386588 CAGGGGAGGCTGCCTGGGGGAGG + Intergenic
1141701935 16:85646614-85646636 CAGGGAAGGGGGCTTGGGGAGGG + Intronic
1141733021 16:85834887-85834909 CAGCGAAGGGGGCTTGGTGAGGG + Intergenic
1142071499 16:88093259-88093281 GAGAGACGGCGGCTTGGGGAAGG - Intronic
1142171081 16:88623209-88623231 CCGCGAAGACGACCTGGGGCGGG - Exonic
1143527665 17:7481927-7481949 CAGCCCAGGCGACCTGGGGCAGG - Intronic
1143660108 17:8319343-8319365 CAGGGAAGGGGGCCTGGGGTTGG - Exonic
1144967289 17:19085617-19085639 CAGGGAAAGCTCCCTGGGGATGG + Intergenic
1144980631 17:19166449-19166471 CAGGGAAAGCTCCCTGGGGATGG - Intergenic
1144987591 17:19211784-19211806 CAGGGAAAGCTCCCTGGGGATGG + Intergenic
1145899190 17:28478939-28478961 CAGGGAAGGCCTCCTGAGGAGGG + Intronic
1147177841 17:38667653-38667675 CAGAGAAGGGTGGCTGGGGAAGG - Intergenic
1147725182 17:42562508-42562530 CAGAGAAGGAGGCCTGGAGCAGG - Intronic
1148177135 17:45576482-45576504 CAGAGAAGGCAGGCTGGAGAGGG + Intergenic
1148695778 17:49557226-49557248 CGGCGAAGGGGGACTGGAGAGGG - Intergenic
1148698039 17:49572885-49572907 CAACTAAGGCTCCCTGGGGATGG + Intergenic
1148889960 17:50800244-50800266 CAGAGGAGGGGGCTTGGGGAAGG + Intergenic
1148945655 17:51260061-51260083 CGGCGCAGGCGCGCTGGGGAGGG - Exonic
1150561919 17:66302323-66302345 CGGCGGCGGCGGCCGGGGGAGGG - Intergenic
1150748224 17:67834089-67834111 CAGAGAAGGCAGGCTGGAGAAGG - Intronic
1151547271 17:74800814-74800836 CAGGAAAGGTGGCCTGGGGAGGG + Intronic
1152228576 17:79103724-79103746 CAGAGAGGGCAGGCTGGGGAGGG - Intronic
1152759047 17:82098737-82098759 CAGCGACGGCGGCGTGGAGTCGG - Intergenic
1153948655 18:10038655-10038677 CAGGGAAGGCTTCCTGGGGAAGG + Intergenic
1155152976 18:23136514-23136536 CTGCGAAGTCGGCCTGGAGAAGG - Exonic
1157446669 18:47751457-47751479 CAGGGAAGGCTTTCTGGGGAGGG - Intergenic
1157693005 18:49698974-49698996 CAGAGAAGGCTTCCTGGAGAGGG - Intergenic
1158152997 18:54393461-54393483 CAGATAAGGAGGCCTGTGGAAGG - Intergenic
1158648190 18:59265628-59265650 TAGCGAAGGCGGGGAGGGGAAGG - Intergenic
1160453694 18:78980964-78980986 CAGCGGCGGCGGCCTGGGCCTGG + Intronic
1160538004 18:79605597-79605619 CAGAGAAGGAGCCCTGGGGGAGG - Intergenic
1160922913 19:1529042-1529064 CAGAGAAGCCGGCATGGGGGAGG - Intronic
1161219838 19:3113498-3113520 CACCGCTGGCGGCCTGGGGACGG + Intronic
1161700674 19:5793285-5793307 AAGGGAAGGCTTCCTGGGGAAGG + Intergenic
1161771524 19:6233542-6233564 AAGGGAGGGCGGCCTAGGGAGGG + Intronic
1162020353 19:7865398-7865420 CAGGGAAGGCTTCCTGGGGGAGG + Intergenic
1162039796 19:7963841-7963863 CAGCGCAGGCGGCCTGGGGATGG + Intronic
1162470916 19:10871639-10871661 CAGCGGCGGCGGCCTGGGCCCGG + Exonic
1162744660 19:12791744-12791766 CGGCCCAGGCGGTCTGGGGAGGG - Exonic
1163251500 19:16128716-16128738 CAGCCCAGGTGGCCTGGGGAGGG - Intronic
1163268361 19:16234571-16234593 CAGAGCAGATGGCCTGGGGAAGG - Exonic
1163648525 19:18503787-18503809 CAGGGAAGGCTCCCTGAGGAGGG - Intronic
1164389577 19:27806080-27806102 CAGCCAAGGCAGCCTGGGCCTGG - Intergenic
1165243077 19:34482363-34482385 CACCGAAGGCGGCCCGGGACCGG - Exonic
1165311208 19:35030428-35030450 CGGCGGCGGCGGCCTAGGGAGGG - Intergenic
1165893039 19:39126104-39126126 CAGCGAAGGGGGCGTGGCGAAGG + Intronic
1165951248 19:39474902-39474924 CAGGGAGGGCTGCCTGGGGAAGG + Intronic
1166091509 19:40512461-40512483 CAGGGAAGGCTGCCTGGAGGAGG + Intronic
1166546866 19:43639429-43639451 CAGCGGGACCGGCCTGGGGAGGG + Intronic
1166990623 19:46690507-46690529 CAGGGAAGGCTTCCTGGGGGAGG - Intronic
1167270545 19:48503411-48503433 CAGAGATGGGGACCTGGGGAAGG - Intronic
1168064159 19:53909752-53909774 CAGCGAGCGTGGGCTGGGGAGGG + Intronic
1168342756 19:55635181-55635203 CTGCGAAGGAGGCTTGGGGAGGG + Intronic
926219352 2:10924826-10924848 CAGAGAAGGCTTCCTGGGGGAGG - Intergenic
926286463 2:11492744-11492766 CACTGAAGGCCTCCTGGGGAGGG + Intergenic
926584316 2:14669417-14669439 GAGAGAAGGAGCCCTGGGGATGG + Intergenic
927484838 2:23481478-23481500 CAGCGAGGGCTGACTGGGGTGGG - Intronic
927679836 2:25132065-25132087 CACCGGGGGCGGCCCGGGGATGG + Intronic
932213341 2:69949226-69949248 CAGCGATGGCCACTTGGGGATGG + Intergenic
936088151 2:109483777-109483799 CAGCGCCTGCAGCCTGGGGAGGG - Intronic
936168399 2:110145041-110145063 TAGAGAAGGCGGCATGGGGAGGG - Intronic
937019107 2:118634006-118634028 CAGCGGAGGCTGCCTGGAGGAGG - Intergenic
937907662 2:127060285-127060307 CTGGGAAGGAGGCCTGGGGAGGG - Intronic
941110310 2:161414366-161414388 CTGCGCTGGCGGCCTGGGCAGGG - Intergenic
943669836 2:190648987-190649009 CGGCGGAGGCGGGCGGGGGAGGG + Intronic
946250155 2:218406614-218406636 AAGCAAAGGCTGGCTGGGGACGG - Intergenic
946312062 2:218887539-218887561 CAGAGAAGAGGGGCTGGGGATGG - Intronic
946743193 2:222820123-222820145 CAGGGAAGGCTGCCTGGAGGAGG - Intergenic
947999637 2:234557216-234557238 AAGAGAAGGTGGGCTGGGGAAGG + Intergenic
948367772 2:237469606-237469628 GAGCGAAGGCGGGGTGGGGGCGG + Intergenic
948747446 2:240106891-240106913 CAGTGTAGGTGGCCTGGGGTGGG + Intergenic
948799447 2:240425074-240425096 CAGCCACGGTGGCCTGGGCATGG + Intergenic
1168831414 20:847086-847108 CAGCCAAGGCAGCCTGTGAAAGG - Intronic
1169135317 20:3193832-3193854 CTGGGAAGGCTTCCTGGGGAGGG + Intronic
1172762012 20:37329525-37329547 CAGCTAAGCCTGGCTGGGGAGGG - Intergenic
1173806319 20:45927664-45927686 CAGGGAAGGCTGCCTGGTGGAGG + Intergenic
1174196153 20:48774277-48774299 CAGTGAAGGCTGCCTGGAGGAGG + Intronic
1174405143 20:50298032-50298054 CAGGGAAGGCTTCCTGGAGAAGG - Intergenic
1175516915 20:59575896-59575918 CAGTGCAGGGGGCCTGCGGAAGG + Intergenic
1175926860 20:62475470-62475492 CGGCGTAGGCGGCCTGGCGGGGG + Exonic
1176381694 21:6117044-6117066 CGGGGAACGCGGCCTCGGGAAGG - Intronic
1177782940 21:25639642-25639664 CTGAGAAGGCGCCCCGGGGAGGG + Exonic
1178358833 21:31931616-31931638 CAAGCAAGGGGGCCTGGGGAAGG - Intronic
1178878294 21:36429268-36429290 AAGGGACGGCGGCCTGGGAAGGG + Intergenic
1179173625 21:38991775-38991797 CAGAGAAGGCTGCCTGGAGGAGG - Intergenic
1179360791 21:40706298-40706320 TAGCAAAGGCAGCCTGGGTAAGG + Intronic
1179457426 21:41508643-41508665 CAGCCTAGGCGGACTGGGGAGGG - Intronic
1179741778 21:43421195-43421217 CGGGGAACGCGGCCTCGGGAAGG + Intronic
1180014941 21:45075374-45075396 CAGGGGAGGCTGCCTTGGGAGGG + Intronic
1180067672 21:45420737-45420759 CAGGGAAGGCAGCCTGGAGAAGG + Intronic
1180593871 22:16961516-16961538 CAGGGAGGACGGCCTGGGGTGGG - Intergenic
1181286410 22:21755435-21755457 CAGTGAAGGCCGCCTGTGGCCGG - Exonic
1181475505 22:23165413-23165435 CAGTGAAGGCGGTTTGGGGCTGG + Intergenic
1181720778 22:24772941-24772963 CACCCAGGGAGGCCTGGGGAGGG - Intronic
1181959514 22:26612851-26612873 CAGAGAAGGCTTCCTGGAGAAGG - Intronic
1182084887 22:27554744-27554766 CATCCAAGGAGGCCAGGGGACGG + Intergenic
1182518418 22:30871819-30871841 CAGTGAAGCCGGCTTGGGGCAGG - Intronic
1182898140 22:33875531-33875553 CAGGCATGGCGGGCTGGGGAGGG - Intronic
1183187396 22:36299915-36299937 AAGCAAAGGGGCCCTGGGGAAGG - Intronic
1183379219 22:37482556-37482578 CAGGGAAGGCTTCCTGGGGAAGG - Intronic
1183479081 22:38052988-38053010 CAGCGAAGGCTTCCTGGAGGAGG - Intergenic
1183742086 22:39674403-39674425 CAGGGAAGGCAGCCTAGGAAAGG + Intronic
1184236401 22:43185569-43185591 CAGGCAAGGCGGCCTGGGCAGGG + Intronic
1184334690 22:43846167-43846189 CAGTGTCGGCAGCCTGGGGAAGG - Intronic
1184671364 22:46013754-46013776 CTGGGAAGGCGGCCGGGGGGAGG - Intergenic
949880833 3:8659424-8659446 CAGGGAAGGCTGCCTGGAGGAGG - Intronic
950180354 3:10908576-10908598 CAGAGAAGGCTGCCTGGAGGAGG - Intronic
950186303 3:10947782-10947804 CAGGGAAGGCCTCATGGGGAAGG + Intergenic
950492989 3:13317550-13317572 CAGTGAAGCTGGCCTGGGGCCGG + Exonic
950614442 3:14147820-14147842 ACACGGAGGCGGCCTGGGGAAGG + Intronic
953884080 3:46705806-46705828 CAGCGGAGGCGGCTTGGGCTTGG - Exonic
954068516 3:48125964-48125986 CAGGGAAGGCCTCCTGGGGGTGG + Intergenic
954384873 3:50238713-50238735 CTGCCATGGCTGCCTGGGGAGGG + Intronic
954983377 3:54767015-54767037 CAGAGAAGATGGCTTGGGGAGGG - Intronic
956426922 3:69145329-69145351 CTGCAAAGGGAGCCTGGGGAGGG + Intergenic
956974712 3:74566293-74566315 AAGCGAAGGTGGCCTGGGGGTGG - Intergenic
959576866 3:107943924-107943946 CAGCAAAGGCTGCTAGGGGAAGG - Intergenic
961645953 3:128392896-128392918 CACTGAAGGAGGTCTGGGGAGGG - Intronic
961657750 3:128452686-128452708 TGGCGACGGCCGCCTGGGGAGGG + Intergenic
963063197 3:141241503-141241525 CAGGGAAGGCTTCCAGGGGAAGG + Intronic
967272631 3:187743793-187743815 CGGCGGCGGCGGCCCGGGGAGGG - Intronic
968563488 4:1296998-1297020 CAGGGAGAGAGGCCTGGGGAGGG - Intronic
968830685 4:2931734-2931756 CTGCCAAGGCTTCCTGGGGATGG + Intronic
968880155 4:3294382-3294404 TAGAGAAGGCGACGTGGGGAGGG + Intronic
969226078 4:5799167-5799189 CAGCAGAGGCGGCCAGGGGCAGG - Intronic
969251812 4:5973237-5973259 CAGAGCAGGCTGCCTGGGCAAGG + Intronic
969317390 4:6390449-6390471 CTGGGAAGGGAGCCTGGGGATGG - Intronic
969440382 4:7213367-7213389 CATGGAGGGCAGCCTGGGGAGGG + Intronic
970170271 4:13282373-13282395 CTGCAAAGGCCGCCTGGGAAAGG - Intergenic
970737912 4:19196026-19196048 CAGTGAAGGGGGGCCGGGGATGG + Intergenic
974163245 4:58167414-58167436 CAGCTAAGGCGGTGTGGAGATGG - Intergenic
975843154 4:78498091-78498113 CAGGGACGGGGGCCTGGGGAAGG + Intronic
981659516 4:147149135-147149157 CAAGGAAGGTGGCCTGGGGTGGG - Intergenic
984668070 4:182449099-182449121 CGGCGGCGGCGGCCTGGGGCGGG + Intronic
985476431 5:81880-81902 CAGGGGAGGCTTCCTGGGGAAGG + Intergenic
985632633 5:1021970-1021992 CAGGGAAGGAGGCCAGGGGTTGG - Intronic
988717078 5:33838758-33838780 CAGAGAAGAGGACCTGGGGAGGG + Intronic
992444042 5:76818937-76818959 CAGGGAAGGGGGCCGGGGGCGGG + Intronic
992913737 5:81425917-81425939 CACAGAAGGAGGCCTGGGAAGGG - Intronic
992996671 5:82340629-82340651 CAGTGAAGGCTGCCTCTGGAGGG + Intronic
993902792 5:93595910-93595932 CAGAGTATGCGGCCCGGGGAGGG - Intergenic
997266324 5:132497110-132497132 CAGCGGCGGGGGCCGGGGGACGG + Intergenic
997560997 5:134846114-134846136 CAGAGGCGGCGGGCTGGGGAGGG + Exonic
999871392 5:155755004-155755026 CAGAGGTGGCAGCCTGGGGAGGG - Intergenic
1000469591 5:161623763-161623785 CAGCGGTGGCGGCTAGGGGAGGG + Intronic
1000983876 5:167846057-167846079 CAGTGAACTCTGCCTGGGGAAGG - Intronic
1001022135 5:168191820-168191842 CAGCGAGGGTGGGATGGGGAAGG + Intronic
1001810446 5:174623524-174623546 CAGGCAAGCCAGCCTGGGGAAGG - Intergenic
1002178833 5:177419075-177419097 CAGCTGAGGCTGCCGGGGGAAGG + Intronic
1002460160 5:179369336-179369358 GAGCGAAGGCGGCTTTGGGAGGG - Intergenic
1002915226 6:1523564-1523586 CGGGGAAGTGGGCCTGGGGAGGG - Intergenic
1003062804 6:2875993-2876015 CTGGGGAGGCGGCCTGGGGGAGG - Intergenic
1006361178 6:33588256-33588278 CAGGGCAGGCTGGCTGGGGAGGG - Intergenic
1006379468 6:33689133-33689155 CCGGGAAGGCGGCCAGGAGAAGG + Intronic
1006646063 6:35515055-35515077 CAGGCAAGGCTGCCTGAGGAAGG + Intergenic
1006706765 6:36027570-36027592 GCGCGAAGGCGGACCGGGGAAGG - Intergenic
1006986410 6:38178569-38178591 CAGGGAAGGCTTCCTGGGGGAGG + Intronic
1007383117 6:41503273-41503295 GAGCGAAGACGGCCGGGGGCAGG + Intergenic
1012438780 6:99242469-99242491 CAGCGAAGGTGGCCTGAGCTGGG + Intergenic
1016861374 6:148721919-148721941 CAGGGAAGGAGACCTGGAGAGGG - Intergenic
1017086658 6:150718814-150718836 TAGCGCATGAGGCCTGGGGAGGG - Intronic
1018400322 6:163414594-163414616 CAGCGGCGGCGGCGGGGGGAGGG - Intronic
1019442030 7:1052369-1052391 CACCGACGTGGGCCTGGGGAGGG + Intronic
1019524031 7:1472755-1472777 CAGGGGAGGCTTCCTGGGGAGGG + Intronic
1020846718 7:13294403-13294425 CAGAACAGGAGGCCTGGGGAAGG + Intergenic
1023466750 7:40464404-40464426 CAGGGAAGGCTTCCTGGAGATGG + Intronic
1024632831 7:51263272-51263294 CAGGCCAGGAGGCCTGGGGAGGG + Intronic
1025056847 7:55772074-55772096 CAGCAAAGGCACCCTGGGGGAGG + Intergenic
1025606654 7:63044476-63044498 CAGGGAAGGCTTCCTGGGGGAGG - Intergenic
1026360374 7:69597847-69597869 CCGAGAAGGCGGCCTCGGGCCGG + Intergenic
1031420955 7:121551067-121551089 CAGGGAAGGGGGCCTGGGTGGGG - Intergenic
1032784627 7:135191127-135191149 CAGCAAAGGCAGCCAGAGGATGG + Intronic
1033220515 7:139524004-139524026 GGGCGAACGCGGCCTGGGGGCGG - Exonic
1034406375 7:150905528-150905550 CAGCAGAGGAGGCCTGGAGAGGG + Intergenic
1034590079 7:152131322-152131344 CAGGCCAGGCGGCCTTGGGATGG + Intergenic
1035021198 7:155801491-155801513 CAGAGGAGGTGGCCTGGGGATGG - Exonic
1037634945 8:20693235-20693257 CTGAGAAGGCAGCCTGGGGAGGG + Intergenic
1037856427 8:22374449-22374471 CAGAGAAGGCTTCTTGGGGAGGG + Intronic
1039321087 8:36432301-36432323 CAGGGAAGGGGGAGTGGGGAAGG + Intergenic
1039604035 8:38866240-38866262 CAGGGGAGGCAGACTGGGGAAGG + Intergenic
1040109217 8:43559065-43559087 CAGCCAAGGAGGCCTCGGGTTGG - Intergenic
1043284857 8:78516222-78516244 CAGGGAAGGCAGCCTGGAAACGG - Exonic
1044857016 8:96486766-96486788 CAGCGAAGGCTTCCTGGAGGAGG + Intergenic
1044985562 8:97753633-97753655 GAGCACAGGAGGCCTGGGGATGG + Intergenic
1045192042 8:99893059-99893081 CAGCTAACGCGGCCGGGGGTAGG + Intronic
1045861058 8:106815417-106815439 TGCTGAAGGCGGCCTGGGGAAGG + Intergenic
1046044624 8:108948879-108948901 CAGCCAGGGAGGACTGGGGAAGG - Intergenic
1048916990 8:139194636-139194658 CAGGGAAGCCTGCCTGAGGATGG + Intergenic
1049285892 8:141775009-141775031 CAGAGAAGTCAGCCTGGGGAGGG + Intergenic
1049412951 8:142481541-142481563 CAGCGAGGGCTGCCTGGGGAGGG + Exonic
1049755294 8:144308821-144308843 CAGAAGGGGCGGCCTGGGGAAGG + Intronic
1050132518 9:2427431-2427453 CAGAGAAGACAGCTTGGGGAAGG + Intergenic
1051403088 9:16704850-16704872 CAGGGACGGAGGCCAGGGGAGGG + Intronic
1053195261 9:36112670-36112692 CAGTTAATGCAGCCTGGGGAAGG + Intronic
1056126307 9:83538701-83538723 GAGCGACAGCGGCCAGGGGAGGG - Intergenic
1056198250 9:84249577-84249599 CATACAAGGAGGCCTGGGGAAGG + Intergenic
1056681647 9:88724638-88724660 CAGCAGAGACGGCCAGGGGAGGG + Intergenic
1057279912 9:93701932-93701954 CTGCAGAGGCGGCCTGGGGCTGG - Intergenic
1057309590 9:93933690-93933712 CAGCAAATGCTGCCGGGGGAAGG + Intergenic
1057739123 9:97696871-97696893 CAGCGAAGAAGGCCCGGGGCTGG + Intronic
1057949817 9:99360829-99360851 CAGAGAAGGCATCCAGGGGAAGG - Intergenic
1058759718 9:108119255-108119277 CAACGAAGGCCTCCTGGGGCAGG + Intergenic
1060726415 9:126008806-126008828 CATGGAAGGGGGCCTGGGCAGGG + Intergenic
1060999232 9:127893511-127893533 CAGGGAAGGCTGCCTTGGGGAGG - Intronic
1061231673 9:129319243-129319265 CAGCAGAGGGGGCCAGGGGAGGG - Intergenic
1061808628 9:133149721-133149743 CAGCGAACTCAGCCTGGGCAGGG + Intergenic
1062048535 9:134435469-134435491 CAGAGAAGGCTGGCCGGGGAGGG - Intronic
1062424714 9:136500794-136500816 CAGCGGGGGCGGCCTGGAGACGG - Exonic
1187417290 X:19104221-19104243 CAGTGAGGGAGGCCTGTGGAAGG + Intronic
1188878973 X:35468659-35468681 CAGGGAAGGCAGTGTGGGGAGGG + Intergenic
1192020334 X:67384476-67384498 CAGCTAATGCGGAGTGGGGAAGG - Intergenic